ALS1
MCID: AMY091
MIFTS: 89

Amyotrophic Lateral Sclerosis 1 (ALS1)

Categories: Genetic diseases, Mental diseases, Metabolic diseases, Neuronal diseases, Rare diseases, Respiratory diseases

Aliases & Classifications for Amyotrophic Lateral Sclerosis 1

MalaCards integrated aliases for Amyotrophic Lateral Sclerosis 1:

Name: Amyotrophic Lateral Sclerosis 1 56 12 73 13 37 71
Amyotrophic Lateral Sclerosis 56 12 74 24 52 25 53 58 73 36 29 54 6 42 3 43 15 17 71
Amyotrophic Lateral Sclerosis Type 1 12 52 29 6 15
Lou Gehrig Disease 24 52 25 58 73
Als 12 52 25 58 73
Charcot Disease 52 25 58 73
Als1 56 12 52 73
Amyotrophic Lateral Sclerosis, Susceptibility to 56 29 6
Lou Gehrig's Disease 12 74 53
Familial Amyotrophic Lateral Sclerosis 73 17
Motor Neuron Disease 73 71
Fals 56 73
Mnd 52 73
Amyotrophic Lateral Sclerosis 1, Autosomal Dominant 56
Motor Neuron Disease, Amyotrophic Lateral Sclerosis 25
Amyotrophic Lateral Sclerosis 1, Familial; Fals 56
Amyotrophic Lateral Sclerosis with Dementia 25
Dementia with Amyotrophic Lateral Sclerosis 25
Amyotrophic Lateral Sclerosis 1, Familial 56
Sclerosis, Lateral, Amyotrophic, Type 1 39
Sclerosis, Lateral, Amyotrophic 39
Motor Neuron Disease, Bulbar 12
Motor Neurone Disease 52

Characteristics:

Orphanet epidemiological data:

58
amyotrophic lateral sclerosis
Inheritance: Autosomal dominant,Autosomal recessive,Not applicable; Prevalence: 1-9/100000 (Europe),1-9/100000 (United States); Age of onset: Adult; Age of death: adult;

OMIM:

56
Inheritance:
autosomal recessive
autosomal dominant

Miscellaneous:
genetic heterogeneity
approximately 10% of als cases are familial


HPO:

31

Classifications:

Orphanet: 58  
Rare neurological diseases


External Ids:

Disease Ontology 12 DOID:0060193 DOID:332
OMIM 56 105400
OMIM Phenotypic Series 56 PS105400
KEGG 36 H00058
ICD9CM 34 335.20
MeSH 43 D000690
NCIt 49 C34373
SNOMED-CT 67 86044005
ICD10 32 G12.2 G12.21
MESH via Orphanet 44 D000690
ICD10 via Orphanet 33 G12.2
UMLS via Orphanet 72 C0002736
Orphanet 58 ORPHA803
UMLS 71 C0002736 C0085084 C1862939

Summaries for Amyotrophic Lateral Sclerosis 1

Genetics Home Reference : 25 Amyotrophic lateral sclerosis (ALS) is a progressive disease that affects motor neurons, which are specialized nerve cells that control muscle movement. These nerve cells are found in the spinal cord and the brain. In ALS, motor neurons die (atrophy) over time, leading to muscle weakness, a loss of muscle mass, and an inability to control movement. There are many different types of ALS; these types are distinguished by their signs and symptoms and their genetic cause or lack of clear genetic association. Most people with ALS have a form of the condition that is described as sporadic, which means it occurs in people with no apparent history of the disorder in their family. People with sporadic ALS usually first develop features of the condition in their late fifties or early sixties. A small proportion of people with ALS, estimated at 5 to 10 percent, have a family history of ALS or a related condition called frontotemporal dementia (FTD), which is a progressive brain disorder that affects personality, behavior, and language. The signs and symptoms of familial ALS typically first appear in one's late forties or early fifties. Rarely, people with familial ALS develop symptoms in childhood or their teenage years. These individuals have a rare form of the disorder known as juvenile ALS. The first signs and symptoms of ALS may be so subtle that they are overlooked. The earliest symptoms include muscle twitching, cramping, stiffness, or weakness. Affected individuals may develop slurred speech (dysarthria) and, later, difficulty chewing or swallowing (dysphagia). Many people with ALS experience malnutrition because of reduced food intake due to dysphagia and an increase in their body's energy demands (metabolism) due to prolonged illness. Muscles become weaker as the disease progresses, and arms and legs begin to look thinner as muscle tissue atrophies. Individuals with ALS eventually lose muscle strength and the ability to walk. Affected individuals eventually become wheelchair-dependent and increasingly require help with personal care and other activities of daily living. Over time, muscle weakness causes affected individuals to lose the use of their hands and arms. Breathing becomes difficult because the muscles of the respiratory system weaken. Most people with ALS die from respiratory failure within 2 to 10 years after the signs and symptoms of ALS first appear; however, disease progression varies widely among affected individuals. Approximately 20 percent of individuals with ALS also develop FTD. Changes in personality and behavior may make it difficult for affected individuals to interact with others in a socially appropriate manner. Communication skills worsen as the disease progresses. It is unclear how the development of ALS and FTD are related. Individuals who develop both conditions are diagnosed as having ALS-FTD. A rare form of ALS that often runs in families is known as ALS-parkinsonism-dementia complex (ALS-PDC). This disorder is characterized by the signs and symptoms of ALS, in addition to a pattern of movement abnormalities known as parkinsonism, and a progressive loss of intellectual function (dementia). Signs of parkinsonism include unusually slow movements (bradykinesia), stiffness, and tremors. Affected members of the same family can have different combinations of signs and symptoms.

MalaCards based summary : Amyotrophic Lateral Sclerosis 1, also known as amyotrophic lateral sclerosis, is related to frontotemporal dementia and/or amyotrophic lateral sclerosis 1 and amyotrophic lateral sclerosis 8, and has symptoms including seizures, ataxia and tremor. An important gene associated with Amyotrophic Lateral Sclerosis 1 is SOD1 (Superoxide Dismutase 1), and among its related pathways/superpathways are Amyotrophic lateral sclerosis (ALS) and Cytoskeletal Signaling. The drugs Mexiletine and Minocycline have been mentioned in the context of this disorder. Affiliated tissues include Bone and Limb, and related phenotypes are amyotrophic lateral sclerosis and generalized muscle weakness

Disease Ontology : 12 A motor neuron disease that is characterized by muscle spasticity, rapidly progressive weakness due to muscle atrophy, difficulty in speaking, swallowing, and breathing.

NIH Rare Diseases : 52 Amyotrophic lateral sclerosis (ALS), also referred to as "Lou Gehrig's disease," is a progressive motor neuron disease which leads to problems with muscle control and movement. There are various types of ALS that are distinguished by symptoms and, in some cases, genetic cause. Early symptoms may include muscle twitching, cramping, stiffness, or weakness, slurred speech, and/or difficulty chewing or swallowing. As the disease progresses, people become weaker and are eventually wheelchair-dependent. Death often results from respiratory failure within 2 to 10 years after the symptoms begin. Most people with ALS have a sporadic (not inherited ) form of ALS. It is believed that these cases are caused by an interaction between genetic and environmental factors . This means that a person may have inherited genetic changes (variants) that increase their risk to develop ALS, but the person will only develop ALS if exposed to certain environmental triggers. About 10% of the people with ALS have at least one relative with the disease and are said to have have a familial (inherited) form of the disease (FALS). Familial ALS may be caused by changes (pathogenic variants, also known as mutations ) in any one of several genes and the pattern of inheritance varies depending on the gene involved. The distinction between sporadic and familial cases is not always clear. The average age at which symptoms begin is 56 years old in the sporadic cases and 46 years old in the familial cases. Diagnosis of ALS is based on symptoms and a variety of tests to rule out other possible medical diseases that can cause similar symptoms. The goal of treatment is to improve the quality of life for people with ALS, by assisting with breathing, nutrition, mobility, and communication. Medications specifically approved for the treatment of ALS in the United States include riluzole and edaravone .

OMIM : 56 Amyotrophic lateral sclerosis is a neurodegenerative disorder characterized by the death of motor neurons in the brain, brainstem, and spinal cord, resulting in fatal paralysis. ALS usually begins with asymmetric involvement of the muscles in middle adult life. Approximately 10% of ALS cases are familial (Siddique and Deng, 1996). ALS is sometimes referred to as 'Lou Gehrig disease' after the famous American baseball player who was diagnosed with the disorder. Rowland and Shneider (2001) and Kunst (2004) provided extensive reviews of ALS. Some forms of ALS occur with frontotemporal dementia (FTD). Familial ALS is distinct from a form of ALS with dementia reported in cases on Guam (105500) (Espinosa et al., 1962; Husquinet and Franck, 1980), in which the histology is different and dementia and parkinsonism complicate the clinical picture. (105400)

MedlinePlus : 42 Amyotrophic lateral sclerosis (ALS) is a nervous system disease that attacks nerve cells called neurons in your brain and spinal cord. These neurons transmit messages from your brain and spinal cord to your voluntary muscles - the ones you can control, like in your arms and legs. At first, this causes mild muscle problems. Some people notice Trouble walking or running Trouble writing Speech problems Eventually, you lose your strength and cannot move. When muscles in your chest fail, you cannot breathe. A breathing machine can help, but most people with ALS die from respiratory failure. The disease usually strikes between age 40 and 60. More men than women get it. No one knows what causes ALS. It can run in families, but usually it strikes at random. There is no cure. Medicines can relieve symptoms and, sometimes, prolong survival. NIH: National Institute of Neurological Disorders and Stroke

CDC : 3 Amyotrophic lateral sclerosis (ALS), sometimes called Lou Gehrig's disease, is a progressive disease that attacks the nerve cells that control voluntary movement. The National ALS Registry is a congressionally mandated registry for persons in the U.S. with ALS. It is the only population-based registry in the U.S. that collects information to help scientists learn more about who gets ALS and its causes. No one knows for sure what causes ALS and currently there is no cure.

