ARVD1
MCID: ARR045
MIFTS: 44

Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 (ARVD1)

Categories: Cardiovascular diseases, Genetic diseases, Rare diseases, Skin diseases

Aliases & Classifications for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

MalaCards integrated aliases for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1:

Name: Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 57 72 70
Uhl Anomaly 12 73 58 72 44
Arrhythmogenic Right Ventricular Dysplasia 1 57 12 13 15
Arrhythmogenic Right Ventricular Cardiomyopathy 1 57 12 72
Arvc1 57 12 72
Arrhythmogenic Right Ventricular Dysplasia, Familial 1 29 6
Arvd1 57 72
Arrhythmogenic Right Ventricular Cardiomyopathy 1; Arvc1 57
Dysplasia, Arrhythmogenic Right Ventricular, Type 1 39
Cardiomyopathy Right Ventricular Dilated 72

Characteristics:

Orphanet epidemiological data:

58
uhl anomaly
Inheritance: Not applicable; Prevalence: <1/1000000 (Worldwide); Age of onset: Infancy,Neonatal; Age of death: early childhood;

OMIM®:

57 (Updated 20-May-2021)
Inheritance:
autosomal dominant

Miscellaneous:
genetic heterogeneity


HPO:

31
arrhythmogenic right ventricular dysplasia, familial, 1:
Inheritance autosomal dominant inheritance heterogeneous


Classifications:



External Ids:

Disease Ontology 12 DOID:0110070
OMIM® 57 107970
OMIM Phenotypic Series 57 PS107970
ICD10 32 I42.8 Q24.8
MESH via Orphanet 45 C536932
ICD10 via Orphanet 33 Q24.8
UMLS via Orphanet 71 C0265857
Orphanet 58 ORPHA3403
SNOMED-CT via HPO 68 263681008 44103008 95281009
UMLS 70 C1862511

Summaries for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

OMIM® : 57 Arrhythmogenic right ventricular dysplasia (ARVD) is a clinical and pathologic entity for which the diagnosis rests on electrocardiographic and angiographic criteria; pathologic findings, replacement of ventricular myocardium with fatty and fibrous elements, preferentially involve the right ventricular free wall. It is inherited in an autosomal dominant manner with reduced penetrance and is one of the major genetic causes of juvenile sudden death. When the dysplasia is extensive, it may represent the Uhl anomaly ('parchment right ventricle'). The presenting finding is usually recurrent, sustained ventricular tachycardia with left bundle branch block configuration. Basso et al. (2009) provided a detailed review of ARVD, including diagnosis, pathogenesis, treatment options, and genetics. (107970) (Updated 20-May-2021)

MalaCards based summary : Arrhythmogenic Right Ventricular Dysplasia, Familial, 1, also known as uhl anomaly, is related to syncope and right bundle branch block. An important gene associated with Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 is TGFB3 (Transforming Growth Factor Beta 3), and among its related pathways/superpathways are Keratinization and Apoptotic cleavage of cellular proteins. Affiliated tissues include heart and skin, and related phenotypes are sudden cardiac death and ventricular arrhythmia

Disease Ontology : 12 An arrhythmogenic right ventricular dysplasia that has material basis in heterozygous mutation in the TGFB3 gene on chromosome 14q24.

UniProtKB/Swiss-Prot : 72 Arrhythmogenic right ventricular dysplasia, familial, 1: A congenital heart disease characterized by infiltration of adipose and fibrous tissue into the right ventricle and loss of myocardial cells, resulting in ventricular and supraventricular arrhythmias.

Wikipedia : 73 The Uhl anomaly is a partial or total loss of the myocardial muscle in the right ventricle. A congenital... more...

Related Diseases for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Diseases in the Arrhythmogenic Right Ventricular Dysplasia, Familial, 11 family:

Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 Arrhythmogenic Right Ventricular Dysplasia, Familial, 2
Arrhythmogenic Right Ventricular Dysplasia, Familial, 3 Arrhythmogenic Right Ventricular Dysplasia, Familial, 4
Arrhythmogenic Right Ventricular Dysplasia, Familial, 5 Arrhythmogenic Right Ventricular Dysplasia, Familial, 6
Arrhythmogenic Right Ventricular Dysplasia, Familial, 8 Arrhythmogenic Right Ventricular Dysplasia, Familial, 9
Arrhythmogenic Right Ventricular Dysplasia, Familial, 10 Arrhythmogenic Right Ventricular Dysplasia, Familial, 12
Arrhythmogenic Right Ventricular Dysplasia, Familial, 13 Arrhythmogenic Right Ventricular Dysplasia, Familial, 14

