Acrofacial Dysostosis 1, Nager Type (AFD1)

Categories: Bone diseases, Eye diseases, Fetal diseases, Genetic diseases, Rare diseases

Aliases & Classifications for Acrofacial Dysostosis 1, Nager Type

MalaCards integrated aliases for Acrofacial Dysostosis 1, Nager Type:

Name: Acrofacial Dysostosis 1, Nager Type 58 12 54 26 76 13
Nager Syndrome 58 12 54 26 60 76 30 6 74
Nager Acrofacial Dysostosis 58 12 54 26 60 76 15
Preaxial Acrofacial Dysostosis 12 54 26
Afd1 58 26 76
Mandibulofacial Dysostosis, Treacher Collins Type, with Limb Anomalies 58 54
Nager Acrofacial Dysostosis Syndrome 54 26
Afd, Nager Type 58 54
Nafd 26 60
Mandibulofacial Dysostosis Treacher Collins Type with Limb Anomalies 76
Mandibulofacial Dysostosis with Preaxial Limb Anomalies 60
Split Hand Deformity-Mandibulofacial Dysostosis 54
Preaxial Mandibulofacial Dysostosis 26
Preaxial Manibulofacial Dysostosis 12
Acrofacial Dysostosis, Nager Type 77
Preaxial Acrodysostosis 60
Afd Nager Type 76
Afd 12


Orphanet epidemiological data:

nager syndrome
Inheritance: Autosomal dominant,Autosomal recessive,Not applicable; Age of onset: Antenatal,Neonatal; Age of death: normal life expectancy;


autosomal dominant

variable severity
most cases are sporadic


acrofacial dysostosis 1, nager type:
Onset and clinical course variable expressivity
Inheritance autosomal dominant inheritance


Summaries for Acrofacial Dysostosis 1, Nager Type

OMIM : 58 Nager syndrome is the prototype for a group of disorders collectively referred to as the acrofacial dysostoses (AFDs), which are characterized by malformation of the craniofacial skeleton and the limbs. The major facial features of Nager syndrome include downslanted palpebral fissures, midface retrusion, and micrognathia, the latter of which often requires the placement of a tracheostomy in early childhood. Limb defects typically involve the anterior (radial) elements of the upper limbs and manifest as small or absent thumbs, triphalangeal thumbs, radial hypoplasia or aplasia, and radioulnar synostosis. Phocomelia of the upper limbs and, occasionally, lower-limb defects have also been reported. The presence of anterior upper-limb defects and the typical lack of lower-limb involvement distinguishes Nager syndrome from Miller syndrome (263750), another rare AFD; however, distinguishing Nager syndrome from other AFDs, including Miller syndrome, can be challenging (summary by Bernier et al., 2012). (154400)

MalaCards based summary : Acrofacial Dysostosis 1, Nager Type, also known as nager syndrome, is related to dysostosis and acrofacial dysostosis. An important gene associated with Acrofacial Dysostosis 1, Nager Type is SF3B4 (Splicing Factor 3b Subunit 4), and among its related pathways/superpathways is mRNA Splicing - Minor Pathway. Affiliated tissues include bone, eye and kidney, and related phenotypes are hearing impairment and skeletal dysplasia

Disease Ontology : 12 An acrofacial dysostosis characterized by underdeveloped cheek bones, very small lower jaw, cleft palate, defects in the middle ear, absent eyelashes, and a notch in the lower eyelids called a coloboma, in children.

Genetics Home Reference : 26 Nager syndrome is a rare condition that mainly affects the development of the face, hands, and arms. The severity of this disorder varies among affected individuals.

NIH Rare Diseases : 54 Nager acrofacial dysostosis is a genetic disorder that affects the limbs and face. The signs and symptoms of Nager acrofacial dysostosis vary among affected individuals, even among those in the same family. Treatment is tailored to the individual based upon their specific needs. This condition is caused by mutations in the SF3B4 gene. While most cases are sporadic (occurring in families with no prior history of the disorder), autosomal dominant and autosomal recessive inheritance have been reported.