NINDS : 53 Amyotrophic lateral sclerosis (ALS) is a rapidly progressive, fatal disease that affects the nerve cells (neurons) in that brain and spinal cord that  control voluntary muscle movement.  Our voluntary muscles produce movements like walking, breathing, chewing, and talking.  Nerve cells called motor neurons--that connect from the brain and spinal cord to the rest of the body--begin to degenerate and die, and stop sending messages to muscles. The muscles gradually weaken, waste away, and twitch, and the brain can't start and control voluntary movement.  Symptoms are usually first noticed in the arms and hands, legs, or swallowing muscles.  People with ALS lose their strength and become unable to move their arms and legs, and to hold the body upright.  Some individuals eventually can't breathe on their own.  Although ALS doesn't usually impair a person's mind or personality, several recent studies suggest that some people with ALS may develop cognitive problems involving word fluency, decision-making, and memory.  Most cases of ALS happen with no known cause, while a small percentage of cases are inherited.

KEGG : 36 Amyotrophic lateral sclerosis (ALS) is a progressive, lethal, degenerative disorder of motor neurons. The hallmark of this disease is the selective death of motor neurons in the brain and spinal cord, leading to paralysis of voluntary muscles. Mutant superoxide dismutase 1 (SOD1), as seen in some familial ALS (FALS) cases, is unstable, forming aggregates in the motor neuron cytoplasm, axoplasm and mitochondria. Within mitochondria, mutant SOD1 may interfere with the anti-apoptotic function of Bcl-2, affect mitochondrial import by interfering with the translocation machinery (TOM/TIM), and generate toxic free radicals (ROS). Reactive oxygen species (ROS), produced within mitochondria, inhibit the function of EAAT2, the main glial glutamate transporter protein, responsible for most of the reuptake of synaptically released glutamate. Glutamate excess increases intracellular calcium, which enhances oxidative stress and mitochondrial damage. Mutant SOD1 can also trigger oxidative reactions , which can then cause damage through the formation of hydroxyl radicals or via nitration of tyrosine residues on proteins. Nitration may target neurofilament proteins, affecting axonal transport. Collectively, these mechanisms are predicted to disturb cellular homeostasis, ultimately triggering motor neuron death.

UniProtKB/Swiss-Prot : 73 Amyotrophic lateral sclerosis: A neurodegenerative disorder affecting upper motor neurons in the brain and lower motor neurons in the brain stem and spinal cord, resulting in fatal paralysis. Sensory abnormalities are absent. The pathologic hallmarks of the disease include pallor of the corticospinal tract due to loss of motor neurons, presence of ubiquitin-positive inclusions within surviving motor neurons, and deposition of pathologic aggregates. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of the cases.
Amyotrophic lateral sclerosis 1: A neurodegenerative disorder affecting upper motor neurons in the brain and lower motor neurons in the brain stem and spinal cord, resulting in fatal paralysis. Sensory abnormalities are absent. The pathologic hallmarks of the disease include pallor of the corticospinal tract due to loss of motor neurons, presence of ubiquitin-positive inclusions within surviving motor neurons, and deposition of pathologic aggregates. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of the cases.

Wikipedia : 74 Amyotrophic lateral sclerosis (ALS), also known as motor neurone disease (MND) or Lou Gehrig's disease,... more...

GeneReviews: NBK1450

Related Diseases for Amyotrophic Lateral Sclerosis 1

Diseases in the Juvenile Amyotrophic Lateral Sclerosis family:

Amyotrophic Lateral Sclerosis 1 Amyotrophic Lateral Sclerosis 2, Juvenile
Amyotrophic Lateral Sclerosis 5, Juvenile Amyotrophic Lateral Sclerosis 4, Juvenile
Amyotrophic Lateral Sclerosis 21 Amyotrophic Lateral Sclerosis 3
Amyotrophic Lateral Sclerosis 7 Amyotrophic Lateral Sclerosis 8
Amyotrophic Lateral Sclerosis 9 Amyotrophic Lateral Sclerosis 11
Amyotrophic Lateral Sclerosis 12 Amyotrophic Lateral Sclerosis 16, Juvenile
Amyotrophic Lateral Sclerosis 17 Amyotrophic Lateral Sclerosis 18
Amyotrophic Lateral Sclerosis 20 Amyotrophic Lateral Sclerosis 19
Amyotrophic Lateral Sclerosis 23 Amyotrophic Lateral Sclerosis 24
Amyotrophic Lateral Sclerosis 25 Amyotrophic Lateral Sclerosis Type 5
Amyotrophic Lateral Sclerosis Type 6 Amyotrophic Lateral Sclerosis Type 14
Amyotrophic Lateral Sclerosis Type 15 Amyotrophic Lateral Sclerosis Type 22
Tardbp-Related Amyotrophic Lateral Sclerosis

Diseases related to Amyotrophic Lateral Sclerosis 1 via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 5555)
# Related Disease Score Top Affiliating Genes
1 frontotemporal dementia and/or amyotrophic lateral sclerosis 1 37.9 VCP VAPB UBQLN2 TARDBP SQSTM1 SOD1
2 amyotrophic lateral sclerosis 8 37.2 VAPB UBQLN2 TARDBP SOD1 OPTN FUS
3 amyotrophic lateral sclerosis 10 with or without frontotemporal dementia 37.1 VAPB UBQLN2 TARDBP SOD1 OPTN MATR3
4 amyotrophic lateral sclerosis type 6 37.0 VAPB UBQLN2 TARDBP SOD1 OPTN FUS
5 amyotrophic lateral sclerosis 11 36.8 VAPB UBQLN2 TARDBP OPTN FUS FIG4
6 amyotrophic lateral sclerosis 18 36.8 VAPB UBQLN2 PRPH PFN1 FUS FIG4
7 amyotrophic lateral sclerosis 12 36.8 VAPB UBQLN2 TARDBP OPTN FUS FIG4
8 amyotrophic lateral sclerosis type 14 36.8 VCP VAPB UBQLN2 PRPH OPTN FUS
9 amyotrophic lateral sclerosis 16, juvenile 36.6 VCP VAPB UBQLN2 FUS CHMP2B C9orf72
10 amyotrophic lateral sclerosis 19 36.6 UBQLN2 TARDBP SOD1 PRPH MATR3 C9orf72
11 frontotemporal dementia 36.4 VCP UBQLN2 TARDBP SQSTM1 SOD1 PFN1
12 amyotrophic lateral sclerosis 17 36.4 VAPB UBQLN2 PRPH FIG4 CHMP2B
13 amyotrophic lateral sclerosis 20 36.4 PRPH PFN1 MATR3 HNRNPA1 C9orf72
14 amyotrophic lateral sclerosis type 15 36.2 VAPB UBQLN2 PRPH CHMP2B C9orf72
15 frontotemporal dementia and/or amyotrophic lateral sclerosis 3 36.0 SQSTM1 PRPH CHCHD10
16 amyotrophic lateral sclerosis, juvenile, with dementia 35.9 VCP C9orf72 ANG
17 inclusion body myopathy with paget disease of bone and frontotemporal dementia 35.9 VCP UBQLN2 TARDBP SQSTM1 SOD1 OPTN
18 frontotemporal dementia and/or amyotrophic lateral sclerosis 4 35.7 PRPH CHCHD10
19 amyotrophic lateral sclerosis type 22 35.5 UBQLN2 PRPH
20 frontotemporal dementia and/or amyotrophic lateral sclerosis 2 35.5 PRPH CHCHD10
21 progressive muscular atrophy 35.2 VCP VAPB UBQLN2 TARDBP SOD1 FUS
22 amyotrophic lateral sclerosis type 5 35.1 VAPB SOD1
23 perry syndrome 34.8 VCP TARDBP FUS DCTN1 CHMP2B C9orf72
24 spinocerebellar ataxia 2 34.7 VAPB UBQLN2 TARDBP SOD1 MATR3 HNRNPA1
25 progressive bulbar palsy 34.5 VAPB TARDBP SOD1 FUS C9orf72
26 neuromuscular disease 34.5 SOD1 NEFH FIG4 DCTN1 C9orf72
27 dementia 34.3 VCP UBQLN2 TARDBP SQSTM1 SOD1 HNRNPA1
28 amyotrophic lateral sclerosis 4, juvenile 34.3 VAPB UBQLN2 TARDBP SOD1 OPTN FUS
29 lateral sclerosis 34.2 VCP VAPB UBQLN2 TARDBP SQSTM1 SOD1
30 pick disease of brain 33.6 VCP UBQLN2 TARDBP SQSTM1 SOD1 OPTN
31 spinal muscular atrophy 33.6 VAPB TARDBP SQSTM1 SOD1 HNRNPA1 FUS
32 amyotrophic lateral sclerosis 21 33.5 VAPB PRPH MATR3 FUS
33 motor neuron disease 33.4 VCP VAPB TARDBP SQSTM1 SOD1 PFN1
34 charcot-marie-tooth disease 33.2 VCP VAPB SOD1 PRPH NEFH FIG4
35 supranuclear palsy, progressive, 1 33.2 VCP TARDBP SOD1 FUS DCTN1 CHMP2B
36 dementia, lewy body 33.2 VCP TARDBP SOD1 FUS CHMP2B C9orf72
37 myopathy 33.1 VCP SQSTM1 MATR3 HNRNPA1 CHCHD10
38 aphasia 33.0 VCP TARDBP OPTN FUS CHMP2B C9orf72
39 muscular disease 32.8 VCP TARDBP SQSTM1 SOD1 MATR3 HNRNPA1
40 hemochromatosis, type 1 32.7 VAPB SOD1 OPTN NEFH FUS FIG4
41 autosomal dominant cerebellar ataxia 32.7 VCP TARDBP SOD1 FUS C9orf72
42 spinal and bulbar muscular atrophy, x-linked 1 32.5 TARDBP SOD1 FUS DCTN1 C9orf72
43 muscular atrophy 32.5 VAPB TARDBP HNRNPA1 FUS DCTN1 CHCHD10
44 amyotrophic lateral sclerosis 9 32.4 VAPB UBQLN2 SOD1 OPTN FUS FIG4
45 semantic dementia 32.2 TARDBP CHMP2B C9orf72
46 paget's disease of bone 32.2 VCP SQSTM1 OPTN HNRNPA1
47 inclusion body myositis 32.2 VCP TARDBP SQSTM1 OPTN
48 dystonia 32.1 SQSTM1 FUS DCTN1 CHMP2B C9orf72
49 dysgraphia 32.1 TARDBP CHMP2B C9orf72
50 amyotrophic lateral sclerosis 7 32.1 PRPH DCTN1 DAO CHMP2B ANG

