VCJD
MCID: VRN002
MIFTS: 58

Variant Creutzfeldt-Jakob Disease (VCJD) malady

Genetic diseases, Rare diseases, Neuronal diseases, Infectious diseases, Mental diseases categories
Download this MalaCard

Summaries for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
43NIH Rare Diseases, 47OMIM, 33MalaCards
See all sources

Fully expand this MalaCard
NIH Rare Diseases:43 There are several known variants of creutzfeldt-jakob disease (cjd). these variants differ somewhat in the symptoms and course of the disease. for example, a variant form of the disease-called new variant or variant (nv-cjd, v-cjd), described in great britain and france, begins primarily with psychiatric symptoms, and has a longer than usual duration from onset of symptoms to death. new variant cjd accounts for less than 1% of cases, and tends to affect younger people. it can result when someone is exposed to contaminated products. while classic cjd is not related to mad cow disease, new variant cjd (nvcjd) is an infectious form that is related to mad cow disease. the infection responsible for the disease in cows (bovine spongiform encephalitis) is believed to be the same one responsible for vcjd in humans. there have not been any cases of nvcjd reported in the u.s.another variant, called the panencephalopathic form, occurs primarily in japan and has a relatively long course, with symptoms often progressing for several years. scientists are trying to gain a better understanding about what causes these variations in the symptoms and course of the disease. last updated: 1/28/2009

MalaCards: Variant Creutzfeldt-Jakob Disease, also known as bovine spongiform encephalopathy, is related to creutzfeldt-jakob disease and kuru. An important gene associated with Variant Creutzfeldt-Jakob Disease is HLA-DQB1 (major histocompatibility complex, class II, DQ beta 1). The compounds hemocyanin and gliadin have been mentioned in the context of this disorder. Affiliated tissues include brain, tonsil and testes, and related mouse phenotypes are cellular and hematopoietic system.

Description from OMIM:47 123400

Aliases & Classifications for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
8Disease Ontology, 43NIH Rare Diseases, 10DISEASES, 47OMIM, 45Novoseek, 62UMLS, 35MeSH, 58SNOMED-CT
See all sources

Classifications:



Aliases & Descriptions:

variant creutzfeldt-jakob disease 8 43
bovine spongiform encephalopathy 8 10
new variant creutzfeldt-jakob disease 62
creutzfeldt-jakob disease, variant 47
variant creutzfeldt-jacob disease 43
encephalopathy bovine spongiform 45
new variant of cjd 43
variant cjd 43
nv-cjd 43
vcjd 43


External Ids:

Disease Ontology8 DOID:5435
SNOMED-CT58 52869003
MeSH35 D016643

Related Diseases for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
17GeneCards, 18GeneDecks
See all sources

Diseases in the Creutzfeldt-Jakob Disease family:

variant creutzfeldt-jakob disease Familial Creutzfeldt-Jakob Disease

Diseases related to Variant Creutzfeldt-Jakob Disease via text searches within MalaCards or GeneCards/GeneDecks gene sharing:

(show top 50)    (show all 55)
idRelated DiseaseScoreTop Affiliating Genes
1creutzfeldt-jakob disease32.3ENO2, PRNP, PRND, TPPP3, APOE
2kuru31.2PRNP
3prion disease31.1PRNP, PRND
4scrapie30.8PRNP, PRND
5dementia30.4APOE, TPPP3, PRNP, TBP
6alzheimer's disease30.4APOE, PRND, PRNP, TBP, CTSD
7multiple sclerosis30.3HLA-DQB1, APOE, TPPP3, IL7
8tonsillitis10.7
9chronic wasting disease10.6
10neuronitis10.6
11brain disease10.4
12alpers syndrome10.3
13tauopathy10.3
14cerebritis10.3
15chorea10.3
16obesity10.3
17severe combined immunodeficiency10.3
18spasticity10.3
19genetic prion diseases10.1PRNP
20subacute sclerosing panencephalitis10.1
21myoclonus10.1
22persistent vegetative state10.1ENO2
23malaria10.1TBP
24spinocerebellar ataxia type 1210.1TBP, PRNP
25dentatorubral-pallidoluysian atrophy10.1PRNP, TBP
26spinocerebellar ataxia10.1TBP, PRNP
27huntington's disease10.1TPPP3, PRNP, TBP
28hepatitis b10.0TBP, HLA-DQB1
29tubular adenocarcinoma10.0ENO2, CTSD
30cerebral amyloid angiopathy10.0PRNP, APOE
31progressive supranuclear palsy10.0APOE, PRNP
32lewy body dementia10.0APOE, PRNP
33vascular dementia10.0APOE, PRNP
34age related macular degeneration10.0APOE, CTSD
35familial creutzfeldt-jakob disease10.0APOE, PRND, PRNP
36alzheimer disease type 210.0APOE, CTSD
37herpes simplex10.0CTSD, TBP, IL7
38amyloid tumor10.0PRNP, APOE
39memory impairment10.0APOE, PRNP
40bullous pemphigoid10.0HLA-DQB1, IL7
41amyloidosis10.0CTSD, PRNP, APOE
42astrocytoma10.0RARB, PRNP, PRND
43hemorrhage, intracerebral10.0ENO2, PRNP, APOE
44ipex syndrome10.0HLA-DQB1, PRNP, IL7, TBP
45parkinson's disease10.0APOE, TPPP3, PRNP, TBP
46tuberculosis10.0CTSD, TBP, IL7, HLA-DQB1
47stomach cancer10.0CTSD, RARB, PRNP
48lung small cell carcinoma10.0RARB, ENO2, CTSD
49atherosclerosis10.0AHSP, APOE, PRNP, IL7
50cerebrovascular disease10.0APOE, TPPP3, PRNP, ENO2