UniProtKB/Swiss-Prot : 76 Acrofacial dysostosis 1, Nager type: A form of acrofacial dysostosis, a group of disorders which are characterized by malformation of the craniofacial skeleton and the limbs. The major facial features of AFD1 include downslanted palpebral fissures, midface retrusion, and micrognathia, the latter of which often requires the placement of a tracheostomy in early childhood. Limb defects typically involve the anterior (radial) elements of the upper limbs and manifest as small or absent thumbs, triphalangeal thumbs, radial hyoplasia or aplasia, and radioulnar synostosis. Phocomelia of the upper limbs and, occasionally, lower-limb defects have also been reported.

Wikipedia : 77 Nager acrofacial dysostosis is a genetic congenital anomaly syndrome. Nager syndrome displays several or... more...

Related Diseases for Acrofacial Dysostosis 1, Nager Type

Graphical network of the top 20 diseases related to Acrofacial Dysostosis 1, Nager Type:

Diseases related to Acrofacial Dysostosis 1, Nager Type

Symptoms & Phenotypes for Acrofacial Dysostosis 1, Nager Type

Human phenotypes related to Acrofacial Dysostosis 1, Nager Type:

60 33 (show top 50) (show all 74)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 hearing impairment 60 33 hallmark (90%) Very frequent (99-80%) HP:0000365
2 skeletal dysplasia 60 33 hallmark (90%) Very frequent (99-80%) HP:0002652
3 delayed speech and language development 60 33 hallmark (90%) Very frequent (99-80%) HP:0000750
4 micrognathia 60 33 hallmark (90%) Very frequent (99-80%) HP:0000347
5 hypoplasia of the maxilla 60 33 hallmark (90%) Very frequent (99-80%) HP:0000327
6 downslanted palpebral fissures 60 33 hallmark (90%) Very frequent (99-80%) HP:0000494
7 aplasia/hypoplasia of the thumb 60 33 hallmark (90%) Very frequent (99-80%) HP:0009601
8 hypoplasia of the zygomatic bone 33 hallmark (90%) HP:0010669
9 ptosis 60 33 frequent (33%) Frequent (79-30%) HP:0000508
10 respiratory insufficiency 60 33 frequent (33%) Frequent (79-30%) HP:0002093
11 joint stiffness 60 33 frequent (33%) Frequent (79-30%) HP:0001387
12 microtia 60 33 frequent (33%) Frequent (79-30%) HP:0008551
13 cleft palate 60 33 frequent (33%) Frequent (79-30%) HP:0000175
14 abnormal nasal morphology 60 33 frequent (33%) Frequent (79-30%) HP:0005105
15 wide mouth 60 33 frequent (33%) Frequent (79-30%) HP:0000154
16 aplasia/hypoplasia of the eyebrow 60 33 frequent (33%) Frequent (79-30%) HP:0100840
17 atresia of the external auditory canal 60 33 frequent (33%) Frequent (79-30%) HP:0000413
18 lower eyelid coloboma 60 33 frequent (33%) Frequent (79-30%) HP:0000652
19 hypoplasia of the radius 60 33 frequent (33%) Frequent (79-30%) HP:0002984
20 sparse lower eyelashes 60 33 frequent (33%) Frequent (79-30%) HP:0007776
21 non-midline cleft lip 60 33 occasional (7.5%) Occasional (29-5%) HP:0100335
22 low-set, posteriorly rotated ears 60 33 occasional (7.5%) Occasional (29-5%) HP:0000368
23 triphalangeal thumb 60 33 occasional (7.5%) Occasional (29-5%) HP:0001199
24 abnormality of the lower limb 60 33 occasional (7.5%) Occasional (29-5%) HP:0002814
25 unilateral renal agenesis 60 33 occasional (7.5%) Occasional (29-5%) HP:0000122
26 phocomelia 60 33 occasional (7.5%) Occasional (29-5%) HP:0009829
27 patent ductus arteriosus 33 occasional (7.5%) HP:0001643
28 ventricular septal defect 33 occasional (7.5%) HP:0001629
29 abnormality of cardiovascular system morphology 33 occasional (7.5%) HP:0030680
30 malar flattening 33 HP:0000272
31 low-set ears 33 HP:0000369
32 clinodactyly 33 HP:0030084
33 hydrocephalus 33 HP:0000238
34 aqueductal stenosis 33 HP:0002410
35 scoliosis 33 HP:0002650
36 microcephaly 33 HP:0000252
37 short stature 33 HP:0004322
38 malformation of the heart and great vessels 60 Occasional (29-5%)
39 retrognathia 33 HP:0000278
40 short toe 33 HP:0001831
41 talipes equinovarus 33 HP:0001762
42 prominent nasal bridge 33 HP:0000426
43 aganglionic megacolon 33 HP:0002251
44 hip dislocation 33 HP:0002827
45 conductive hearing impairment 33 HP:0000405
46 tetralogy of fallot 33 HP:0001636
47 urticaria 33 HP:0001025
48 hallux valgus 33 HP:0001822
49 radioulnar synostosis 33 HP:0002974
50 cheekbone underdevelopment 60 Very frequent (99-80%)