Graphical network of the top 20 diseases related to Amyotrophic Lateral Sclerosis 1:



Diseases related to Amyotrophic Lateral Sclerosis 1

Symptoms & Phenotypes for Amyotrophic Lateral Sclerosis 1

Human phenotypes related to Amyotrophic Lateral Sclerosis 1:

58 31 (show all 31)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 amyotrophic lateral sclerosis 58 31 obligate (100%) Obligate (100%) HP:0007354
2 generalized muscle weakness 58 31 hallmark (90%) Very frequent (99-80%) HP:0003324
3 neurodegeneration 58 31 hallmark (90%) Very frequent (99-80%) HP:0002180
4 spasticity 58 31 frequent (33%) Frequent (79-30%) HP:0001257
5 emotional lability 58 31 frequent (33%) Frequent (79-30%) HP:0000712
6 depressivity 58 31 frequent (33%) Frequent (79-30%) HP:0000716
7 fatigue 58 31 frequent (33%) Frequent (79-30%) HP:0012378
8 dyspnea 58 31 frequent (33%) Frequent (79-30%) HP:0002094
9 skeletal muscle atrophy 58 31 frequent (33%) Frequent (79-30%) HP:0003202
10 xerostomia 58 31 frequent (33%) Frequent (79-30%) HP:0000217
11 anxiety 58 31 frequent (33%) Frequent (79-30%) HP:0000739
12 respiratory failure 58 31 frequent (33%) Frequent (79-30%) HP:0002878
13 paralysis 58 31 frequent (33%) Frequent (79-30%) HP:0003470
14 pain 58 31 frequent (33%) Frequent (79-30%) HP:0012531
15 fatigable weakness of swallowing muscles 58 31 frequent (33%) Frequent (79-30%) HP:0030195
16 fatigable weakness of respiratory muscles 58 31 frequent (33%) Frequent (79-30%) HP:0030196
17 muscle spasm 31 frequent (33%) HP:0003394
18 nausea and vomiting 58 31 occasional (7.5%) Occasional (29-5%) HP:0002017
19 agitation 58 31 occasional (7.5%) Occasional (29-5%) HP:0000713
20 laryngospasm 58 31 occasional (7.5%) Occasional (29-5%) HP:0025425
21 hyperreflexia 31 HP:0001347
22 sleep apnea 31 HP:0010535
23 muscle weakness 31 HP:0001324
24 motor neuron atrophy 58 Very frequent (99-80%)
25 functional respiratory abnormality 58 Frequent (79-30%)
26 muscle cramps 58 Frequent (79-30%)
27 fatigable weakness of bulbar muscles 58 Frequent (79-30%)
28 fasciculations 31 HP:0002380
29 degeneration of the lateral corticospinal tracts 31 HP:0002314
30 pseudobulbar paralysis 31 HP:0007024
31 degeneration of anterior horn cells 31 HP:0002398

Symptoms via clinical synopsis from OMIM:

56
Neurologic Central Nervous System:
spasticity
hyperreflexia
sleep apnea
ocular motility spared
upper and lower neuron manifestations
more
Laboratory Abnormalities:
reduced cytosolic superoxide dismutase-1 (sod1)

Muscle Soft Tissue:
muscle cramps
fasciculations
muscle weakness and atrophy

Clinical features from OMIM:

105400

UMLS symptoms related to Amyotrophic Lateral Sclerosis 1:


seizures, ataxia, tremor, myoclonus, back pain, pain, headache, hemiplegia, syncope, chronic pain, sciatica, vertigo/dizziness, sleeplessness, muscular fasciculation, muscle cramp, muscle spasticity

GenomeRNAi Phenotypes related to Amyotrophic Lateral Sclerosis 1 according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Decreased viability GR00106-A-0 10.13 DCTN1
2 Decreased viability GR00221-A-2 10.13 SOD1
3 Decreased viability GR00221-A-3 10.13 SOD1
4 Decreased viability GR00221-A-4 10.13 FUS SOD1
5 Decreased viability GR00231-A 10.13 SQSTM1
6 Decreased viability GR00381-A-1 10.13 ANG FIG4 SQSTM1 VCP
7 Decreased viability GR00402-S-2 10.13 ANG C9orf72 CHCHD10 CHMP2B DAO DCTN1
8 no effect GR00402-S-1 9.62 ANG C9orf72 CHCHD10 CHMP2B DAO DCTN1

MGI Mouse Phenotypes related to Amyotrophic Lateral Sclerosis 1:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 behavior/neurological MP:0005386 10.18 C9orf72 CHCHD10 DAO DCTN1 FIG4 NEFH
2 cellular MP:0005384 10.15 ANG C9orf72 CHCHD10 DCTN1 MATR3 NEFH
3 hematopoietic system MP:0005397 10.02 ANG C9orf72 CHCHD10 DCTN1 FIG4 PFN1
4 immune system MP:0005387 10 ANG C9orf72 CHCHD10 DCTN1 FIG4 OPTN
5 mortality/aging MP:0010768 9.97 ANG C9orf72 CHCHD10 CHMP2B DCTN1 FIG4
6 muscle MP:0005369 9.5 CHCHD10 DCTN1 FIG4 SOD1 TARDBP VAPB
7 nervous system MP:0003631 9.47 C9orf72 CHCHD10 CHMP2B DAO DCTN1 FIG4

Drugs & Therapeutics for Amyotrophic Lateral Sclerosis 1

Drugs for Amyotrophic Lateral Sclerosis 1 (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 375)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Mexiletine Approved, Investigational Phase 4 31828-71-4 4178
2
Minocycline Approved, Investigational Phase 4 10118-90-8 5281021
3 Anti-Inflammatory Agents Phase 4
4 Hormone Antagonists Phase 4
5 Hormones Phase 4
6 Nootropic Agents Phase 4
7 Thyrotropin-Releasing Hormone Phase 4
8 TA 0910 Phase 4
9
Olanzapine Approved, Investigational Phase 2, Phase 3 132539-06-1 4585
10
Sargramostim Approved, Investigational Phase 2, Phase 3 123774-72-1, 83869-56-1
11
Lenograstim Approved, Investigational Phase 2, Phase 3 135968-09-1
12
Guaifenesin Approved, Investigational, Vet_approved Phase 3 93-14-1 3516
13
Dextromethorphan Approved Phase 3 125-71-3 5360696 5362449
14
Quinidine Approved, Investigational Phase 3 56-54-2 441074
15
Tocopherol Approved, Investigational Phase 3 1406-66-2, 54-28-4 14986
16
Citalopram Approved Phase 3 59729-33-8 2771
17
Zinc Approved, Investigational Phase 3 7440-66-6 32051
18
Mecasermin Approved, Investigational Phase 3 68562-41-4
19
Ethanol Approved Phase 3 64-17-5 702
20
Ceftriaxone Approved Phase 3 73384-59-5 5479530 5361919
21
Naltrexone Approved, Investigational, Vet_approved Phase 3 16590-41-3 5360515
22
Riluzole Approved, Investigational Phase 3 1744-22-5 5070
23
Methylcobalamin Approved, Investigational Phase 3 13422-55-4
24
Hydroxocobalamin Approved Phase 3 13422-51-0 11953898 15589840
25
Edaravone Approved, Investigational Phase 3 89-25-8 70335
26
Bismuth subsalicylate Approved, Vet_approved Phase 3 14882-18-9 53629521
27
Sodium citrate Approved, Investigational Phase 3 68-04-2
28
Dopamine Approved Phase 3 51-61-6, 62-31-7 681
29
Pramipexole Approved, Investigational Phase 3 104632-26-0 59868 119570
30
Lithium carbonate Approved Phase 2, Phase 3 554-13-2
31
Modafinil Approved, Investigational Phase 3 68693-11-8 4236
32
Tamsulosin Approved, Investigational Phase 3 106133-20-4 129211
33
Coenzyme Q10 Approved, Investigational, Nutraceutical Phase 3 303-98-0 5281915
34
Vitamin E Approved, Nutraceutical, Vet_approved Phase 3 59-02-9 14985
35
Vitamin A Approved, Nutraceutical, Vet_approved Phase 2, Phase 3 68-26-8, 11103-57-4, 22737-96-8 445354 9904001
36
Folic acid Approved, Nutraceutical, Vet_approved Phase 3 59-30-3 6037
37
Cyanocobalamin Approved, Nutraceutical Phase 3 68-19-9 44176380
38
Citric acid Approved, Nutraceutical, Vet_approved Phase 3 77-92-9 311
39
Tyrosine Approved, Investigational, Nutraceutical Phase 3 60-18-4 6057
40 Tocotrienol Investigational Phase 3 6829-55-6
41 Nabiximols Investigational Phase 2, Phase 3 56575-23-6
42
Cobalamin Experimental Phase 3 13408-78-1 6857388
43
Simendan Investigational Phase 3 131741-08-7
44
Ibudilast Investigational Phase 2, Phase 3 50847-11-5 3671
45 Micronutrients Phase 3
46 Trace Elements Phase 3
47 Nutrients Phase 3
48 Neuromuscular Agents Phase 3
49 abobotulinumtoxinA Phase 2, Phase 3
50 rimabotulinumtoxinB Phase 2, Phase 3