Diseases related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 105)
# Related Disease Score Top Affiliating Genes
1 syncope 30.3 TTN RYR2
2 right bundle branch block 30.2 PKP2 DSG2
3 cardiac conduction defect 29.4 RYR2 MYBPC3 DSP DSG2
4 arrhythmogenic right ventricular cardiomyopathy 28.8 TTN TGFB3 RYR2 PLEC PKP2 DSP
5 atrial standstill 1 27.7 TTN-AS1 TTN RYR2 PKP2 MYBPC3 DSP
6 arrhythmogenic right ventricular dysplasia, familial, 14 11.0
7 myopathy, myofibrillar, 3 10.2 TTN PLEC
8 myopathy, myofibrillar, 1 10.2 TTN PLEC
9 cardiomyopathy, dilated, 1dd 10.2 TTN RYR2
10 tricuspid valve insufficiency 10.2
11 congenital structural myopathy 10.1 TTN RYR2
12 epidermolysis bullosa simplex with mottled pigmentation 10.1 PLEC DSP
13 mitochondrial dna depletion syndrome 12b 10.1 TTN MYBPC3
14 ventricular fibrillation, paroxysmal familial, 1 10.1 RYR2 DSP
15 palmoplantar keratoderma and woolly hair 10.1 DSP DSC2
16 ectodermal dysplasia/skin fragility syndrome 10.1 DSP DSC2
17 cardiomyopathy, familial hypertrophic, 4 10.0 TTN MYBPC3
18 epidermolysis bullosa simplex, dowling-meara type 10.0 PLEC DSP
19 mitral valve insufficiency 10.0 TTN MYBPC3
20 progressive familial heart block, type ia 10.0
21 progressive familial heart block, type ib 10.0
22 cyanosis, transient neonatal 10.0
23 hemopericardium 10.0
24 pericardial effusion 10.0
25 pulmonary valve insufficiency 10.0
26 congestive heart failure 10.0
27 pulmonary embolism 10.0
28 47,xyy 10.0
29 brugada syndrome 1 10.0 RYR2 MYBPC3
30 left ventricular noncompaction 2 10.0 TTN-AS1 TTN
31 darier-white disease 10.0 DSP DSC2
32 diastolic heart failure 10.0 TTN MYBPC3
33 autosomal dominant distal myopathy 10.0 TTN-AS1 TTN
34 multiminicore disease 10.0 TTN-AS1 TTN
35 salih myopathy 10.0 TTN-AS1 TTN
36 third-degree atrioventricular block 10.0 TTN-AS1 TTN
37 pemphigus vulgaris, familial 9.9 DSP DSG2
38 cardiomyopathy, familial hypertrophic, 9 9.9 TTN-AS1 TTN
39 ventricular tachycardia, catecholaminergic polymorphic, 1, with or without atrial dysfunction and/or dilated cardiomyopathy 9.9 RYR2 PKP2 DSP
40 cardiac arrhythmia 9.9 RYR2 PKP2 DSP
41 familial isolated arrhythmogenic right ventricular dysplasia 9.9 PKP2 DSP DSC2
42 myopathy, myofibrillar, 9, with early respiratory failure 9.9 TTN-AS1 TTN
43 ritter's disease 9.9 DSP DSG2 DSC2
44 paraneoplastic pemphigus 9.9 DSP DSG2 DSC2
45 pemphigus 9.9 DSP DSG2 DSC2
46 long qt syndrome 2 9.8 RYR2 PKP2 MYBPC3
47 tibial muscular dystrophy 9.8 TTN-AS1 TTN
48 distal arthrogryposis 9.8 TTN TGFB3 MYBPC3
49 epidermolysis bullosa simplex with muscular dystrophy 9.8 TTN-AS1 TTN PLEC
50 familial atrial fibrillation 9.8 TTN RYR2 PKP2 DSG2

Graphical network of the top 20 diseases related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1:



Diseases related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Symptoms & Phenotypes for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Human phenotypes related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1:

31
# Description HPO Frequency HPO Source Accession
1 sudden cardiac death 31 HP:0001645
2 ventricular arrhythmia 31 HP:0004308
3 right ventricular cardiomyopathy 31 HP:0011663

Symptoms via clinical synopsis from OMIM®:

57 (Updated 20-May-2021)
Cardiovascular Heart:
cardiomyopathy, right ventricular
fibrofatty replacement of right ventricular myocardium
ventricular arrhythmia (pvc, nsvt, and vt)
premature sudden cardiac death

Clinical features from OMIM®:

107970 (Updated 20-May-2021)

MGI Mouse Phenotypes related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1:

46
# Description MGI Source Accession Score Top Affiliating Genes
1 cardiovascular system MP:0005385 9.61 DSC2 DSG2 DSP MYBPC3 PKP2 PLEC
2 muscle MP:0005369 9.17 DSG2 DSP MYBPC3 PKP2 PLEC RYR2

Drugs & Therapeutics for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Search Clinical Trials , NIH Clinical Center for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Cochrane evidence based reviews: uhl anomaly

Genetic Tests for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Genetic tests related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1:

# Genetic test Affiliating Genes
1 Arrhythmogenic Right Ventricular Dysplasia, Familial 1 29 TGFB3

Anatomical Context for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

MalaCards organs/tissues related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1:

40
Heart, Skin

Publications for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Articles related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1:

(show all 38)
# Title Authors PMID Year
1
Regulatory mutations in transforming growth factor-beta3 gene cause arrhythmogenic right ventricular cardiomyopathy type 1. 57 6
15639475 2005
2
Arrhythmogenic right ventricular cardiomyopathy type 1 (ARVD1): confirmation of locus assignment and mutation screening of four candidate genes. 6 57
12529708 2003
3
Insights into desmosome biology from inherited human skin disease and cardiocutaneous syndromes. 57
24738885 2014
4
Genetics of arrhythmogenic right ventricular cardiomyopathy. 57
23468208 2013
5
Wide spectrum of desmosomal mutations in Danish patients with arrhythmogenic right ventricular cardiomyopathy. 57
20864495 2010
6
Genome-wide association identifies a deletion in the 3' untranslated region of striatin in a canine model of arrhythmogenic right ventricular cardiomyopathy. 57
20596727 2010
7
Arrhythmogenic right ventricular cardiomyopathy. 57
19362677 2009
8
Arrhythmogenic right ventricular cardiomyopathy causing sudden cardiac death in boxer dogs: a new animal model of human disease. 57
14993138 2004
9
Fifteen-year-old boy with stress-induced arrhythmia and sudden death. 57
12210335 2002
10
Arrhythmogenic right ventricular dysplasia. 57
10073261 1999
11
In vivo evidence of apoptosis in arrhythmogenic right ventricular cardiomyopathy. 57
9466574 1998
12
Evidence of apoptosis in arrhythmogenic right ventricular dysplasia. 57
8815941 1996
13
Familial right ventricular dysplasia with biventricular involvement and inflammatory infiltration. Heart Muscle Disease Study Group. 57
8774331 1996
14
Familial cardiomyopathy underlies syndrome of right bundle branch block, ST segment elevation and sudden death. 57
8557918 1996
15
A new locus for arrhythmogenic right ventricular dysplasia on the long arm of chromosome 14. 57
8824801 1996
16
Familial right ventricular dysplasia (cardiomyopathy). 57
8736609 1995
17
The gene for arrhythmogenic right ventricular cardiomyopathy maps to chromosome 14q23-q24. 57
7951245 1994
18
Diagnosis of arrhythmogenic right ventricular dysplasia/cardiomyopathy. Task Force of the Working Group Myocardial and Pericardial Disease of the European Society of Cardiology and of the Scientific Council on Cardiomyopathies of the International Society and Federation of Cardiology. 57
8142187 1994
19
Endomyocardial biopsy in right ventricular cardiomyopathy. 57
8225662 1993
20
Clinical profile of concealed form of arrhythmogenic right ventricular cardiomyopathy presenting with apparently idiopathic ventricular arrhythmias. 57
1572740 1992
21
Familial form of arrhythmogenic right ventricular dysplasia. 57
3825875 1987
22
Arrhythmogenic right ventricular dysplasia in a family. 57
4061306 1985
23
Familial right ventricular dilated cardiomyopathy. 57
4015925 1985
24
Uhl's anomaly (parchment right ventricle): clinical, echocardiographic, radionuclear, hemodynamic and angiocardiographic features in 2 patients. 57
6695798 1984
25
Right ventricular dysplasia: a report of 24 adult cases. 57
7053899 1982
26
Case 288: Uhl Anomaly. 61
33750225 2021
27
Uhl Anomaly in Asymptomatic Adult Woman. 61
30700135 2019
28
Uhl's disease: An uncommon presentation of a rare disease. 61
30001957 2018
29
Unguarded tricuspid orifice---a rare cause of fetal right atrial dilatation with characteristic color doppler sign: Case report with review of literature. 61
27753109 2017
30
Prenatal Diagnosis of Uhl Anomaly with Autopsy Correlation. 61
26929879 2016
31
Long-term follow-up of a patient with Uhl anomaly after biologic and mechanical circulatory support. 61
25749142 2015
32
Images in cardiovascular medicine. Fortuitous discovery of partial Uhl anomaly in a male adult. 61
20530016 2010
33
A case of Uhl anomaly treated with one and a half ventricle repair combined with partial right ventriculectomy in infancy. 61
11689812 2001
34
Experience with one and a half ventricle repair. 61
10096960 1999
35
Pregnancy and delivery in a patient with Uhl anomaly. 61
1923232 1991
36
[Myocardial dysplasia of the right ventricle (Uhl's anomaly) as a possible cause of sudden, unexpected death]. 61
2459862 1988
37
Idiopathic right ventricular dilation. Special reference to "arrhythmogenic right ventricular dysplasia" and analogous lesions. 61
2949485 1986
38
Cine-computed tomography of arrhythmogenic right ventricular dysplasia. 61
3944294 1986

