VCJD
MCID: VRN002
MIFTS: 58

Variant Creutzfeldt-Jakob Disease (VCJD) malady

Genetic diseases, Rare diseases, Neuronal diseases, Infectious diseases, Mental diseases categories

Summaries for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
44NIH Rare Diseases, 48OMIM, 34MalaCards
See all sources

Fully expand this MalaCard

Download this MalaCard
NIH Rare Diseases:44 There are several known variants of creutzfeldt-jakob disease (cjd). these variants differ somewhat in the symptoms and course of the disease. for example, a variant form of the disease-called new variant or variant (nv-cjd, v-cjd), described in great britain and france, begins primarily with psychiatric symptoms, and has a longer than usual duration from onset of symptoms to death. new variant cjd accounts for less than 1% of cases, and tends to affect younger people. it can result when someone is exposed to contaminated products. while classic cjd is not related to mad cow disease, new variant cjd (nvcjd) is an infectious form that is related to mad cow disease. the infection responsible for the disease in cows (bovine spongiform encephalitis) is believed to be the same one responsible for vcjd in humans. there have not been any cases of nvcjd reported in the u.s.another variant, called the panencephalopathic form, occurs primarily in japan and has a relatively long course, with symptoms often progressing for several years. scientists are trying to gain a better understanding about what causes these variations in the symptoms and course of the disease. last updated: 1/28/2009

MalaCards: Variant Creutzfeldt-Jakob Disease, also known as bovine spongiform encephalopathy, is related to creutzfeldt-jakob disease and kuru. An important gene associated with Variant Creutzfeldt-Jakob Disease is HLA-DQB1 (major histocompatibility complex, class II, DQ beta 1). The compounds hemocyanin and gliadin have been mentioned in the context of this disorder. Affiliated tissues include brain, tonsil and testes, and related mouse phenotypes are cellular and hematopoietic system.

Description from OMIM:48 123400

Aliases & Classifications for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
9Disease Ontology, 44NIH Rare Diseases, 11DISEASES, 48OMIM, 46Novoseek, 63UMLS, 36MeSH, 59SNOMED-CT
See all sources

Classifications:



Aliases & Descriptions:

variant creutzfeldt-jakob disease 9 44
bovine spongiform encephalopathy 9 11
new variant creutzfeldt-jakob disease 63
creutzfeldt-jakob disease, variant 48
variant creutzfeldt-jacob disease 44
encephalopathy bovine spongiform 46
new variant of cjd 44
variant cjd 44
nv-cjd 44
vcjd 44


External Ids:

Disease Ontology9 DOID:5435
SNOMED-CT59 52869003
MeSH36 D016643

Related Diseases for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
18GeneCards, 19GeneDecks
See all sources

Diseases in the Creutzfeldt-Jakob Disease family:

variant creutzfeldt-jakob disease Familial Creutzfeldt-Jakob Disease

Diseases related to Variant Creutzfeldt-Jakob Disease via text searches within MalaCards or GeneCards/GeneDecks gene sharing:

(show top 50)    (show all 55)
idRelated DiseaseScoreTop Affiliating Genes
1creutzfeldt-jakob disease32.3ENO2, PRNP, PRND, TPPP3, APOE
2kuru31.2PRNP
3prion disease31.1PRNP, PRND
4scrapie30.8PRNP, PRND
5dementia30.4APOE, TPPP3, PRNP, TBP
6alzheimer's disease30.4APOE, PRND, PRNP, TBP, CTSD
7multiple sclerosis30.3HLA-DQB1, APOE, TPPP3, IL7
8tonsillitis10.7
9chronic wasting disease10.6
10neuronitis10.6
11brain disease10.4
12alpers syndrome10.3
13tauopathy10.3
14cerebritis10.3
15chorea10.3
16obesity10.3
17severe combined immunodeficiency10.3
18spasticity10.3
19genetic prion diseases10.1PRNP
20subacute sclerosing panencephalitis10.1
21myoclonus10.1
22persistent vegetative state10.1ENO2
23malaria10.1TBP
24spinocerebellar ataxia type 1210.1TBP, PRNP
25dentatorubral-pallidoluysian atrophy10.1PRNP, TBP
26spinocerebellar ataxia10.1TBP, PRNP
27huntington's disease10.1TPPP3, PRNP, TBP
28hepatitis b10.0TBP, HLA-DQB1
29tubular adenocarcinoma10.0ENO2, CTSD
30cerebral amyloid angiopathy10.0PRNP, APOE
31progressive supranuclear palsy10.0APOE, PRNP
32lewy body dementia10.0APOE, PRNP
33vascular dementia10.0APOE, PRNP
34age related macular degeneration10.0APOE, CTSD
35familial creutzfeldt-jakob disease10.0APOE, PRND, PRNP
36alzheimer disease type 210.0APOE, CTSD
37herpes simplex10.0CTSD, TBP, IL7
38amyloid tumor10.0PRNP, APOE
39memory impairment10.0APOE, PRNP
40bullous pemphigoid10.0HLA-DQB1, IL7
41amyloidosis10.0CTSD, PRNP, APOE
42astrocytoma10.0RARB, PRNP, PRND
43hemorrhage, intracerebral10.0ENO2, PRNP, APOE
44ipex syndrome10.0HLA-DQB1, PRNP, IL7, TBP
45parkinson's disease10.0APOE, TPPP3, PRNP, TBP
46tuberculosis10.0CTSD, TBP, IL7, HLA-DQB1
47stomach cancer10.0CTSD, RARB, PRNP
48lung small cell carcinoma10.0RARB, ENO2, CTSD
49atherosclerosis10.0AHSP, APOE, PRNP, IL7
50cerebrovascular disease10.0APOE, TPPP3, PRNP, ENO2