Graphical network of the top 20 diseases related to Variant Creutzfeldt-Jakob Disease:



Diseases related to variant creutzfeldt-jakob disease

Symptoms for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
47OMIM
See all sources

Symptoms by clinical synopsis from OMIM:

123400

Clinical features from OMIM:

123400

Drugs & Therapeutics for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
42NIH Clinical Center, 6ClinicalTrials, 62UMLS, 41NDF-RT
See all sources

Drug clinical trials:

Search ClinicalTrials for Variant Creutzfeldt-Jakob Disease

Search NIH Clinical Center for Variant Creutzfeldt-Jakob Disease

Genetic Tests for Variant Creutzfeldt-Jakob Disease

About this section

Anatomical Context for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
33MalaCards
See all sources

MalaCards organs/tissues related to Variant Creutzfeldt-Jakob Disease:

33
Brain, Tonsil, Testes, Spleen, Appendix, Eye, Pituitary, Cortex, Cerebellum, Liver, Thalamus

Animal Models for Variant Creutzfeldt-Jakob Disease or affiliated genes

About this section
Sources:
37MGI
See all sources

MGI Mouse Phenotypes related to Variant Creutzfeldt-Jakob Disease:

37
idDescriptionMGI Source AccessionScoreTop Affiliating Genes
1MP:00053848.2CTSD, ENO2, PRNP, APOE, AHSP, HLA-DQB1
2MP:00053977.9HLA-DQB1, AHSP, APOE, PRNP, IL7, RARB
3MP:00053877.7HLA-DQB1, AHSP, APOE, PRND, PRNP, IL7
4MP:00053787.6SPRN, HLA-DQB1, APOE, PRNP, RARB, TBP
5MP:00053867.6CTSD, SPRN, HLA-DQB1, APOE, PRND, PRNP
6MP:00036317.5SPRN, HLA-DQB1, APOE, PRND, PRNP, RARB
7MP:00107687.5SPRN, HLA-DQB1, AHSP, APOE, PRNP, RARB

Publications for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
52PubMed
See all sources

Articles related to Variant Creutzfeldt-Jakob Disease:

(show top 50)    (show all 353)
idTitleAuthorsYear
1
Human prion diseases: from kuru to variant creutzfeldt-jakob disease. (23225013)
2012
2
Diagnosing variant Creutzfeldt-Jakob disease: a retrospective analysis of the first 150 cases in the UK. (21172857)
2011
3
The first report of a patient with probable variant creutzfeldt-jakob disease in Turkey. (22279448)
2011
4
Validation of diagnostic criteria for variant Creutzfeldt-Jakob disease. (20517937)
2010
5
Photo essay. MRI and positron emission tomography findings in Heidenhain variant Creutzfeldt-Jakob disease. (20581692)
2010
6
Variant Creutzfeldt-Jakob disease and exposure to fractionated plasma products. (19538514)
2009
7
Survival and re-operation rates after neurosurgical procedures in Scotland: implications for targeted surveillance of sub-clinical variant Creutzfeldt-Jakob disease. (19299901)
2009
8
"Hot cross bun" sign in variant Creutzfeldt-Jakob disease. (19279286)
2009
9
Report of the Working Group 'Overall Blood Supply Strategy with Regard to Variant Creutzfeldt-Jakob Disease (vCJD)': Statement on the Development and Implementation of Test Systems Suitable for the Screening of Blood Donors for vCJD - Dated September 17, 2008. (21048823)
2009
10
PRNP variation in UK sporadic and variant Creutzfeldt Jakob disease highlights genetic risk factors and a novel non-synonymous polymorphism. (20035629)
2009
11
Variant Creutzfeldt-Jakob disease: French versus British. (19334065)
2009
12
Review. The neuropathology of kuru and variant Creutzfeldt-Jakob disease. (18849282)
2008
13
Two cases of variant Creutzfeldt-Jakob disease reported in Spain in 2007 and 2008. (18445462)
2008
14
Size frequency distributions of abnormal protein deposits in Alzheimer's disease and variant Creutzfeldt-Jakob disease. (17849360)
2007
15
In vitro amplification and detection of variant Creutzfeldt-Jakob disease PrPSc. (17614097)
2007
16
Blood-transmitted prions and variant Creutzfeldt-Jakob disease. (17317213)
2007
17
Neuropathological changes in striate and extrastriate visual cortex in variant Creutzfeldt-Jakob disease (vCJD). (19668500)
2007
18
A new human genotype prone to variant Creutzfeldt-Jakob disease. (16709965)
2006
19
Is variant Creutzfeldt-Jakob disease in young children misdiagnosed as Alpers' syndrome? An analysis of a national surveillance study. (15146014)
2004
20
Possible transmission of variant Creutzfeldt-Jakob disease by blood transfusion. (14962520)
2004
21
Small de novo duplication in the repeat region of the TATA-box-binding protein gene manifest with a phenotype similar to variant Creutzfeldt-Jakob disease. (15521976)
2004
22
Practical aspects of decontamination of the unconventional transmissible agents that cause sporadic and variant Creutzfeldt-Jakob disease and other similar human diseases. (15448715)
2004
23
Variant Creutzfeldt-Jakob disease. (15449462)
2004
24
Technical aspects of the development and validation of tests for variant Creutzfeldt-Jakob disease in blood transfusion. (15078250)
2004
25
Variant Creutzfeldt-Jakob disease. (12733426)
2003
26
Rapid echoplanar diffusion imaging in a case of variant Creutzfeldt-Jakob disease; where speed is of the essence. (12879327)
2003
27
Chorea as a presenting feature of variant Creutzfeldt-Jakob disease. (12815669)
2003
28
Variant Creutzfeldt-Jakob disease. (14535362)
2003
29
Predicting incidence of variant Creutzfeldt-Jakob disease from UK dietary exposure to bovine spongiform encephalopathy for the 1940 to 1969 and post-1969 birth cohorts. (14559750)
2003
30
The biology and epidemiology of variant Creutzfeldt-Jakob disease. (15025265)
2003
31
Diagnosing variant Creutzfeldt-Jakob disease with the pulvinar sign: MR imaging findings in 86 neuropathologically confirmed cases. (13679271)
2003
32
Organ distribution of prion proteins in variant Creutzfeldt-Jakob disease. (12679264)
2003
33
Genetic susceptibility to variant Creutzfeldt-Jakob disease. (12583940)
2003
34
The sympathetic nervous system is involved in variant Creutzfeldt-Jakob disease. (12937415)
2003
35
Age and variant Creutzfeldt-Jakob disease. (14720404)
2003
36
The predictability of the epidemic of variant Creutzfeldt-Jakob disease by back-calculation methods. (12828242)
2003
37
Modelling the epidemic of variant Creutzfeldt-Jakob disease in the UK based on age characteristics: updated, detailed analysis. (12828243)
2003
38
Neuropathology of variant Creutzfeldt-Jakob disease. (11862618)
2002
39
BSE and variant Creutzfeldt-Jakob disease: never say never. (12012095)
2002
40
Variant Creutzfeldt-Jakob disease: an unfolding epidemic of misfolded proteins. (12410862)
2002
41
Tonsillectomy and variant Creutzfeldt-Jakob disease. (11902091)
2002
42
Future uncertain for variant Creutzfeldt-Jakob disease. (12849414)
2002
43
New variant Creutzfeldt-Jakob disease--is our practice safe? (11412169)
2001
44
Afterthoughts about bovine spongiform encephalopathy and variant Creutzfeldt-Jakob disease. (11485682)
2001
45
Bovine spongiform encephalopathy and variant Creutzfeldt-Jakob disease: implications for Australia. (11548083)
2001
46
The pulvinar sign on magnetic resonance imaging in variant Creutzfeldt-Jakob disease. (10791525)
2000
47
The relationship between new variant Creutzfeldt-Jakob disease and bovine spongiform encephalopathy. (10394138)
1999
48
New variant Creutzfeldt-Jakob disease is more common in Britain than elsewhere. (9685298)
1998
49
New variant Creutzfeldt-Jakob disease and bovine spongiform encephalopathy. (9494833)
1998
50
Cerebrospinal-fluid test for new-variant Creutzfeldt-Jakob disease. (8843819)
1996