Symptoms via clinical synopsis from OMIM:

Head And Neck Ears:
low-set ears
posteriorly rotated ears
preauricular tags
conductive deafness
external auditory canal atresia

Neurologic Central Nervous System:
aqueductal stenosis
normal intelligence
speech delay

Head And Neck Head:

Head And Neck Mouth:
cleft palate
velopharyngeal insufficiency
cleft lip

Skeletal Pelvis:
hip dislocation

Skeletal Limbs:
radioulnar synostosis
radial aplasia
limitation of elbow extension
short forearms
radial hypoplasia

Genitourinary Kidneys:
unilateral renal agenesis
duplicated calyx

Abdomen External Features:

Head And Neck Eyes:
downslanting palpebral fissures
partial-total absence of lower eyelashes
lower lid coloboma

Skeletal Skull:
hypoplastic mandible
hypoplastic zygomatic arch

Cardiovascular Vascular:
patent ductus arteriosus (in some patients)

Chest Ribs Sternum Clavicles And Scapulae:
hypoplastic first rib

Skin Nails Hair Skin:
urticaria pigmentosa

Skeletal Hands:
triphalangeal thumbs
thumb aplasia/hypoplasia

Skeletal Spine:
cervical vertebral abnormalities

Growth Height:
short stature

Head And Neck Face:
midface retrusion

Skeletal Feet:
hallux valgus
toe syndactyly
broad hallux
overlapping toes
Prenatal Manifestations Delivery:
premature birth

Genitourinary Internal Genitalia Female:
bicornuate uterus

Respiratory Larynx:
laryngeal hypoplasia

Head And Neck Nose:
high nasal bridge

Cardiovascular Heart:
ventricular septal defect (in some patients)
tetralogy of fallot (in some patients)

Respiratory Airways:
hypoplasia of the epiglottis

Abdomen Gastrointestinal:
hirschsprung disease

Skin Nails Hair Hair:
partial to total absence of eyelashes

Clinical features from OMIM:


GenomeRNAi Phenotypes related to Acrofacial Dysostosis 1, Nager Type according to GeneCards Suite gene sharing:

# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Decreased viability in esophageal squamous lineage GR00235-A 9.5 ARSE DHODH DMAP1 EFTUD2 PRRX2 SF3B4
2 Dynamic nuclei (hole, folded or small irregular) GR00257-A-1 9.17 ARSE DMAP1 EFTUD2 PRRX2 SLC12A6 TXNL4A

Drugs & Therapeutics for Acrofacial Dysostosis 1, Nager Type

Interventional clinical trials:

# Name Status NCT ID Phase Drugs
1 Comparison Between Internal and External Distractors in Osteogenesis Not yet recruiting NCT03540329 Not Applicable

Search NIH Clinical Center for Acrofacial Dysostosis 1, Nager Type

Genetic Tests for Acrofacial Dysostosis 1, Nager Type

Genetic tests related to Acrofacial Dysostosis 1, Nager Type:

# Genetic test Affiliating Genes
1 Nager Syndrome 30 SF3B4

Anatomical Context for Acrofacial Dysostosis 1, Nager Type

MalaCards organs/tissues related to Acrofacial Dysostosis 1, Nager Type:

Bone, Eye, Kidney, Skin, Heart, Uterus, Breast

Publications for Acrofacial Dysostosis 1, Nager Type

Articles related to Acrofacial Dysostosis 1, Nager Type:

(show all 48)
# Title Authors Year
Decannulation and Airway Outcomes With Maxillomandibular Distraction in Treacher Collins and Nager Syndrome. ( 29381611 )
Modified Lefort Distraction Osteogenesis for the Treatment of Nager Syndrome-Associated Midface Hypoplasia: Technique and Review. ( 29916980 )
Synchronous Bilateral Breast Cancer in a Patient With Nager Syndrome. ( 28139434 )
A synonymous splicing mutation in the SF3B4 gene segregates in a family with highly variable Nager syndrome. ( 27966544 )
Ankylosis of temporomandibular joints after mandibular distraction osteogenesis in patients with Nager syndrome: Report of two cases and literature review. ( 28688869 )
A Case Report of Absent Epiglottis in Children With Nager Syndrome: Its Impact on Swallowing. ( 27723379 )
The Craniofacial and Upper Limb Management of Nager Syndrome. ( 27171953 )
Use of the C-MAC® adult D blade in paediatric patients with Nager syndrome. ( 27608358 )
Prenatal diagnosis of Nager syndrome in a 12-week-old fetus with a whole gene deletion of SF3B4 by chromosomal microarray. ( 26679067 )
Sf3b4-depleted Xenopus embryos: A model to study the pathogenesis of craniofacial defects in Nager syndrome. ( 26874011 )
Nager Syndrome with Eventration of Diaphragm: A Rare Presentation. ( 27130509 )
Propranolol-induced gingival hyperplasia with Nager syndrome: A rare adverse drug reaction. ( 27144155 )
Nager syndrome and Pierre Robin sequence. ( 25808856 )
Nager syndrome. ( 25543163 )
Orbital soft tissue surgery for patients with Treacher-Collins or Nager syndrome. A new surgical approach with early correction of soft tissue: prospective study. ( 25799958 )
Nager syndrome: confirmation of SF3B4 haploinsufficiency as the major cause. ( 24003905 )
A 22-Week-Old Fetus with Nager Syndrome and Congenital Diaphragmatic Hernia due to a Novel SF3B4 Mutation. ( 25337072 )
Rodriguez syndrome with SF3B4 mutation: a severe form of Nager syndrome? ( 24715698 )
Management of soft palate agenesis in Nager syndrome with an elongated, superiorly based pharyngeal flap. ( 25397380 )
Clinical and mutation data in 12 patients with the clinical diagnosis of Nager syndrome. ( 23568615 )
Limbal dermoid in Nager syndrome acrofacial dysostosis: A rare case report. ( 23619484 )
Possible autosomal recessive inheritance in an infant with acrofacial dysostosis similar to Nager syndrome. ( 23913624 )
Prenatal phenotype of Nager syndrome and Rodriguez syndrome: variable expression of the same entity? ( 23811969 )
Temporomandibular joint replacement for ankylosis correction in Nager syndrome: case report and review of the literature. ( 21723020 )
Haploinsufficiency of SF3B4, a component of the pre-mRNA spliceosomal complex, causes Nager syndrome. ( 22541558 )
The first reported treatment of Nager syndrome associated hearing loss with bone-anchored hearing aids: case report. ( 22018095 )
Nager syndrome: a case report. ( 22503264 )
Prenatal diagnosis of Nager syndrome in the third trimester of pregnancy and anatomopathological correlation. ( 27279120 )
Overall intelligibility, articulation, resonance, voice and language in a child with Nager syndrome. ( 21145116 )
Prenatal diagnosis of Nager syndrome in a monochorionic-diamniotic twin pregnancy. ( 19180573 )
Airway management in Nager Syndrome. ( 18947886 )
Craniofacial structures and dental development in three patients with Nager syndrome. ( 17119427 )
Newly recognized autosomal recessive acrofacial dysostosis syndrome resembling Nager syndrome. ( 15266620 )
Nager syndrome (preaxial acrofacial dysostosis): a case report. ( 15184856 )
Prenatal ultrasound diagnosis of Nager syndrome. ( 12601847 )
Spontaneous expression of FRA3P in a patient with Nager syndrome. ( 12673663 )
Anaesthetic implications of Nager syndrome. ( 11982847 )
Flexor digitorum longus accessorius in the club foot of an infant with Nager syndrome. ( 11195131 )
Human PRRX1 and PRRX2 genes: cloning, expression, genomic localization, and exclusion as disease genes for Nager syndrome. ( 11063257 )
Nager syndrome. Problems and possibilities of therapy. ( 10961048 )
Cloning, characterization, and chromosomal assignment of the human ortholog of murine Zfp-37, a candidate gene for Nager syndrome. ( 9585434 )
Mandibular malformations: growth characteristics and management in hemifacial microsomia and Nager syndrome. ( 10066111 )
Urticaria pigmentosa and Nager syndrome. ( 8176025 )
Preaxial acrofacial dysostosis (Nager syndrome) associated with an inherited and apparently balanced X;9 translocation: prenatal and postnatal late replication studies. ( 8357008 )
The Nager syndrome. ( 3321996 )
Nager syndrome: an update of speech and hearing characteristics. ( 3472688 )
Acrofacial dysostosis (Nager syndrome): synopsis and report of a new case. ( 6881198 )
Differential diagnosis of Nager acrofacial dysostosis syndrome: report of four patients with Nager syndrome and discussion of other related syndromes. ( 6837625 )