Graphical network of the top 20 diseases related to Variant Creutzfeldt-Jakob Disease:



Diseases related to variant creutzfeldt-jakob disease

Symptoms for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
48OMIM
See all sources

Symptoms by clinical synopsis from OMIM:

123400

Clinical features from OMIM:

123400

Drugs & Therapeutics for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
6CenterWatch, 43NIH Clinical Center, 7ClinicalTrials, 63UMLS, 42NDF-RT
See all sources

Approved drugs:

Search CenterWatch for Variant Creutzfeldt-Jakob Disease

Drug clinical trials:

Search ClinicalTrials for Variant Creutzfeldt-Jakob Disease

Search NIH Clinical Center for Variant Creutzfeldt-Jakob Disease

Search CenterWatch for Variant Creutzfeldt-Jakob Disease

Genetic Tests for Variant Creutzfeldt-Jakob Disease

About this section

Anatomical Context for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
34MalaCards
See all sources

MalaCards organs/tissues related to Variant Creutzfeldt-Jakob Disease:

34
Brain, Tonsil, Testes, Spleen, Appendix, Eye, Pituitary, Cortex, Cerebellum, Liver, Thalamus

Animal Models for Variant Creutzfeldt-Jakob Disease or affiliated genes

About this section
Sources:
38MGI
See all sources

MGI Mouse Phenotypes related to Variant Creutzfeldt-Jakob Disease:

38
idDescriptionMGI Source AccessionScoreTop Affiliating Genes
1MP:00053848.2CTSD, ENO2, PRNP, APOE, AHSP, HLA-DQB1
2MP:00053977.9HLA-DQB1, AHSP, APOE, PRNP, IL7, RARB
3MP:00053877.7HLA-DQB1, AHSP, APOE, PRND, PRNP, IL7
4MP:00053787.6SPRN, HLA-DQB1, APOE, PRNP, RARB, TBP
5MP:00053867.6CTSD, SPRN, HLA-DQB1, APOE, PRND, PRNP
6MP:00036317.5SPRN, HLA-DQB1, APOE, PRND, PRNP, RARB
7MP:00107687.5SPRN, HLA-DQB1, AHSP, APOE, PRNP, RARB

Publications for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
53PubMed
See all sources

Articles related to Variant Creutzfeldt-Jakob Disease:

(show top 50)    (show all 353)
idTitleAuthorsYear
1
Human prion diseases: from kuru to variant creutzfeldt-jakob disease. (23225013)
2012
2
Diagnosing variant Creutzfeldt-Jakob disease: a retrospective analysis of the first 150 cases in the UK. (21172857)
2011
3
The first report of a patient with probable variant creutzfeldt-jakob disease in Turkey. (22279448)
2011
4
Validation of diagnostic criteria for variant Creutzfeldt-Jakob disease. (20517937)
2010
5
Photo essay. MRI and positron emission tomography findings in Heidenhain variant Creutzfeldt-Jakob disease. (20581692)
2010
6
Variant Creutzfeldt-Jakob disease and exposure to fractionated plasma products. (19538514)
2009
7
Survival and re-operation rates after neurosurgical procedures in Scotland: implications for targeted surveillance of sub-clinical variant Creutzfeldt-Jakob disease. (19299901)
2009
8
"Hot cross bun" sign in variant Creutzfeldt-Jakob disease. (19279286)
2009
9
Report of the Working Group 'Overall Blood Supply Strategy with Regard to Variant Creutzfeldt-Jakob Disease (vCJD)': Statement on the Development and Implementation of Test Systems Suitable for the Screening of Blood Donors for vCJD - Dated September 17, 2008. (21048823)
2009
10
PRNP variation in UK sporadic and variant Creutzfeldt Jakob disease highlights genetic risk factors and a novel non-synonymous polymorphism. (20035629)
2009
11
Variant Creutzfeldt-Jakob disease: French versus British. (19334065)
2009
12
Review. The neuropathology of kuru and variant Creutzfeldt-Jakob disease. (18849282)
2008
13
Two cases of variant Creutzfeldt-Jakob disease reported in Spain in 2007 and 2008. (18445462)
2008
14
Size frequency distributions of abnormal protein deposits in Alzheimer's disease and variant Creutzfeldt-Jakob disease. (17849360)
2007
15
In vitro amplification and detection of variant Creutzfeldt-Jakob disease PrPSc. (17614097)
2007
16
Blood-transmitted prions and variant Creutzfeldt-Jakob disease. (17317213)
2007
17
Neuropathological changes in striate and extrastriate visual cortex in variant Creutzfeldt-Jakob disease (vCJD). (19668500)
2007
18
A new human genotype prone to variant Creutzfeldt-Jakob disease. (16709965)
2006
19
Is variant Creutzfeldt-Jakob disease in young children misdiagnosed as Alpers' syndrome? An analysis of a national surveillance study. (15146014)
2004
20
Possible transmission of variant Creutzfeldt-Jakob disease by blood transfusion. (14962520)
2004
21
Small de novo duplication in the repeat region of the TATA-box-binding protein gene manifest with a phenotype similar to variant Creutzfeldt-Jakob disease. (15521976)
2004
22
Practical aspects of decontamination of the unconventional transmissible agents that cause sporadic and variant Creutzfeldt-Jakob disease and other similar human diseases. (15448715)
2004
23
Variant Creutzfeldt-Jakob disease. (15449462)
2004
24
Technical aspects of the development and validation of tests for variant Creutzfeldt-Jakob disease in blood transfusion. (15078250)
2004
25
Variant Creutzfeldt-Jakob disease. (12733426)
2003
26
Rapid echoplanar diffusion imaging in a case of variant Creutzfeldt-Jakob disease; where speed is of the essence. (12879327)
2003
27
Chorea as a presenting feature of variant Creutzfeldt-Jakob disease. (12815669)
2003
28
Variant Creutzfeldt-Jakob disease. (14535362)
2003
29
Predicting incidence of variant Creutzfeldt-Jakob disease from UK dietary exposure to bovine spongiform encephalopathy for the 1940 to 1969 and post-1969 birth cohorts. (14559750)
2003
30
The biology and epidemiology of variant Creutzfeldt-Jakob disease. (15025265)
2003
31
Diagnosing variant Creutzfeldt-Jakob disease with the pulvinar sign: MR imaging findings in 86 neuropathologically confirmed cases. (13679271)
2003
32
Organ distribution of prion proteins in variant Creutzfeldt-Jakob disease. (12679264)
2003
33
Genetic susceptibility to variant Creutzfeldt-Jakob disease. (12583940)
2003
34
The sympathetic nervous system is involved in variant Creutzfeldt-Jakob disease. (12937415)
2003
35
Age and variant Creutzfeldt-Jakob disease. (14720404)
2003
36
The predictability of the epidemic of variant Creutzfeldt-Jakob disease by back-calculation methods. (12828242)
2003
37
Modelling the epidemic of variant Creutzfeldt-Jakob disease in the UK based on age characteristics: updated, detailed analysis. (12828243)
2003
38
Neuropathology of variant Creutzfeldt-Jakob disease. (11862618)
2002
39
BSE and variant Creutzfeldt-Jakob disease: never say never. (12012095)
2002
40
Variant Creutzfeldt-Jakob disease: an unfolding epidemic of misfolded proteins. (12410862)
2002
41
Tonsillectomy and variant Creutzfeldt-Jakob disease. (11902091)
2002
42
Future uncertain for variant Creutzfeldt-Jakob disease. (12849414)
2002
43
New variant Creutzfeldt-Jakob disease--is our practice safe? (11412169)
2001
44
Afterthoughts about bovine spongiform encephalopathy and variant Creutzfeldt-Jakob disease. (11485682)
2001
45
Bovine spongiform encephalopathy and variant Creutzfeldt-Jakob disease: implications for Australia. (11548083)
2001
46
The pulvinar sign on magnetic resonance imaging in variant Creutzfeldt-Jakob disease. (10791525)
2000
47
The relationship between new variant Creutzfeldt-Jakob disease and bovine spongiform encephalopathy. (10394138)
1999
48
New variant Creutzfeldt-Jakob disease is more common in Britain than elsewhere. (9685298)
1998
49
New variant Creutzfeldt-Jakob disease and bovine spongiform encephalopathy. (9494833)
1998
50
Cerebrospinal-fluid test for new-variant Creutzfeldt-Jakob disease. (8843819)
1996