Variations for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

ClinVar genetic disease variations for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1:

6 (show all 32)
# Gene Name Type Significance ClinVarId dbSNP ID Position
1 TGFB3 NM_003239.4(TGFB3):c.*495C>T SNV Pathogenic 12475 rs387906514 GRCh37: 14:76425035-76425035
GRCh38: 14:75958692-75958692
2 TGFB3 NM_003239.5(TGFB3):c.411del (p.Ser138fs) Deletion Pathogenic 1031323 GRCh37: 14:76438003-76438003
GRCh38: 14:75971660-75971660
3 TGFB3 NM_003239.4(TGFB3):c.-30G>A SNV Pathogenic 12474 rs770828281 GRCh37: 14:76447266-76447266
GRCh38: 14:75980923-75980923
4 TTN-AS1 , TTN NM_001267550.2(TTN):c.88825C>T (p.Arg29609Ter) SNV Pathogenic 645724 rs766450773 GRCh37: 2:179419249-179419249
GRCh38: 2:178554522-178554522
5 DSC2 NM_024422.6(DSC2):c.1913_1916del (p.Gln638fs) Deletion Likely pathogenic 978277 GRCh37: 18:28651780-28651783
GRCh38: 18:31071814-31071817
6 PKP2 NM_001005242.3(PKP2):c.2358-2A>G SNV Likely pathogenic 978281 GRCh37: 12:32945667-32945667
GRCh38: 12:32792733-32792733
7 PKP2 NM_001005242.3(PKP2):c.1926T>A (p.Tyr642Ter) SNV Likely pathogenic 978331 GRCh37: 12:32974377-32974377
GRCh38: 12:32821443-32821443
8 TGFB3 NM_003239.4(TGFB3):c.325G>A (p.Asp109Asn) SNV Uncertain significance 665993 rs986180095 GRCh37: 14:76446912-76446912
GRCh38: 14:75980569-75980569
9 RYR2 NM_001035.3(RYR2):c.1144G>A (p.Val382Met) SNV Uncertain significance 201209 rs370057029 GRCh37: 1:237604757-237604757
GRCh38: 1:237441457-237441457
10 DSP NM_004415.4(DSP):c.3774C>A (p.Asp1258Glu) SNV Uncertain significance 534294 rs748733750 GRCh37: 6:7580197-7580197
GRCh38: 6:7579964-7579964
11 DSC2 NM_024422.6(DSC2):c.1018A>G (p.Thr340Ala) SNV Uncertain significance 161222 rs368299411 GRCh37: 18:28662951-28662951
GRCh38: 18:31082985-31082985
12 RYR2 NM_001035.3(RYR2):c.4912T>A (p.Ser1638Thr) SNV Uncertain significance 201252 rs794728739 GRCh37: 1:237777340-237777340
GRCh38: 1:237614040-237614040
13 MYBPC3 NM_000256.3(MYBPC3):c.1321G>A (p.Glu441Lys) SNV Uncertain significance 36601 rs193922377 GRCh37: 11:47364602-47364602
GRCh38: 11:47343051-47343051
14 DSP NM_004415.4(DSP):c.5063C>T (p.Ala1688Val) SNV Uncertain significance 188467 rs372288373 GRCh37: 6:7581486-7581486
GRCh38: 6:7581253-7581253
15 TGFB3 NM_003239.4(TGFB3):c.965T>C (p.Ile322Thr) SNV Uncertain significance 410276 rs762643638 GRCh37: 14:76427381-76427381
GRCh38: 14:75961038-75961038
16 TGFB3 NM_003239.4(TGFB3):c.464G>A (p.Arg155Gln) SNV Uncertain significance 575813 rs925224125 GRCh37: 14:76437950-76437950
GRCh38: 14:75971607-75971607