Variations for Acrofacial Dysostosis 1, Nager Type

ClinVar genetic disease variations for Acrofacial Dysostosis 1, Nager Type:

6 (show top 50) (show all 84)
# Gene Variation Type Significance SNP ID Assembly Location
1 SF3B4 NM_005850.4(SF3B4): c.1252_1258delCTTCGAG (p.Leu418Alafs) deletion Pathogenic rs797045121 GRCh37 Chromosome 1, 149895451: 149895457
2 SF3B4 NM_005850.4(SF3B4): c.1252_1258delCTTCGAG (p.Leu418Alafs) deletion Pathogenic rs797045121 GRCh38 Chromosome 1, 149923559: 149923565
3 SF3B4 NM_005850.4(SF3B4): c.1232delC (p.Pro411Glnfs) deletion Pathogenic rs797045122 GRCh37 Chromosome 1, 149895477: 149895477
4 SF3B4 NM_005850.4(SF3B4): c.1232delC (p.Pro411Glnfs) deletion Pathogenic rs797045122 GRCh38 Chromosome 1, 149923585: 149923585
5 SF3B4 NM_005850.4(SF3B4): c.1199delC (p.Pro400Leufs) deletion Pathogenic rs797045123 GRCh37 Chromosome 1, 149895510: 149895510
6 SF3B4 NM_005850.4(SF3B4): c.1199delC (p.Pro400Leufs) deletion Pathogenic rs797045123 GRCh38 Chromosome 1, 149923618: 149923618
7 SF3B4 NM_005850.4(SF3B4): c.1148dupA (p.His383Glnfs) duplication Pathogenic rs797045124 GRCh37 Chromosome 1, 149895561: 149895561
8 SF3B4 NM_005850.4(SF3B4): c.1148dupA (p.His383Glnfs) duplication Pathogenic rs797045124 GRCh38 Chromosome 1, 149923669: 149923669
9 SF3B4 NM_005850.4(SF3B4): c.1060dupC (p.Arg354Profs) duplication Pathogenic rs782357237 GRCh37 Chromosome 1, 149895760: 149895760
10 SF3B4 NM_005850.4(SF3B4): c.1060dupC (p.Arg354Profs) duplication Pathogenic rs782357237 GRCh38 Chromosome 1, 149923868: 149923868
11 SF3B4 NM_005850.4(SF3B4): c.864delT (p.His288Glnfs) deletion Pathogenic rs797045126 GRCh37 Chromosome 1, 149897777: 149897777
12 SF3B4 NM_005850.4(SF3B4): c.864delT (p.His288Glnfs) deletion Pathogenic rs797045126 GRCh38 Chromosome 1, 149925885: 149925885
13 SF3B4 NM_005850.4(SF3B4): c.836_837insGGGTATG (p.Thr280Glyfs) insertion Pathogenic rs797045127 GRCh37 Chromosome 1, 149897804: 149897805
14 SF3B4 NM_005850.4(SF3B4): c.836_837insGGGTATG (p.Thr280Glyfs) insertion Pathogenic rs797045127 GRCh38 Chromosome 1, 149925912: 149925913
15 SF3B4 NM_005850.4(SF3B4): c.827dupC (p.Ser277Ilefs) duplication Pathogenic rs797045128 GRCh37 Chromosome 1, 149897814: 149897814
16 SF3B4 NM_005850.4(SF3B4): c.827dupC (p.Ser277Ilefs) duplication Pathogenic rs797045128 GRCh38 Chromosome 1, 149925922: 149925922
17 SF3B4 NM_005850.4(SF3B4): c.796dupA (p.Met266Asnfs) duplication Pathogenic rs797045129 GRCh37 Chromosome 1, 149897845: 149897845
18 SF3B4 NM_005850.4(SF3B4): c.796dupA (p.Met266Asnfs) duplication Pathogenic rs797045129 GRCh38 Chromosome 1, 149925953: 149925953
19 SF3B4 NM_005850.4(SF3B4): c.769delA (p.Ile257Tyrfs) deletion Pathogenic rs797045130 GRCh37 Chromosome 1, 149897872: 149897872
20 SF3B4 NM_005850.4(SF3B4): c.769delA (p.Ile257Tyrfs) deletion Pathogenic rs797045130 GRCh38 Chromosome 1, 149925980: 149925980
21 SF3B4 NM_005850.4(SF3B4): c.661_664dupCCCA (p.Asn222Thrfs) duplication Pathogenic rs797045131 GRCh37 Chromosome 1, 149898310: 149898313
22 SF3B4 NM_005850.4(SF3B4): c.661_664dupCCCA (p.Asn222Thrfs) duplication Pathogenic rs797045131 GRCh38 Chromosome 1, 149926418: 149926421
23 SF3B4 NM_005850.4(SF3B4): c.625C> T (p.Gln209Ter) single nucleotide variant Pathogenic rs797045132 GRCh37 Chromosome 1, 149898349: 149898349
24 SF3B4 NM_005850.4(SF3B4): c.625C> T (p.Gln209Ter) single nucleotide variant Pathogenic rs797045132 GRCh38 Chromosome 1, 149926457: 149926457
25 SF3B4 NM_005850.4(SF3B4): c.452C> A (p.Ser151Ter) single nucleotide variant Pathogenic rs797045133 GRCh37 Chromosome 1, 149898522: 149898522