Variations for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
64UniProtKB/Swiss-Prot, 1 National Center for Biotechnology Information (Clinvar)
See all sources

UniProtKB/Swiss-Prot genetic disease variations for Variant Creutzfeldt-Jakob Disease:

64
id Symbol AA change Variation ID SNP ID
1PRNPp.Asp178AsnVAR_006469
2PRNPp.Val180IleVAR_006470
3PRNPp.Glu200LysVAR_006473
4PRNPp.Arg208HisVAR_006474
5PRNPp.Val210IleVAR_006475
6PRNPp.Met232ArgVAR_006478
7PRNPp.Glu196LysVAR_008749
8PRNPp.Val203IleVAR_008751
9PRNPp.Glu211GlnVAR_008752

Clinvar genetic disease variations for Variant Creutzfeldt-Jakob Disease:

1
id Gene Name Type Significance SNP ID Assembly Location
1PRNPNM_000311.3(PRNP): c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln)NT expansionPathogenicrs367543047
2PRNPNM_000311.3(PRNP): c.385A> G (p.Met129Val)single nucleotide variantBenign, Likely benign, Pathogenic, risk factorrs1799990GRCh37Chr 20, 4680251: 4680251
3PRNPNM_000311.3(PRNP): c.598G> A (p.Glu200Lys)single nucleotide variantPathogenicrs28933385GRCh37Chr 20, 4680464: 4680464
4PRNPNM_000311.3(PRNP): c.385A> G (p.Met129Val)single nucleotide variantBenign, Likely benign, Pathogenic, risk factorrs1799990GRCh37Chr 20, 4680251: 4680251
5PRNPNM_000311.3(PRNP): c.628G> A (p.Val210Ile)single nucleotide variantPathogenicrs74315407GRCh37Chr 20, 4680494: 4680494
6PRNPNM_000311.3(PRNP): c.538G> A (p.Val180Ile)single nucleotide variantPathogenicrs74315408GRCh37Chr 20, 4680404: 4680404
7PRNPNM_000311.3(PRNP): c.695T> G (p.Met232Arg)single nucleotide variantPathogenic, Uncertain significancers74315409GRCh37Chr 20, 4680561: 4680561
8PRNPNM_000311.3(PRNP): c.623G> A (p.Arg208His)single nucleotide variantPathogenicrs74315412GRCh37Chr 20, 4680489: 4680489
9PRNPNM_000311.3(PRNP): c.532G> A (p.Asp178Asn)single nucleotide variantPathogenicrs74315403GRCh37Chr 20, 4680398: 4680398
10PRNPNM_000311.3(PRNP): c.631G> C (p.Glu211Gln)single nucleotide variantPathogenicrs398122370GRCh37Chr 20, 4680497: 4680497

Expression for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section
Sources:
2BioGPS, 15Gene Expression Omnibus DataSets
See all sources
Expression patterns in normal tissues for genes affiliated with Variant Creutzfeldt-Jakob Disease

Search GEO for disease gene expression data for Variant Creutzfeldt-Jakob Disease.

Pathways for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section

Compounds for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section
Sources:
45Novoseek, 24HMDB, 11DrugBank, 29IUPHAR, 61Tocris Bioscience, 51PharmGKB
See all sources

Compounds related to Variant Creutzfeldt-Jakob Disease according to GeneCards/GeneDecks:

(show top 50)    (show all 60)
idCompoundScoreTop Affiliating Genes
1hemocyanin4510.1PRNP, IL7
2gliadin4510.1IL7, HLA-DQB1
3cysteamine45 24 1111.8APOE, CTSD
4edss459.8APOE, ENO2
5agarose459.8PRNP, TBP, CTSD
6sodium dodecylsulfate459.7TBP, PRNP, APOE
7histidine459.6CTSD, TBP, PRNP, HLA-DQB1
8ciglitazone45 2910.5APOE, RARB
9glyceraldehyde 3-phosphate459.5TBP, ENO2, CTSD
10valine459.4CTSD, PRNP, PRND, APOE
11agar459.4IL7, RARB, CTSD
12iron45 2410.4AHSP, PRNP, TBP, ENO2
13formaldehyde45 2410.4CTSD, ENO2, TBP, PRNP
14hyaluronic acid45 2410.3CTSD, ENO2, APOE
15guanine45 24 1111.3ENO2, TBP, APOE
16ibmx45 61 2911.3APOE, RARB, ENO2
17leucine459.3CTSD, ENO2, TBP, PRNP
18dmso459.2PRNP, RARB, ENO2, CTSD
19oligonucleotide459.2TBP, RARB, IL7, HLA-DQB1
20alpha tocopherol459.2APOE, RARB, TBP, CTSD
21paraffin459.1CTSD, ENO2, PRNP, APOE
22pge2459.1AHSP, PRNP, IL7, RARB, CTSD
23steroid459.1CTSD, TBP, RARB, IL7
24cisplatin45 51 61 1112.1CTSD, ENO2, TBP, RARB
25thymidine45 2410.1IL7, RARB, ENO2, CTSD
26adenylate459.1RARB, TBP, ENO2, CTSD
27cycloheximide459.0CTSD, RARB, IL7, APOE
28zinc45 2410.0CTSD, TBP, RARB, PRNP
29aspartate458.9HLA-DQB1, APOE, PRNP, ENO2, CTSD
30dexamethasone45 51 29 1111.9IL7, RARB, TBP, ENO2
31glutamine458.9HLA-DQB1, APOE, TBP, ENO2, CTSD
32indomethacin45 29 61 1111.8AHSP, APOE, ENO2
33arginine458.8RARB, PRNP, APOE, AHSP
34progesterone45 29 61 24 1112.8IL7, RARB, TBP, ENO2, CTSD
35retinoic acid45 249.7IL7, RARB, TBP, ENO2, CTSD
36vegf458.7CTSD, ENO2, IL7, APOE
37oxygen45 249.7AHSP, PRNP, IL7, TBP, ENO2, CTSD
38atp45 299.7AHSP, PRNP, IL7, TBP, ENO2, CTSD
39testosterone45 61 24 1111.6APOE, IL7, RARB, ENO2, CTSD
40heparin45 29 24 1111.5AHSP, APOE, PRNP, IL7, ENO2, CTSD
41cholesterol45 29 24 1111.5AHSP, APOE, PRNP, IL7, ENO2, CTSD
42cysteine458.5AHSP, APOE, IL7, RARB, TBP, CTSD
43dopamine45 29 24 1111.5AHSP, APOE, TPPP3, RARB, ENO2
44alanine458.5APOE, PRNP, IL7, TBP, ENO2, CTSD
45lipid458.4AHSP, APOE, PRNP, IL7, RARB, ENO2
46calcium45 51 24 1111.4AHSP, PRNP, IL7, RARB, ENO2, CTSD
47glutamate458.3CTSD, HLA-DQB1, AHSP, APOE, PRNP, IL7
48serine458.1APOE, PRNP, STMN2, IL7, TBP, CTSD
49estrogen458.0AHSP, APOE, IL7, RARB, TBP, ENO2
50tyrosine457.6HLA-DQB1, TPPP3, PRNP, STMN2, IL7, RARB

GO Terms for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section
Sources:
16Gene Ontology
See all sources

Cellular components related to Variant Creutzfeldt-Jakob Disease according to GeneCards/GeneDecks:

idNameGO IDScoreTop Affiliating Genes
1anchored component of membraneGO:0312259.6PRNP, PRND, SPRN

Biological processes related to Variant Creutzfeldt-Jakob Disease according to GeneCards/GeneDecks:

idNameGO IDScoreTop Affiliating Genes
1cell deathGO:0082199.2CTSD, TBP, APOE

Molecular functions related to Variant Creutzfeldt-Jakob Disease according to GeneCards/GeneDecks:

idNameGO IDScoreTop Affiliating Genes
1tubulin bindingGO:0156319.6PRNP, TPPP3

Products for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section
  • Antibodies
  • Proteins
  • Lysates
  • Antibodies

Sources for Variant Creutzfeldt-Jakob Disease

About this section
4CDC
13ExPASy
14FMA
22GTR
23HGMD
24HMDB
25ICD10
26ICD10 via Orphanet
27ICD9CM
29IUPHAR
30KEGG
35MeSH
36MESH via Orphanet
37MGI
40NCIt
41NDF-RT
44NINDS
45Novoseek
47OMIM
48OMIM via Orphanet
52PubMed
53QIAGEN
59SNOMED-CT via Orphanet
62UMLS
63UMLS via Orphanet