17 TGFB3 NM_003239.4(TGFB3):c.559G>A (p.Gly187Ser) SNV Uncertain significance 191778 rs201063101 GRCh37: 14:76437556-76437556
GRCh38: 14:75971213-75971213
18 RYR2 NM_001035.3(RYR2):c.4196C>A (p.Thr1399Lys) SNV Uncertain significance 226037 rs75901196 GRCh37: 1:237755074-237755074
GRCh38: 1:237591774-237591774
19 PLEC NM_201384.3(PLEC):c.2354C>G (p.Ala785Gly) SNV Uncertain significance 634815 rs781932151 GRCh37: 8:145004655-145004655
GRCh38: 8:143930487-143930487
20 TGFB3 NM_003239.4(TGFB3):c.785G>T (p.Gly262Val) SNV Uncertain significance 637043 rs1595339233 GRCh37: 14:76429800-76429800
GRCh38: 14:75963457-75963457
21 DSG2 NM_001943.5(DSG2):c.269C>T (p.Thr90Ile) SNV Uncertain significance 326474 rs772744115 GRCh37: 18:29100818-29100818
GRCh38: 18:31520855-31520855
22 PKP2 NM_004572.3(PKP2):c.1892A>G (p.Tyr631Cys) SNV Uncertain significance 406548 rs1060501183 GRCh37: 12:32975480-32975480
GRCh38: 12:32822546-32822546
23 TTN NM_001267550.2(TTN):c.34129_34149GTTCTACCTGAAGAAGAGGAA[1] (p.11363_11369VLPEEEE[3]) Microsatellite Uncertain significance 130665 rs587780487 GRCh37: 2:179542469-179542489
GRCh38: 2:178677742-178677762
24 PLEC NM_201384.3(PLEC):c.5390G>A (p.Arg1797His) SNV Uncertain significance 196720 rs782581787 GRCh37: 8:144998707-144998707
GRCh38: 8:143924539-143924539
25 TTN NM_133378.4(TTN):c.37385_37387delAAG Microsatellite Uncertain significance 202444 rs759525338 GRCh37: 2:179486460-179486462
GRCh38: 2:178621733-178621735
26 DSG2 NM_001943.5(DSG2):c.473T>G (p.Val158Gly) SNV Likely benign 44319 rs191143292 GRCh37: 18:29101156-29101156
GRCh38: 18:31521193-31521193
27 PLEC NM_201384.3(PLEC):c.8051G>A (p.Arg2684Gln) SNV Likely benign 196822 rs200239963 GRCh37: 8:144995938-144995938
GRCh38: 8:143921770-143921770
28 PLEC NM_201384.3(PLEC):c.5471C>T (p.Ala1824Val) SNV Likely benign 196764 rs542642242 GRCh37: 8:144998626-144998626
GRCh38: 8:143924458-143924458
29 PLEC NM_201384.3(PLEC):c.11617C>G (p.Leu3873Val) SNV Likely benign 634814 rs782207321 GRCh37: 8:144992372-144992372
GRCh38: 8:143918204-143918204
30 PLEC NM_201384.3(PLEC):c.5476C>T (p.Arg1826Trp) SNV Likely benign 167508 rs200575795 GRCh37: 8:144998621-144998621
GRCh38: 8:143924453-143924453
31 MYBPC3 NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) SNV Likely benign 42506 rs11570076 GRCh37: 11:47365122-47365122
GRCh38: 11:47343571-47343571
32 DSG2 NM_001943.5(DSG2):c.1174G>A (p.Val392Ile) SNV Benign 36009 rs193922639 GRCh37: 18:29111109-29111109
GRCh38: 18:31531146-31531146

Expression for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Search GEO for disease gene expression data for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1.