26 SF3B4 NM_005850.4(SF3B4): c.452C> A (p.Ser151Ter) single nucleotide variant Pathogenic rs797045133 GRCh38 Chromosome 1, 149926630: 149926630
27 SF3B4 NM_005850.4(SF3B4): c.88delT (p.Trp30Glyfs) deletion Pathogenic rs797045134 GRCh37 Chromosome 1, 149899133: 149899133
28 SF3B4 NM_005850.4(SF3B4): c.88delT (p.Trp30Glyfs) deletion Pathogenic rs797045134 GRCh38 Chromosome 1, 149927241: 149927241
29 SF3B4 NM_005850.4(SF3B4): c.1230_1249delACCAGTTCCCCCTCGAGGCC (p.Pro411Thrfs) deletion Pathogenic rs797045954 GRCh37 Chromosome 1, 149895460: 149895479
30 SF3B4 NM_005850.4(SF3B4): c.1230_1249delACCAGTTCCCCCTCGAGGCC (p.Pro411Thrfs) deletion Pathogenic rs797045954 GRCh38 Chromosome 1, 149923568: 149923587
31 SF3B4 NM_005850.4(SF3B4): c.731_743del (p.Pro244Hisfs) deletion Pathogenic rs797045957 GRCh37 Chromosome 1, 149897898: 149897910
32 SF3B4 NM_005850.4(SF3B4): c.731_743del (p.Pro244Hisfs) deletion Pathogenic rs797045957 GRCh38 Chromosome 1, 149926006: 149926018
33 SF3B4 NM_005850.4(SF3B4): c.193G> T (p.Glu65Ter) single nucleotide variant Pathogenic rs797045955 GRCh37 Chromosome 1, 149898781: 149898781
34 SF3B4 NM_005850.4(SF3B4): c.193G> T (p.Glu65Ter) single nucleotide variant Pathogenic rs797045955 GRCh38 Chromosome 1, 149926889: 149926889
35 SF3B4 NM_005850.4(SF3B4): c.45_46del (p.Tyr16Argfs) deletion Pathogenic rs797045956 GRCh37 Chromosome 1, 149899175: 149899176
36 SF3B4 NM_005850.4(SF3B4): c.45_46del (p.Tyr16Argfs) deletion Pathogenic rs797045956 GRCh38 Chromosome 1, 149927283: 149927284
37 SF3B4 NM_005850.4(SF3B4): c.1A> G (p.Met1Val) single nucleotide variant Pathogenic rs387907185 GRCh37 Chromosome 1, 149899651: 149899651
38 SF3B4 NM_005850.4(SF3B4): c.1A> G (p.Met1Val) single nucleotide variant Pathogenic rs387907185 GRCh38 Chromosome 1, 149927759: 149927759
39 SF3B4 NM_005850.4(SF3B4): c.1147dupC (p.His383Profs) duplication Pathogenic rs387907186 GRCh37 Chromosome 1, 149895562: 149895562
40 SF3B4 NM_005850.4(SF3B4): c.1147dupC (p.His383Profs) duplication Pathogenic rs387907186 GRCh38 Chromosome 1, 149923670: 149923670
41 SF3B4 NM_005850.4(SF3B4): c.1147delC (p.His383Metfs) deletion Pathogenic rs387907186 GRCh37 Chromosome 1, 149895562: 149895562
42 SF3B4 NM_005850.4(SF3B4): c.1147delC (p.His383Metfs) deletion Pathogenic rs387907186 GRCh38 Chromosome 1, 149923670: 149923670
43 SF3B4 NM_005850.4(SF3B4): c.913+1G> A single nucleotide variant Pathogenic rs797045125 GRCh37 Chromosome 1, 149897727: 149897727
44 SF3B4 NM_005850.4(SF3B4): c.913+1G> A single nucleotide variant Pathogenic rs797045125 GRCh38 Chromosome 1, 149925835: 149925835
45 SF3B4 NM_005850.4(SF3B4): c.1006C> T (p.Arg336Ter) single nucleotide variant Pathogenic rs397515324 GRCh37 Chromosome 1, 149895814: 149895814
46 SF3B4 NM_005850.4(SF3B4): c.1006C> T (p.Arg336Ter) single nucleotide variant Pathogenic rs397515324 GRCh38 Chromosome 1, 149923922: 149923922
47 SF3B4 NM_005850.4(SF3B4): c.682T> C (p.Leu228=) single nucleotide variant Benign/Likely benign rs115070660 GRCh37 Chromosome 1, 149898292: 149898292
48 SF3B4 NM_005850.4(SF3B4): c.682T> C (p.Leu228=) single nucleotide variant Benign/Likely benign rs115070660 GRCh38 Chromosome 1, 149926400: 149926400
49 SF3B4 NM_005850.4(SF3B4): c.-1C> T single nucleotide variant Likely benign rs587718470 GRCh38 Chromosome 1, 149927760: 149927760
50 SF3B4 NM_005850.4(SF3B4): c.543C> T (p.Asp181=) single nucleotide variant Likely benign rs41265150 GRCh38 Chromosome 1, 149926539: 149926539