Variations for Variant Creutzfeldt-Jakob Disease

About this section
Sources:
65UniProtKB/Swiss-Prot, 1 National Center for Biotechnology Information (Clinvar)
See all sources

UniProtKB/Swiss-Prot genetic disease variations for Variant Creutzfeldt-Jakob Disease:

65
id Symbol AA change Variation ID SNP ID
1PRNPp.Asp178AsnVAR_006469
2PRNPp.Val180IleVAR_006470
3PRNPp.Glu200LysVAR_006473
4PRNPp.Arg208HisVAR_006474
5PRNPp.Val210IleVAR_006475
6PRNPp.Met232ArgVAR_006478
7PRNPp.Glu196LysVAR_008749
8PRNPp.Val203IleVAR_008751
9PRNPp.Glu211GlnVAR_008752

Clinvar genetic disease variations for Variant Creutzfeldt-Jakob Disease:

1
id Gene Name Type Significance SNP ID Assembly Location
1PRNPNM_000311.3(PRNP): c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln)NT expansionPathogenicrs367543047
2PRNPNM_000311.3(PRNP): c.385A> G (p.Met129Val)single nucleotide variantBenign, Likely benign, Pathogenic, risk factorrs1799990GRCh37Chr 20, 4680251: 4680251
3PRNPNM_000311.3(PRNP): c.598G> A (p.Glu200Lys)single nucleotide variantPathogenicrs28933385GRCh37Chr 20, 4680464: 4680464
4PRNPNM_000311.3(PRNP): c.385A> G (p.Met129Val)single nucleotide variantBenign, Likely benign, Pathogenic, risk factorrs1799990GRCh37Chr 20, 4680251: 4680251
5PRNPNM_000311.3(PRNP): c.628G> A (p.Val210Ile)single nucleotide variantPathogenicrs74315407GRCh37Chr 20, 4680494: 4680494
6PRNPNM_000311.3(PRNP): c.538G> A (p.Val180Ile)single nucleotide variantPathogenicrs74315408GRCh37Chr 20, 4680404: 4680404
7PRNPNM_000311.3(PRNP): c.695T> G (p.Met232Arg)single nucleotide variantPathogenic, Uncertain significancers74315409GRCh37Chr 20, 4680561: 4680561
8PRNPNM_000311.3(PRNP): c.623G> A (p.Arg208His)single nucleotide variantPathogenicrs74315412GRCh37Chr 20, 4680489: 4680489
9PRNPNM_000311.3(PRNP): c.532G> A (p.Asp178Asn)single nucleotide variantPathogenicrs74315403GRCh37Chr 20, 4680398: 4680398
10PRNPNM_000311.3(PRNP): c.631G> C (p.Glu211Gln)single nucleotide variantPathogenicrs398122370GRCh37Chr 20, 4680497: 4680497

Expression for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section
Sources:
2BioGPS, 16Gene Expression Omnibus DataSets
See all sources
Expression patterns in normal tissues for genes affiliated with Variant Creutzfeldt-Jakob Disease

Search GEO for disease gene expression data for Variant Creutzfeldt-Jakob Disease.

Pathways for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section

Compounds for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section
Sources:
46Novoseek, 25HMDB, 12DrugBank, 30IUPHAR, 62Tocris Bioscience, 52PharmGKB
See all sources

Compounds related to Variant Creutzfeldt-Jakob Disease according to GeneCards/GeneDecks:

(show top 50)    (show all 60)
idCompoundScoreTop Affiliating Genes
1hemocyanin4610.1PRNP, IL7
2gliadin4610.1IL7, HLA-DQB1
3cysteamine46 25 1211.8APOE, CTSD
4edss469.8APOE, ENO2
5agarose469.8PRNP, TBP, CTSD
6sodium dodecylsulfate469.7TBP, PRNP, APOE
7histidine469.6CTSD, TBP, PRNP, HLA-DQB1
8ciglitazone46 3010.5APOE, RARB
9glyceraldehyde 3-phosphate469.5TBP, ENO2, CTSD
10valine469.4CTSD, PRNP, PRND, APOE
11agar469.4IL7, RARB, CTSD
12iron46 2510.4AHSP, PRNP, TBP, ENO2
13formaldehyde46 2510.4CTSD, ENO2, TBP, PRNP
14hyaluronic acid46 2510.3CTSD, ENO2, APOE
15guanine46 25 1211.3ENO2, TBP, APOE
16ibmx46 62 3011.3APOE, RARB, ENO2
17leucine469.3CTSD, ENO2, TBP, PRNP
18dmso469.2PRNP, RARB, ENO2, CTSD
19oligonucleotide469.2TBP, RARB, IL7, HLA-DQB1
20alpha tocopherol469.2APOE, RARB, TBP, CTSD
21paraffin469.1CTSD, ENO2, PRNP, APOE
22pge2469.1AHSP, PRNP, IL7, RARB, CTSD
23steroid469.1CTSD, TBP, RARB, IL7
24cisplatin46 52 62 1212.1CTSD, ENO2, TBP, RARB
25thymidine46 2510.1IL7, RARB, ENO2, CTSD
26adenylate469.1RARB, TBP, ENO2, CTSD
27cycloheximide469.0CTSD, RARB, IL7, APOE
28zinc46 2510.0CTSD, TBP, RARB, PRNP
29aspartate468.9HLA-DQB1, APOE, PRNP, ENO2, CTSD
30dexamethasone46 52 30 1211.9IL7, RARB, TBP, ENO2
31glutamine468.9HLA-DQB1, APOE, TBP, ENO2, CTSD
32indomethacin46 30 62 1211.8AHSP, APOE, ENO2
33arginine468.8RARB, PRNP, APOE, AHSP
34progesterone46 30 62 25 1212.8IL7, RARB, TBP, ENO2, CTSD
35retinoic acid46 259.7IL7, RARB, TBP, ENO2, CTSD
36vegf468.7CTSD, ENO2, IL7, APOE
37oxygen46 259.7AHSP, PRNP, IL7, TBP, ENO2, CTSD
38atp46 309.7AHSP, PRNP, IL7, TBP, ENO2, CTSD
39testosterone46 62 25 1211.6APOE, IL7, RARB, ENO2, CTSD
40heparin46 30 25 1211.5AHSP, APOE, PRNP, IL7, ENO2, CTSD
41cholesterol46 30 25 1211.5AHSP, APOE, PRNP, IL7, ENO2, CTSD
42cysteine468.5AHSP, APOE, IL7, RARB, TBP, CTSD
43dopamine46 30 25 1211.5AHSP, APOE, TPPP3, RARB, ENO2
44alanine468.5APOE, PRNP, IL7, TBP, ENO2, CTSD
45lipid468.4AHSP, APOE, PRNP, IL7, RARB, ENO2
46calcium46 52 25 1211.4AHSP, PRNP, IL7, RARB, ENO2, CTSD
47glutamate468.3CTSD, HLA-DQB1, AHSP, APOE, PRNP, IL7
48serine468.1APOE, PRNP, STMN2, IL7, TBP, CTSD
49estrogen468.0AHSP, APOE, IL7, RARB, TBP, ENO2
50tyrosine467.6HLA-DQB1, TPPP3, PRNP, STMN2, IL7, RARB

GO Terms for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section
Sources:
17Gene Ontology
See all sources

Cellular components related to Variant Creutzfeldt-Jakob Disease according to GeneCards/GeneDecks:

idNameGO IDScoreTop Affiliating Genes
1anchored component of membraneGO:0312259.6PRNP, PRND, SPRN

Biological processes related to Variant Creutzfeldt-Jakob Disease according to GeneCards/GeneDecks:

idNameGO IDScoreTop Affiliating Genes
1cell deathGO:0082199.2CTSD, TBP, APOE

Molecular functions related to Variant Creutzfeldt-Jakob Disease according to GeneCards/GeneDecks:

idNameGO IDScoreTop Affiliating Genes
1tubulin bindingGO:0156319.6PRNP, TPPP3

Products for genes affiliated with Variant Creutzfeldt-Jakob Disease

About this section
  • Antibodies
  • Proteins
  • Lysates
  • Antibodies

Sources for Variant Creutzfeldt-Jakob Disease

About this section
4CDC
14ExPASy
15FMA
23GTR
24HGMD
25HMDB
26ICD10
27ICD10 via Orphanet
28ICD9CM
30IUPHAR
31KEGG
36MeSH
37MESH via Orphanet
38MGI
41NCIt
42NDF-RT
45NINDS
46Novoseek
48OMIM
49OMIM via Orphanet
53PubMed
54QIAGEN
60SNOMED-CT via Orphanet
63UMLS
64UMLS via Orphanet