Interventional clinical trials:

(show top 50) (show all 620)
# Name Status NCT ID Phase Drugs
1 Role of Non-invasive Ventilation in Amyotrophic Lateral Sclerosis: Volume Versus Pressure Mode Unknown status NCT00560287 Phase 4
2 Care (Canadian ALS Riluzole Evaluation) Multicentre Phase IV Comparative Study of the Effects of Riluzole 50mg Bid on the Survival of ALS Subjects Compared to Historical Controls Completed NCT00542412 Phase 4 Riluzole
3 Mexiletine for the Treatment of Muscle Cramps in ALS Completed NCT01811355 Phase 4 Mexiletine;Placebo
4 Feasibility of Telesurveillance and Home Cough Assistance for Amyotrophic Lateral Patients (ALS) Completed NCT00613899 Phase 4
5 Riluzole in Fragile X Syndrome: A Pilot Study Incorporating Biomarker Assay Completed NCT00895752 Phase 4 Riluzole
6 Modafinil for Treatment of Fatigue in ALS Patients: Pilot Study Completed NCT00614926 Phase 4 Modafinil;Placebo
7 Treatment of Childhood Regressive Autism With Minocycline: an Anti-Inflammatory Agent Active Within the CNS Completed NCT00409747 Phase 4 Minocycline
8 Multicenter, Randomized, Double-blind, Placebo-controlled, Phase IV Clinical Trial to Evaluate and Compare the Safety and Efficacy of C-Trelin OD Tab 5mg(Taltirelin Hydrate) in Patients With Ataxia Induced by Spinocerebellar Degeneration Recruiting NCT04107740 Phase 4 C-Trelin OD Tab(5mg Taltirelin Hydrate);Placebo
9 A Phase III, Multi-Center, Double-Blind, Placebo Controlled, Randomized Study of Creatine Monohydrate in Patients With Amyotrophic Lateral Sclerosis Unknown status NCT00069186 Phase 3 Creatine Monohydrate
10 Randomized, Placebo-controlled Parallel Group Study for the Evaluation of an Oral Dose of 10mg Olanzapine in Combination With Riluzole for the Treatment of Loss of Appetite in Patients With Amyotrophic Lateral Sclerosis (ALS) Unknown status NCT00876772 Phase 2, Phase 3 Olanzapine
11 Phase 2/3 Application of Botulinum Neurotoxin Type A in Salivary Glands as a Treatment of Chronic Drooling in Patients With Cerebral Palsy: A Controlled Clinical Trial. Unknown status NCT01489904 Phase 2, Phase 3
12 A Phase II/III Study in Patients With Amyotrophic Lateral Sclerosis (ALS) Completed NCT00444613 Phase 2, Phase 3 E0302 (mecobalamin);E0302 (mecobalamin);Placebo
13 Phase II/III Randomized, Placebo-Controlled Trial of Arimoclomol in SOD1 Positive Familial Amyotrophic Lateral Sclerosis (ALS) Completed NCT00706147 Phase 2, Phase 3 Arimoclomol;Placebo
14 A Randomized, Double-Blind, Placebo-Controlled, Multi-Center Study of the Safety and Efficacy of Dexpramipexole in Subjects With Amyotrophic Lateral Sclerosis Completed NCT01281189 Phase 3 Dexpramipexole;Placebo
15 A Randomized, Double-Blind, Placebo-Controlled Study of Safety and Efficacy of Botulinum Toxin Type B (Myobloc) in Sialorrhea in Amyotrophic Lateral Sclerosis Completed NCT00125203 Phase 2, Phase 3 Botulinum toxin type B (Myobloc)
16 A Long-Term Study in Patients With Amyotrophic Lateral Sclerosis (ALS) Completed NCT00445172 Phase 2, Phase 3 E0302 (mecobalamin)
17 The Effect of Granulocyte Colony Stimulating Factor (GCSF) in the Treatment of Amyotrophic Lateral Sclerosis (ALS) Patients Referred to Tehran Imam Khomeini and Shariati Hospital Centers in 2013 Completed NCT01825551 Phase 2, Phase 3 Granulocyte Colony Stimulating Factor;Placebo
18 Effect of Intrathecal Administration of Hematopoietic Stem Cells in Patients With Amyotrophic Lateral Sclerosis (ALS) Completed NCT01933321 Phase 2, Phase 3
19 A Double-Blind Controlled, Multicenter Phase II/III Study to Assess the Safety and Efficacy of AVP-923 (Dextromethorphan/Quinidine) in the Treatment of Pseudobulbar Affect in Patients With Amyotrophic Lateral Sclerosis Completed NCT00021697 Phase 3 AVP-923
20 Phase 2-3 - Memantine for Disability in Amyotrophic Lateral Sclerosis Completed NCT00353665 Phase 2, Phase 3 Memantine (Ebixa);riluzole;Placebo
21 A Phase 3, Open-Label Extension Study of Tirasemtiv for Patients With Amyotrophic Lateral Sclerosis (ALS) Who Completed VITALITY-ALS (CY 4031) Completed NCT02936635 Phase 3 tirasemtiv
22 An Expanded Controlled Study of MCI-186 for Treatment of Amyotrophic Lateral Sclerosis in Double-Blind, Parallel-Group, Placebo-Controlled Manner (Phase 3) Completed NCT00424463 Phase 3 MCI-186;Placebo of MCI-186
23 Efficacy and Safety Study of MCI-186 for Treatment of the Patients With Amyotrophic Lateral Sclerosis (ALS) 2 Completed NCT01492686 Phase 3 MCI-186;Placebo;MCI-186 in open label phase
24 Multicenter, Randomised, Double-blind, Placebo-controlled, Parallel Group, Phase 2/3 Study to Compare the Efficacy and Safety of Masitinib Completed NCT02588677 Phase 2, Phase 3 Masitinib (4.5);Riluzole;Placebo;Masitinib (3.0)
25 An Exploratory Study of MCI-186 for Treatment of Amyotrophic Lateral Sclerosis (Severity Classification III) in Double-Blind, Parallel-Group, Placebo-Controlled Manner Completed NCT00415519 Phase 3 MCI-186;Placebo of MCI-186
26 A Confirmatory Study of MCI-186 for Treatment of Amyotrophic Lateral Sclerosis in Double-blind, Parallel-group, Placebo-controlled Manner. Completed NCT00330681 Phase 3 MCI-186;Placebo of MCI-186
27 An Open-label, 8- Week, Flexible Dose Trial of Escitalopram (Lexapro®) in Comorbid Major Depression With Amyotrophic Lateral Sclerosis and Multiple Sclerosis Completed NCT00965497 Phase 3 escitalopram
28 A Fase II, Randomized, Double-Blind, Placebo-Controlled, Multicentre Study for the Safety and Efficacy on Spasticity Symptoms of a Cannabis Sativa Extract in Motor Neuron Disease Patients Completed NCT01776970 Phase 2, Phase 3 Cannabis Sativa extract Oromucosal spray
29 A Phase 3, Multi-National, Double-Blind, Randomized, Placebo-Controlled, Stratified, Parallel Group, Study to Evaluate the Safety, Tolerability and Efficacy of Tirasemtiv in Patients With Amyotrophic Lateral Sclerosis (ALS) Completed NCT02496767 Phase 3 tirasemtiv;Placebo tablets;Riluzole 50 MG
30 An Open-label Safety Extension Study of TRO19622 in Amyotrophic Lateral Sclerosis (ALS) Patients Treated With Riluzole Completed NCT01285583 Phase 2, Phase 3 TRO19622
31 Insulin-like Growth Factor-1 in Amyotrophic Lateral Sclerosis (ALS) Completed NCT00035815 Phase 3 Insulin like growth factor, type 1;Placebo
32 A Randomized, Double-Blind, Placebo-Controlled Sequential Clinical Trial of Sodium Valproate in ALS Completed NCT00136110 Phase 3 Sodium Valproate
33 Randomized Crossover Design Trial of Vitamin E vs Placebo for Treatment of Cramps in Amyotrophic Lateral Sclerosis. Completed NCT00372879 Phase 3
34 Phase II/III, Multicenter, Randomized, Parallel Group, Double-blind, Placebo Controlled Study to Assess Safety and Efficacy of TRO19622 in Amyotrophic Lateral Sclerosis (ALS) Patients Treated With Riluzole Completed NCT00868166 Phase 3 Olesoxime;Placebo Comparator;Riluzole
35 Noninvasive Ventilation in ALS Patients With Mild Respiratory Involvement Completed NCT00386464 Phase 2, Phase 3
36 Study of Dopamine and Serotonin Transporters in Patients With Amyotrophic Lateral Sclerosis and Controls. Analysis With 123I-FP-CIT (Datscan) and 123I-ADAM Brain SPECT Completed NCT01160263 Phase 3 SPECT : 123 I-FP-CIT (DATSCAN) and 123I-ADAM
37 Minocycline to Treat Amyotrophic Lateral Sclerosis Completed NCT00047723 Phase 3 minocycline
38 A European, Randomised, Double-blind, Active Comparator Controlled, Cross-over, Efficacy and Safety Study of a New 10% Ready To-use Liquid Human Intravenous Immunoglobulin (I10E) Versus Kiovig® in Patients With Multifocal Motor Neuropathy Completed NCT01951924 Phase 3 Biological : I10E (Human normal Immunoglobulin for intravenous administration 100mg/mL);Biological: Kiovig® (Human normal Immunoglobulin for intravenous administration 100mg/mL)
39 Clinical Trial Ceftriaxone in Subjects With Amyotrophic Lateral Sclerosis (ALS) Completed NCT00349622 Phase 3 ceftriaxone
40 Repetitive Transcranial Magnetic Stimulation in Amyotrophic Lateral Sclerosis Completed NCT00833820 Phase 2, Phase 3
41 A Double-Blind, Randomized, Placebo-Controlled, Multicenter Study to Assess the Safety and Efficacy and to Determine the Pharmacokinetics of Two Doses of AVP-923 (Dextromethorphan/Quinidine) in the Treatment of Pseudobulbar Affect (PBA) in Patients With Amyotrophic Lateral Sclerosis (ALS) and Multiple Sclerosis (MS) Completed NCT00573443 Phase 3 dextromethorphan hydrobromide 20 mg and quinidine sulfate 10 mg;dextromethorphan hydrobromide 30 mg and quinidine sulfate 10 mg;Placebo
42 A Phase 3, Multicenter, Double-Blind, Placebo-Controlled, Single-Treatment Efficacy and Safety Study of MYOBLOC® (Part A) Followed by Open-Label, Multiple-Treatment With MYOBLOC® (Part B) in the Treatment of Troublesome Sialorrhea in Adult Subjects Completed NCT01994109 Phase 3 MYOBLOC
43 Efficacy of Riluzole in Patients With Cervical Spondylotic Myelopathy Undergoing Surgical Treatment. A Randomized, Double-Blind, Placebo-controlled Multi-Center Study Completed NCT01257828 Phase 3 riluzole;Placebo medication
44 Double-Blind, Randomised, Two-Armed Study for the Evaluation of Efficacy and Safety of Minocycline for Treatment Completed NCT00146809 Phase 3 Minocyline
45 A Double-blind Randomised Controlled Trial Investigating the Most Efficacious Dose of Botulinum Toxin-A for Sialorrhoea Treatment in Asian Adults With Neurological Diseases Completed NCT02425176 Phase 2, Phase 3 Botulinum toxin A (BoNT-A) 50U;Botulinum toxin A (BoNT-A) 100U;Botulinum toxin A (BoNT-A) 200U
46 A Randomized Placebo-Controlled, Crossover-Design Study of the Effects of Low Dose Naltrexone on Quality of Life as Measured by the Multiple Sclerosis Quality of Life Inventory (MSQLI54) Completed NCT00501696 Phase 3 4.5 mg Naltrexone;Naltrexone
47 Preventing Loss of Independence Through Exercise (PLIE) in Persons With Dementia Completed NCT02350127 Phase 2, Phase 3
48 A Double Blind Randomized Study of Minocycline for the Treatment of Negative and Cognitive Symptoms in Early-Phase Schizophrenia Completed NCT00733057 Phase 3 Minocycline;Placebo (200 mg/day)
49 Japanese Early-stage Clinical Trial of Ultra-high Dose Methylcobalamin for Amyotrophic Lateral Sclerosis: a Pivotal Phase 3 Randomized Controlled Study Recruiting NCT03548311 Phase 3 methylcobalamin;saline solution
50 A Randomised, Double-blind, Single-centre Study on the Safety, Tolerability and Efficacy of Cannabis Based Medicine Extract (CannTrust CBD Oil) in Slowing the Disease Progression in Amyotrophic Lateral Sclerosis or Motor Neurone Disease Patients Recruiting NCT03690791 Phase 3 CannTrust CBD Oil (capsule);Placebo (capsule)