Expression for Acrofacial Dysostosis 1, Nager Type

Search GEO for disease gene expression data for Acrofacial Dysostosis 1, Nager Type.

Pathways for Acrofacial Dysostosis 1, Nager Type

Pathways related to Acrofacial Dysostosis 1, Nager Type according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1 10.52 EFTUD2 SF3B4 TXNL4A

GO Terms for Acrofacial Dysostosis 1, Nager Type

Cellular components related to Acrofacial Dysostosis 1, Nager Type according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 U4/U6 x U5 tri-snRNP complex GO:0046540 8.96 EFTUD2 TXNL4A
2 spliceosomal complex GO:0005681 8.8 EFTUD2 SF3B4 TXNL4A

Biological processes related to Acrofacial Dysostosis 1, Nager Type according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 mRNA processing GO:0006397 9.43 EFTUD2 SF3B4 TXNL4A
2 RNA splicing GO:0008380 9.33 EFTUD2 SF3B4 TXNL4A
3 mRNA splicing, via spliceosome GO:0000398 9.13 EFTUD2 SF3B4 TXNL4A
4 RNA splicing, via transesterification reactions GO:0000375 8.62 SF3B4 TXNL4A

Sources for Acrofacial Dysostosis 1, Nager Type

9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
20 FMA
29 GO
30 GTR
33 HPO
34 ICD10
35 ICD10 via Orphanet
39 LifeMap
43 MedGen
45 MeSH
46 MESH via Orphanet
47 MGI
50 NCI
51 NCIt
56 Novoseek
59 OMIM via Orphanet
63 PubMed
71 SNOMED-CT via Orphanet
73 Tocris
75 UMLS via Orphanet
Loading form....