Pathways for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Pathways related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1
Show member pathways
11.91 PKP2 DSP DSG2 DSC2
2
Show member pathways
11.56 PLEC DSP DSG2
3
Show member pathways
11.53 TTN TGFB3 RYR2 MYBPC3
4
Show member pathways
11.47 PLEC PKP2 DSP
5 11.21 RYR2 PKP2 DSP DSG2 DSC2

GO Terms for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

Cellular components related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 cell junction GO:0030054 9.73 PLEC PKP2 FRMD4A DSP DSG2 DSC2
2 cell-cell junction GO:0005911 9.62 PKP2 DSP DSG2 DSC2
3 intermediate filament GO:0005882 9.58 PLEC PKP2 DSP
4 adherens junction GO:0005912 9.54 PKP2 FRMD4A DSC2
5 intercalated disc GO:0014704 9.46 PKP2 DSP DSG2 DSC2
6 cornified envelope GO:0001533 9.26 PKP2 DSP DSG2 DSC2
7 desmosome GO:0030057 8.92 PKP2 DSP DSG2 DSC2

Biological processes related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 according to GeneCards Suite gene sharing:

(show all 18)
# Name GO ID Score Top Affiliating Genes
1 cell adhesion GO:0007155 9.87 PKP2 MYBPC3 DSG2 DSC2
2 keratinization GO:0031424 9.76 PKP2 DSP DSG2 DSC2
3 wound healing GO:0042060 9.67 TGFB3 PLEC DSP
4 cell-cell adhesion GO:0098609 9.67 PKP2 DSP DSG2 DSC2
5 cornification GO:0070268 9.62 PKP2 DSP DSG2 DSC2
6 positive regulation of protein secretion GO:0050714 9.61 TTN TGFB3 FRMD4A
7 response to progesterone GO:0032570 9.58 TGFB3 DSG2
8 cardiac muscle contraction GO:0060048 9.58 TTN RYR2 MYBPC3
9 muscle filament sliding GO:0030049 9.56 TTN MYBPC3
10 ventricular cardiac muscle tissue morphogenesis GO:0055010 9.55 PKP2 MYBPC3
11 intermediate filament cytoskeleton organization GO:0045104 9.54 PLEC DSP
12 ventricular cardiac muscle cell action potential GO:0086005 9.52 RYR2 PKP2
13 cell communication by electrical coupling involved in cardiac conduction GO:0086064 9.51 RYR2 PKP2
14 cardiac muscle hypertrophy GO:0003300 9.48 TTN RYR2
15 regulation of heart rate by cardiac conduction GO:0086091 9.46 PKP2 DSP DSG2 DSC2
16 desmosome organization GO:0002934 9.43 PKP2 DSP DSG2
17 bundle of His cell-Purkinje myocyte adhesion involved in cell communication GO:0086073 9.26 PKP2 DSP DSG2 DSC2
18 regulation of ventricular cardiac muscle cell action potential GO:0098911 9.02 RYR2 PKP2 DSP DSG2 DSC2

Molecular functions related to Arrhythmogenic Right Ventricular Dysplasia, Familial, 1 according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 calcium ion binding GO:0005509 9.46 TTN RYR2 DSG2 DSC2
2 structural constituent of muscle GO:0008307 9.13 TTN PLEC MYBPC3
3 cell adhesive protein binding involved in bundle of His cell-Purkinje myocyte communication GO:0086083 8.92 PKP2 DSP DSG2 DSC2

Sources for Arrhythmogenic Right Ventricular Dysplasia, Familial, 1

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
20 GARD
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
53 NINDS
54 Novoseek
56 OMIM via Orphanet
57 OMIM® (Updated 20-May-2021)
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 Tocris
70 UMLS
71 UMLS via Orphanet
Content
Loading form....