Search NIH Clinical Center for Amyotrophic Lateral Sclerosis 1

Inferred drug relations via UMLS 71 / NDF-RT 50 :


Riluzole

Cell-based therapeutics:


LifeMap Discovery
Data from LifeMap, the Embryonic Development and Stem Cells Database
Read about Amyotrophic Lateral Sclerosis 1 cell therapies at LifeMap Discovery.
Stem-cell-based therapeutic approaches for Amyotrophic Lateral Sclerosis 1:
Mesenchymal stem cell transplantation in amyotrophic lateral sclerosis patients
Autologous bone marrow-derived stem cells for treatment of amyotrophic lateral sclerosis
NurOwn, mesenchymal stem cells secreting NTF for neurodegenerative diseases
Mesenchymal stem cells for amyotrophic lateral sclerosis
NSI-566, spinal cord stem cells for neurological disorders
HYNR-CS inj, bone marrow-derived stem cells for amyotrophic lateral sclerosis
Umbilical cord-derived mesenchymal stem cells for treatment of amyotrophic lateral sclerosis
Human mesenchymal stem cell transplantation in mouse model of amyotrophic lateral sclerosis
Neural stem cell transplantation for amyotrophic lateral sclerosis
Human fetal neural stem cells for treatment of amyotrophic lateral sclerosis
MotorGraft, embryonic stem cell-derived motor neuron progenitors for neuromuscular diseases
Embryonic/Adult Cultured Cells Related to Amyotrophic Lateral Sclerosis 1:
Bone marrow-derived mesenchymal stem cells PMIDs: 18586098
Bone marrow-derived mesenchymal stem cells (HYNR-CS inj) PMIDs: 20117176
Bone marrow-derived mesenchymal stem cells PMIDs: 21954839 19682989 17582439
Neural stem cells LewisX+ CXCR4+ PMIDs: 17439986
Fetal spinal cord stem cells (NSI-566) PMIDs: 22415942 19326469
Astrocyte-like cells PMIDs: 19603590 19127447
Bone marrow-derived mononuclear cells
Umbilical cord-derived mesenchymal stem cells (family)
Motor neuron progenitor cells
Adipose-derived mesenchymal stem cells (family)

Cochrane evidence based reviews: amyotrophic lateral sclerosis

Genetic Tests for Amyotrophic Lateral Sclerosis 1

Genetic tests related to Amyotrophic Lateral Sclerosis 1:

# Genetic test Affiliating Genes
1 Amyotrophic Lateral Sclerosis 29 C9orf72 OPTN UBQLN2 VCP
2 Amyotrophic Lateral Sclerosis Type 1 29 NEFH PRPH SOD1
3 Amyotrophic Lateral Sclerosis, Susceptibility to 29

Anatomical Context for Amyotrophic Lateral Sclerosis 1

MalaCards organs/tissues related to Amyotrophic Lateral Sclerosis 1:

40
Brain, Spinal Cord, Bone, Skeletal Muscle, Testes, Skin, Cortex
LifeMap Discovery
Data from LifeMap, the Embryonic Development and Stem Cells Database

Cells/anatomical compartments in embryo or adult related to Amyotrophic Lateral Sclerosis 1:
# Tissue Anatomical CompartmentCell Relevance
1 Bone Bone Marrow Bone Marrow Stromal Cells Potential therapeutic candidate
2 Limb Pelvic Girdle Bone Marrow Stromal Cells Potential therapeutic candidate
3 Brain Forebrain White Matter Fibrous Astrocyte Cells Potential therapeutic candidate
4 Spinal Cord Spinal Cord White Matter Fibrous Astrocyte Cells Potential therapeutic candidate
5 Adipose Subcutaneous White Adipose Mesenchymal Stem Cells Potential therapeutic candidate
6 Neural Tube Motor Neural Progenitor Domain Motor Neural Progenitor Cells Potential therapeutic candidate
7 Neural Tube Motor Neural Progenitor Domain Motor Neurons Affected by disease
8 Brain Forebrain White Matter Myelinating Oligodendrocyte Cells Affected by disease
9 Spinal Cord Spinal Cord White Matter Myelinating Oligodendrocyte Cells Affected by disease
10 Spinal Cord Spinal Cord Grey Matter Protoplasmic Astrocyte Cells Potential therapeutic candidate
11 Brain Neocortex Protoplasmic Astrocyte Cells Potential therapeutic candidate
12 Adipose Subcutaneous White Adipose Stromal Cells Potential therapeutic candidate
13 Spinal Cord Spinal Cord White Matter VA1 Fibrous Astrocyte Cells Potential therapeutic candidate
14 Spinal Cord Spinal Cord White Matter VA2 Fibrous Astrocyte Cells Potential therapeutic candidate
15 Spinal Cord Spinal Cord White Matter VA3 Fibrous Astrocyte Cells Potential therapeutic candidate

Publications for Amyotrophic Lateral Sclerosis 1

Articles related to Amyotrophic Lateral Sclerosis 1:

(show top 50) (show all 22111)
# Title Authors PMID Year
1
SOD1, ANG, VAPB, TARDBP, and FUS mutations in familial amyotrophic lateral sclerosis: genotype-phenotype correlations. 61 56 6
20577002 2010
2
An immunological epitope selective for pathological monomer-misfolded SOD1 in ALS. 61 56 6
17486090 2007
3
The G93C mutation in superoxide dismutase 1: clinicopathologic phenotype and prognosis. 61 56 6
16476815 2006
4
A frameshift deletion in peripherin gene associated with amyotrophic lateral sclerosis. 61 56 6
15322088 2004
5
Recessive amyotrophic lateral sclerosis families with the D90A SOD1 mutation share a common founder: evidence for a linked protective factor. 61 56 6
9817920 1998
6
Amyotrophic lateral sclerosis associated with homozygosity for an Asp90Ala mutation in CuZn-superoxide dismutase. 61 56 6
7647793 1995
7
Cu/Zn superoxide dismutase (SOD1) mutations and sporadic amyotrophic lateral sclerosis. 61 56 6
8105280 1993
8
Amyotrophic lateral sclerosis and structural defects in Cu,Zn superoxide dismutase. 61 56 6
8351519 1993
9
Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. 61 56 6
8446170 1993
10
EFNS task force on management of amyotrophic lateral sclerosis: guidelines for diagnosing and clinical care of patients and relatives. 61 24 6
16324086 2005
11
Point mutations of the p150 subunit of dynactin (DCTN1) gene in ALS. 56 6
15326253 2004
12
The inheritance of progressive muscular atrophy as a dominant trait in two New England families. 56 6
13804989 1960
13
"Wetherbee Ail"; the inheritance of progressive muscular atrophy as a dominant trait in two New England families. 56 6
14875225 1951
14
TARDBP 3'-UTR variant in autopsy-confirmed frontotemporal lobar degeneration with TDP-43 proteinopathy. 54 61 6
19618195 2009
15
A large-scale international meta-analysis of paraoxonase gene polymorphisms in sporadic ALS. 54 61 56
19321847 2009
16
Lack of evidence of monomer/misfolded superoxide dismutase-1 in sporadic amyotrophic lateral sclerosis. 54 61 56
19670443 2009
17
High frequency of TARDBP gene mutations in Italian patients with amyotrophic lateral sclerosis. 54 61 6
19224587 2009
18
Mutations of the ANG gene in French patients with sporadic amyotrophic lateral sclerosis. 54 61 6
18852347 2008
19
Two German kindreds with familial amyotrophic lateral sclerosis due to TARDBP mutations. 54 61 6
18779421 2008
20
TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis. 54 61 6
18396105 2008
21
TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. 54 61 6
18309045 2008
22
Identification of new ANG gene mutations in a large cohort of Italian patients with amyotrophic lateral sclerosis. 54 61 6
18087731 2008
23
Angiogenin loss-of-function mutations in amyotrophic lateral sclerosis. 54 61 6
17886298 2007
24
Expression of Nogo-A in human muscle fibers is not specific for amyotrophic lateral sclerosis. 54 61 56
17894379 2007
25
SMN1 gene, but not SMN2, is a risk factor for sporadic ALS. 54 61 56
16931506 2006
26
ANG mutations segregate with familial and 'sporadic' amyotrophic lateral sclerosis. 54 61 6
16501576 2006
27
Heterozygous R1101K mutation of the DCTN1 gene in a family with ALS and FTD. 54 61 6
16240349 2005
28
A pathogenic peripherin gene mutation in a patient with amyotrophic lateral sclerosis. 54 61 6
15446584 2004
29
Early onset of severe familial amyotrophic lateral sclerosis with a SOD-1 mutation: potential impact of CNTF as a candidate modifier gene. 54 61 56
11951178 2002
30
Abnormal SMN1 gene copy number is a susceptibility factor for amyotrophic lateral sclerosis. 54 61 56
11835381 2002
31
A novel mutation (Cys6Gly) in the Cu/Zn superoxide dismutase gene associated with rapidly progressive familial amyotrophic lateral sclerosis. 54 61 6
10624810 1999
32
Exon 5 encoded domain is not required for the toxic function of mutant SOD1 but essential for the dismutase activity: identification and characterization of two new SOD1 mutations associated with familial amyotrophic lateral sclerosis. 54 61 6
10735277 1997
33
Epidemiology of mutations in superoxide dismutase in amyotrophic lateral sclerosis. 54 61 56
9029070 1997
34
Transgenic mice carrying a human mutant superoxide dismutase transgene develop neuronal cytoskeletal pathology resembling human amyotrophic lateral sclerosis lesions. 54 61 56
8610185 1996
35
A novel two-base mutation in the Cu/Zn superoxide dismutase gene associated with familial amyotrophic lateral sclerosis in Japan. 54 61 6
8907321 1996
36
Variable clinical symptoms in familial amyotrophic lateral sclerosis with a novel point mutation in the Cu/Zn superoxide dismutase gene. 54 61 6
7501156 1995
37
Superoxide dismutase mutations in an unselected cohort of Scottish amyotrophic lateral sclerosis patients. 54 61 6
7643359 1995
38
Superoxide dismutase 1 with mutations linked to familial amyotrophic lateral sclerosis possesses significant activity. 54 61 6
8058797 1994
39
A novel mutation in Cu/Zn superoxide dismutase gene in Japanese familial amyotrophic lateral sclerosis. 54 61 6
8179602 1994
40
A phenotype of atypical apraxia of speech in a family carrying SQSTM1 mutation. 61 6
25114083 2015
41
Phenotype of matrin-3-related distal myopathy in 16 German patients. 61 6
25154462 2014
42
Rare mutations in SQSTM1 modify susceptibility to frontotemporal lobar degeneration. 61 6
24899140 2014
43
Mutations in the Matrin 3 gene cause familial amyotrophic lateral sclerosis. 61 6
24686783 2014
44
Targeted high-throughput sequencing identifies a TARDBP mutation as a cause of early-onset FTD without motor neuron disease. 61 6
24300238 2014
45
UBQLN2 mutation causing heterogeneous X-linked dominant neurodegeneration. 61 6
24771548 2014
46
Sequestosome-1 (SQSTM1) sequence variants in ALS cases in the UK: prevalence and coexistence of SQSTM1 mutations in ALS kindred with PDB. 61 6
23942205 2014
47
SQSTM1 mutations in French patients with frontotemporal dementia or frontotemporal dementia with amyotrophic lateral sclerosis. 61 6
24042580 2013
48
ERBB4 mutations that disrupt the neuregulin-ErbB4 pathway cause amyotrophic lateral sclerosis type 19. 61 6
24119685 2013
49
Mutations in prion-like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS. 61 6
23455423 2013
50
Inhibition of RNA lariat debranching enzyme suppresses TDP-43 toxicity in ALS disease models. 61 56
23104007 2012

Variations for Amyotrophic Lateral Sclerosis 1

ClinVar genetic disease variations for Amyotrophic Lateral Sclerosis 1:

6 (show top 50) (show all 216) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 SOD1 NM_000454.4(SOD1):c.435G>C (p.Leu145Phe)SNV Pathogenic 586637 rs1482760341 21:33040861-33040861 21:31668548-31668548
2 SOD1 NM_000454.4(SOD1):c.112G>C (p.Gly38Arg)SNV Pathogenic 549678 rs121912431 21:33036142-33036142 21:31663829-31663829
3 SOD1 SOD1, IVS4AS, C-G, -304SNV Pathogenic 14786
4 SOD1 SOD1, 6-BP DEL, GGACCAdeletion Pathogenic 14785
5 SOD1 NM_000454.4(SOD1):c.280G>C (p.Gly94Arg)SNV Pathogenic 14784 rs121912437 21:33039611-33039611 21:31667298-31667298
6 SOD1 NM_000454.4(SOD1):c.242A>G (p.His81Arg)SNV Pathogenic 14782 rs121912458 21:33039573-33039573 21:31667260-31667260
7 SOD1 NM_000454.4(SOD1):c.137T>G (p.Phe46Cys)SNV Pathogenic 14781 rs121912457 21:33036167-33036167 21:31663854-31663854
8 SOD1 NM_000454.4(SOD1):c.37G>C (p.Gly13Arg)SNV Pathogenic 14780 rs121912456 21:33032119-33032119 21:31659806-31659806
9 SOD1 NM_000454.4(SOD1):c.217G>A (p.Gly73Ser)SNV Pathogenic 14779 rs121912455 21:33038809-33038809 21:31666496-31666496
10 SOD1 NM_000454.4(SOD1):c.358-11A>GSNV Pathogenic 14778 21:33040773-33040773 21:31668460-31668460
11 SOD1 NM_000454.4(SOD1):c.380T>A (p.Leu127Ter)SNV Pathogenic 14777 rs121912454 21:33040806-33040806 21:31668493-31668493
12 SOD1 NM_000454.4(SOD1):c.49G>A (p.Gly17Ser)SNV Pathogenic 14776 rs121912453 21:33032131-33032131 21:31659818-31659818
13 SOD1 NM_000454.4(SOD1):c.253T>G (p.Leu85Val)SNV Pathogenic 14775 rs121912452 21:33039584-33039584 21:31667271-31667271
14 SOD1 NM_000454.4(SOD1):c.404G>A (p.Ser135Asn)SNV Pathogenic 14774 rs121912451 21:33040830-33040830 21:31668517-31668517
15 SOD1 NM_000454.4(SOD1):c.64G>A (p.Glu22Lys)SNV Pathogenic 14773 rs121912450 21:33032146-33032146 21:31659833-31659833
16 SOD1 NM_000454.4(SOD1):c.455T>C (p.Ile152Thr)SNV Pathogenic 14772 rs121912449 21:33040881-33040881 21:31668568-31668568
17 SOD1 NM_000454.4(SOD1):c.20G>T (p.Cys7Phe)SNV Pathogenic 14771 rs121912448 21:33032102-33032102 21:31659789-31659789
18 SOD1 NM_000454.4(SOD1):c.358-10T>GSNV Pathogenic 14770 21:33040774-33040774 21:31668461-31668461
19 SOD1 NM_000454.4(SOD1):c.436G>A (p.Ala146Thr)SNV Pathogenic 14769 rs121912447 21:33040862-33040862 21:31668549-31668549
20 SOD1 NM_000454.4(SOD1):c.434T>C (p.Leu145Ser)SNV Pathogenic 14768 rs121912446 21:33040860-33040860 21:31668547-31668547
21 SOD1 NM_000454.4(SOD1):c.13G>A (p.Ala5Thr)SNV Pathogenic 14765 rs121912444 21:33032095-33032095 21:31659782-31659782
22 SOD1 NM_000454.4(SOD1):c.140A>G (p.His47Arg)SNV Pathogenic 14764 rs121912443 21:33036170-33036170 21:31663857-31663857
23 SOD1 NM_000454.4(SOD1):c.14C>T (p.Ala5Val)SNV Pathogenic 14763 rs121912442 21:33032096-33032096 21:31659783-31659783
24 SOD1 NM_000454.4(SOD1):c.338T>C (p.Ile113Thr)SNV Pathogenic 14762 rs74315452 21:33039669-33039669 21:31667356-31667356
25 SOD1 NM_000454.4(SOD1):c.302A>G (p.Glu101Gly)SNV Pathogenic 14761 rs121912439 21:33039633-33039633 21:31667320-31667320
26 SOD1 NM_000454.4(SOD1):c.281G>C (p.Gly94Ala)SNV Pathogenic 14760 rs121912438 21:33039612-33039612 21:31667299-31667299
27 SOD1 NM_000454.4(SOD1):c.280G>T (p.Gly94Cys)SNV Pathogenic 14759 rs121912437 21:33039611-33039611 21:31667298-31667298
28 SOD1 NM_000454.4(SOD1):c.256G>C (p.Gly86Arg)SNV Pathogenic 14758 rs121912436 21:33039587-33039587 21:31667274-31667274
29 SOD1 NM_000454.4(SOD1):c.319C>G (p.Leu107Val)SNV Pathogenic 14757 rs121912440 21:33039650-33039650 21:31667337-31667337
30 SOD1 NM_000454.4(SOD1):c.131A>G (p.His44Arg)SNV Pathogenic 14756 rs121912435 21:33036161-33036161 21:31663848-31663848
31 SOD1 NM_000454.4(SOD1):c.125G>A (p.Gly42Asp)SNV Pathogenic 14755 rs121912434 21:33036155-33036155 21:31663842-31663842
32 SOD1 NM_000454.4(SOD1):c.124G>A (p.Gly42Ser)SNV Pathogenic 14754 rs121912433 21:33036154-33036154 21:31663841-31663841
33 SOD1 NM_000454.4(SOD1):c.112G>A (p.Gly38Arg)SNV Pathogenic 14752 rs121912431 21:33036142-33036142 21:31663829-31663829
34 DCTN1 NM_004082.4(DCTN1):c.175G>A (p.Gly59Ser)SNV Pathogenic 8401 rs121909342 2:74605231-74605231 2:74378104-74378104
35 SOD1 NM_000454.4(SOD1):c.341T>C (p.Ile114Thr)SNV Pathogenic 197145 rs121912441 21:33039672-33039672 21:31667359-31667359
36 SOD1 NC_000021.9:g.31667335C>TSNV Pathogenic 695024 21:33039648-33039648 21:31667335-31667335
37 SOD1 NM_000454.4(SOD1):c.301G>A (p.Glu101Lys)SNV Pathogenic/Likely pathogenic 574319 rs76731700 21:33039632-33039632 21:31667319-31667319
38 SOD1 NM_000454.5(SOD1):c.146A>G (p.His49Arg)SNV Likely pathogenic 807693 21:33036176-33036176 21:31663863-31663863
39 SOD1 NM_000454.4(SOD1):c.260A>G (p.Asn87Ser)SNV Likely pathogenic 468253 rs11556620 21:33039591-33039591 21:31667278-31667278
40 SOD1 NM_000454.4(SOD1):c.443G>A (p.Gly148Asp)SNV Likely pathogenic 536142 rs1555836950 21:33040869-33040869 21:31668556-31668556
41 SOD1 NM_000454.4(SOD1):c.290A>T (p.Asp97Val)SNV Likely pathogenic 692200 21:33039621-33039621 21:31667308-31667308
42 NEFH NM_021076.4(NEFH):c.2015_2056CAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG[1] (p.672_685AEAKSPEKAKSPVK[1])short repeat risk factor 14035 rs606231212 22:29885610-29885651 22:29489621-29489662
43 PRPH PRPH, 1-BP DEL, 228Cdeletion risk factor 13706
44 DCTN1 NM_004082.4(DCTN1):c.3302G>A (p.Arg1101Lys)SNV risk factor 8405 rs121909345 2:74590464-74590464 2:74363337-74363337
45 DCTN1 NM_004082.4(DCTN1):c.1712T>C (p.Met571Thr)SNV risk factor 8403 rs121909343 2:74595997-74595997 2:74368870-74368870
46 SOD1 NM_000454.4(SOD1):c.115C>G (p.Leu39Val)SNV Likely pathogenic 14753 rs121912432 21:33036145-33036145 21:31663832-31663832
47 NEFH NM_021076.4(NEFH):c.2368_2370del (p.Lys790del)deletion Conflicting interpretations of pathogenicity 66740 rs59551486 22:29885997-29885999 22:29490008-29490010
48 SOD1 NM_000454.4(SOD1):c.272A>C (p.Asp91Ala)SNV Conflicting interpretations of pathogenicity 14766 rs80265967 21:33039603-33039603 21:31667290-31667290
49 PRPH NM_006262.4(PRPH):c.421G>T (p.Asp141Tyr)SNV Conflicting interpretations of pathogenicity 13707 rs58599399 12:49689404-49689404 12:49295621-49295621
50 UBQLN2 NM_013444.3(UBQLN2):c.1573C>T (p.Pro525Ser)SNV Conflicting interpretations of pathogenicity 29954 rs369947678 X:56591879-56591879 X:56565446-56565446

UniProtKB/Swiss-Prot genetic disease variations for Amyotrophic Lateral Sclerosis 1:

73 (show top 50) (show all 83)
# Symbol AA change Variation ID SNP ID
1 DCTN1 p.Met571Thr VAR_063872 rs121909343
2 DCTN1 p.Arg785Trp VAR_063873 rs121909344
3 DCTN1 p.Arg1101Lys VAR_063874 rs121909345
4 SOD1 p.Ala5Thr VAR_007130 rs121912444
5 SOD1 p.Ala5Val VAR_007131 rs121912442
6 SOD1 p.Val8Glu VAR_007132
7 SOD1 p.Val15Met VAR_007133
8 SOD1 p.Gly17Ser VAR_007134 rs121912453
9 SOD1 p.Glu22Lys VAR_007135 rs121912450
10 SOD1 p.Gly38Arg VAR_007136 rs121912431
11 SOD1 p.Leu39Val VAR_007137 rs121912432
12 SOD1 p.Gly42Ser VAR_007138 rs121912433
13 SOD1 p.Gly42Asp VAR_007139 rs121912434
14 SOD1 p.His44Arg VAR_007140 rs121912435
15 SOD1 p.His47Arg VAR_007141 rs121912443
16 SOD1 p.His49Gln VAR_007142
17 SOD1 p.Leu85Val VAR_007143 rs121912452
18 SOD1 p.Gly86Arg VAR_007144 rs121912436
19 SOD1 p.Asp91Ala VAR_007145 rs80265967
20 SOD1 p.Gly94Ala VAR_007146 rs121912438
21 SOD1 p.Gly94Cys VAR_007147 rs121912437
22 SOD1 p.Gly94Asp VAR_007148 rs121912438
23 SOD1 p.Gly94Arg VAR_007149 rs121912437
24 SOD1 p.Glu101Gly VAR_007150 rs121912439
25 SOD1 p.Asp102Gly VAR_007151
26 SOD1 p.Asp102Asn VAR_007152
27 SOD1 p.Leu107Val VAR_007153 rs121912440
28 SOD1 p.Ile113Thr VAR_007154 rs74315452
29 SOD1 p.Ile114Thr VAR_007155 rs121912441
30 SOD1 p.Arg116Gly VAR_007156 rs130163532
31 SOD1 p.Asp126His VAR_007157
32 SOD1 p.Ser135Asn VAR_007158 rs121912451
33 SOD1 p.Asn140Lys VAR_007159 rs1804449
34 SOD1 p.Leu145Phe VAR_007160 rs148276034
35 SOD1 p.Val149Gly VAR_007161 rs147676062
36 SOD1 p.Val149Ile VAR_007162 rs567511139
37 SOD1 p.Ile150Thr VAR_007163 rs142401499
38 SOD1 p.Ile152Thr VAR_007164 rs121912449
39 SOD1 p.Cys7Phe VAR_008717 rs121912448
40 SOD1 p.Gly73Ser VAR_008718 rs121912455
41 SOD1 p.Gly94Val VAR_008719
42 SOD1 p.Ile105Phe VAR_008720 rs121912445
43 SOD1 p.Asp125Val VAR_008722
44 SOD1 p.Leu145Ser VAR_008724 rs121912446
45 SOD1 p.Ala146Thr VAR_008725 rs121912447
46 SOD1 p.Ala5Ser VAR_013518
47 SOD1 p.Leu9Gln VAR_013519
48 SOD1 p.Leu9Val VAR_013520
49 SOD1 p.Gly13Arg VAR_013521 rs121912456
50 SOD1 p.Val15Gly VAR_013522

Copy number variations for Amyotrophic Lateral Sclerosis 1 from CNVD:

7 (show top 50) (show all 271)
# CNVD ID Chromosome Start End Type Gene Symbol CNVD Disease
1 13850 1 10015602 10163883 Deletion UBE4B Amyotrophic lateral sclerosis
2 38070 1 9912362 9925413 Deletion LZIC Amyotrophic lateral sclerosis
3 38081 1 9926072 9968143 Deletion NMNAT1 Amyotrophic lateral sclerosis
4 38110 1 9979860 9998665 Deletion RBP7 Amyotrophic lateral sclerosis
5 38787 10 105052542 105100881 Duplication PCGF6 Amyotrophic lateral sclerosis
6 38794 10 105117713 105138812 Deletion,duplication TAF5 Amyotrophic lateral sclerosis
7 38801 10 105138803 105146213 Deletion,duplication USMG5 Amyotrophic lateral sclerosis
8 38806 10 105146401 105196009 Deletion,duplication PDCD11 Amyotrophic lateral sclerosis
9 38819 10 105196536 105202065 Deletion,duplication CALHM2 Amyotrophic lateral sclerosis
10 38825 10 105222550 105228987 Deletion,duplication CALHM3 Amyotrophic lateral sclerosis
11 38829 10 105244037 105342293 Duplication NEURL Amyotrophic lateral sclerosis
12 38887 10 105717459 105777332 Deletion SLK Amyotrophic lateral sclerosis
13 38957 10 106390848 107014983 Duplication SORCS3 Amyotrophic lateral sclerosis
14 39675 10 11824361 11846071 Duplication ECHDC3 Amyotrophic lateral sclerosis
15 41384 10 17311303 17319598 Deletion VIM Amyotrophic lateral sclerosis
16 41389 10 17402681 17536260 Deletion ST8SIA6 Amyotrophic lateral sclerosis
17 44175 10 53125251 53129361 Duplication CSTF2T Amyotrophic lateral sclerosis
18 46555 10 82021555 82039414 Duplication MAT1A Amyotrophic lateral sclerosis
19 46560 10 82085841 82106480 Duplication DYDC1 Amyotrophic lateral sclerosis
20 46567 10 82106537 82117809 Duplication DYDC2 Amyotrophic lateral sclerosis
21 46573 10 82158221 82182733 Duplication C10orf58 Amyotrophic lateral sclerosis
22 46577 10 82204017 82272371 Duplication TSPAN14 Amyotrophic lateral sclerosis
23 47201 10 90414073 90428552 Duplication LIPF Amyotrophic lateral sclerosis
24 47210 10 90474280 90502493 Duplication LIPK Amyotrophic lateral sclerosis
25 47701 10 96786518 96819244 Duplication CYP2C8 Amyotrophic lateral sclerosis
26 47721 10 96943946 96978675 Duplication C10orf129 Amyotrophic lateral sclerosis
27 47727 10 96987319 97040771 Duplication PDLIM1 Amyotrophic lateral sclerosis
28 51047 11 122214464 122248557 Duplication CRTAM Amyotrophic lateral sclerosis
29 51746 11 130250975 130291592 Duplication SNX19 Amyotrophic lateral sclerosis
30 52817 11 20342262 20345776 Duplication HTATIP2 Amyotrophic lateral sclerosis
31 52820 11 20365678 20487349 Duplication PRMT3 Amyotrophic lateral sclerosis
32 53960 11 35409951 35503752 Deletion DKFZP586H2123 Amyotrophic lateral sclerosis
33 54765 11 47247774 47308158 Deletion MADD Amyotrophic lateral sclerosis
34 58676 11 69165053 69178423 Duplication CCND1 Amyotrophic lateral sclerosis
35 61192 11 95763461 95766375 Duplication JRKL Amyotrophic lateral sclerosis
36 62870 12 112079360 112107667 Deletion DDX54 Amyotrophic lateral sclerosis
37 62876 12 112107937 112114502 Deletion C12orf52 Amyotrophic lateral sclerosis
38 62877 12 112117628 112143263 Deletion IQCD Amyotrophic lateral sclerosis
39 62881 12 112143651 112218317 Deletion TPCN1 Amyotrophic lateral sclerosis
40 63147 12 114880763 115199526 Deletion MED13L Amyotrophic lateral sclerosis
41 63427 12 118607980 118799475 Duplication CIT Amyotrophic lateral sclerosis
42 63663 12 120055060 120108241 Duplication P2RX7 Amyotrophic lateral sclerosis
43 65019 12 14656842 14740696 Deletion GUCY2C Amyotrophic lateral sclerosis
44 65031 12 14814920 14815332 Deletion HIST4H4 Amyotrophic lateral sclerosis
45 65033 12 14818536 14822203 Deletion H2AFJ Amyotrophic lateral sclerosis
46 65036 12 14830678 14847668 Deletion WBP11 Amyotrophic lateral sclerosis
47 65317 12 15664341 15833601 Deletion EPS8 Amyotrophic lateral sclerosis
48 65332 12 15926554 15947677 Deletion Strap Amyotrophic lateral sclerosis
49 65337 12 15955452 16081582 Deletion DERA Amyotrophic lateral sclerosis
50 65486 12 18125069 18134381 Duplication RERGL Amyotrophic lateral sclerosis

Expression for Amyotrophic Lateral Sclerosis 1

LifeMap Discovery
Genes differentially expressed in tissues of Amyotrophic Lateral Sclerosis 1 patients vs. healthy controls: 35 (show all 14)
# Gene Description Tissue Up/Dn Fold Change (log2) P value
1 ACTN3 actinin, alpha 3 (gene/pseudogene) Skeletal Muscle - 5.49 0.000
2 MYH8 myosin, heavy chain 8, skeletal muscle, perinatal Skeletal Muscle + 3.89 0.000
3 PRUNE2 prune homolog 2 (Drosophila) Skeletal Muscle + 3.83 0.001
4 CHRNA1 cholinergic receptor, nicotinic, alpha 1 (muscle) Skeletal Muscle + 3.82 0.000
5 COL19A1 collagen, type XIX, alpha 1 Skeletal Muscle + 3.77 0.000
6 LRRK2 leucine-rich repeat kinase 2 Skeletal Muscle + 3.67 0.001
7 FST follistatin Skeletal Muscle + 3.47 0.001
8 CERKL ceramide kinase-like Skeletal Muscle + 3.46 0.000
9 RMDN2 regulator of microtubule dynamics 2 Skeletal Muscle + 3.44 0.005
10 MYLK2 myosin light chain kinase 2 Skeletal Muscle - 3.27 0.009
11 MUSK muscle, skeletal, receptor tyrosine kinase Skeletal Muscle + 3.22 0.001
12 HOXC10 homeobox C10 Skeletal Muscle - 3.22 0.000
13 SESN3 sestrin 3 Skeletal Muscle + 3.19 0.007
14 CPNE8 copine VIII Skeletal Muscle + 3.06 0.001
Search GEO for disease gene expression data for Amyotrophic Lateral Sclerosis 1.

Pathways for Amyotrophic Lateral Sclerosis 1

Pathways related to Amyotrophic Lateral Sclerosis 1 according to KEGG:

36
# Name Kegg Source Accession
1 Amyotrophic lateral sclerosis (ALS) hsa05014

Pathways related to Amyotrophic Lateral Sclerosis 1 according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1 12.05 VCP PFN1 DCTN1 CHMP2B
2 11.56 TARDBP SOD1 OPTN NEFH DCTN1
3
Show member pathways
11.55 SOD1 PRPH NEFH
4
Show member pathways
11.37 PRPH NEFH DCTN1
5 10.96 SOD1 PFN1 NEFH

GO Terms for Amyotrophic Lateral Sclerosis 1

Cellular components related to Amyotrophic Lateral Sclerosis 1 according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 nucleus GO:0005634 10.17 VCP UBQLN2 TARDBP SQSTM1 SOD1 PFN1
2 cytoplasm GO:0005737 10.1 VCP VAPB UBQLN2 TARDBP SQSTM1 SOD1
3 endosome GO:0005768 9.77 SQSTM1 OPTN FIG4 CHMP2B C9orf72
4 cytoplasmic vesicle GO:0031410 9.43 UBQLN2 SQSTM1 SOD1 OPTN C9orf72 ANG
5 cytoplasmic stress granule GO:0010494 9.33 VCP TARDBP C9orf72
6 autophagosome GO:0005776 8.92 UBQLN2 SQSTM1 OPTN C9orf72

Biological processes related to Amyotrophic Lateral Sclerosis 1 according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 macroautophagy GO:0016236 9.5 VCP SQSTM1 CHMP2B
2 neuron cellular homeostasis GO:0070050 9.4 DCTN1 CHMP2B
3 gene expression GO:0010467 9.37 TARDBP FUS
4 regulation of autophagosome assembly GO:2000785 9.26 UBQLN2 C9orf72
5 neurofilament cytoskeleton organization GO:0060052 9.16 SOD1 NEFH
6 autophagy GO:0006914 9.1 VCP UBQLN2 SQSTM1 OPTN CHMP2B C9orf72
7 maintenance of synapse structure GO:0099558 8.96 DCTN1 CHCHD10

Molecular functions related to Amyotrophic Lateral Sclerosis 1 according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 identical protein binding GO:0042802 9.7 VCP TARDBP SQSTM1 SOD1 OPTN MATR3
2 protein binding GO:0005515 9.6 VCP VAPB UBQLN2 TARDBP SQSTM1 SOD1
3 dynein complex binding GO:0070840 9.32 NEFH DCTN1
4 K63-linked polyubiquitin modification-dependent protein binding GO:0070530 9.26 SQSTM1 OPTN
5 polyubiquitin modification-dependent protein binding GO:0031593 9.13 VCP UBQLN2 OPTN

Sources for Amyotrophic Lateral Sclerosis 1

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....