Beta-Thalassemia disease: Malacards - Research Articles, Drugs, Genes, Clinical Trials

B-THAL MCID: BTT014 MIFTS: 70	Beta-Thalassemia (B-THAL) Categories: Blood diseases, Endocrine diseases, Genetic diseases, Immune diseases, Liver diseases, Nephrological diseases, Rare diseases	Data Licensing For inquiries, contact: [email protected]
Genes Variations Tissues Related diseases Publications Symptoms & Phenotypes Drugs Expand all tables

Sources

Aliases & Classifications for Beta-Thalassemia

MalaCards integrated aliases for Beta-Thalassemia:

Name: Beta-Thalassemia ⁵⁷ ²⁴ ¹⁹ ⁵⁸ ⁷⁵ ⁷³ ⁵³ ⁴³ ³⁶

Beta Thalassemia ¹¹ ⁴² ⁷³ ²⁸ ⁵ ¹⁴ ⁷¹ ⁷⁵

Beta Thalassemia Intermedia ¹⁹ ²⁸ ⁵ ⁷¹

Mediterranean Anemia ²⁴ ¹⁹ ⁴² ⁷³

Cooley's Anemia ²⁴ ¹⁹ ⁷³ ⁷¹

Erythroblastic Anemia ¹⁹ ⁴² ⁷³

Thalassemia, Hispanic Gamma-Delta-Beta ⁵⁷ ¹⁹

Beta-Plus-Thalassemia ⁵ ⁷¹

Thalassemia Minor ⁷³ ⁷¹

Thalassemia Major ⁷³ ⁵³

Beta Thalassaemia Syndrome ³³

Beta Thalassaemia Disease ³³

Beta Thalassemia Major ¹⁹

Beta Thalassemia Minor ¹⁹

Thalassemia, Beta Type ⁴²

Mediterranean Anaemia ³³

Mediterranean Disease ³³

Thalassemias, Beta- ¹⁹

Thalassemia, Beta ⁵⁷

B-Thal ⁷³

Characteristics:

Inheritance:

Autosomal dominant,Autosomal recessive ⁵⁸

Prevelance:

1-9/100000 (Worldwide) 1-9/1000000 (France) 1-5/10000 (Europe) ⁵⁸

Age Of Onset:

Childhood,Infancy ⁵⁸

Classifications:

MalaCards categories:
Global: Genetic diseases Rare diseases
Anatomical: Immune diseases Blood diseases Nephrological diseases Endocrine diseases Liver diseases

See all MalaCards categories (disease lists)

ICD10: ³¹ ³²

Diseases of the blood and blood-forming organs and certain disorders involving the immune mechanism

Haemolytic anaemias

Thalassaemia

Beta thalassaemia

ICD11: ³³

Diseases of the blood or blood-forming organs

Anaemias or other erythrocyte disorders

Thalassaemias

Beta thalassaemia

Orphanet: ⁵⁸

Rare renal diseases

Rare endocrine diseases

Rare haematological diseases

External Ids:

Disease Ontology ¹¹ DOID:12241

OMIM® ⁵⁷ 613985

ICD9CM ³⁴ 282.44

MeSH ⁴³ D017086

NCIt ⁴⁹ C34375

SNOMED-CT ⁶⁸ 65959000

ICD10 ³¹ D56.1

MESH via Orphanet ⁴⁴ D017086

ICD10 via Orphanet ³² D56.1

UMLS via Orphanet ⁷² C0005283

Orphanet ⁵⁸ ORPHA848

MedGen ⁴⁰ C0005283 C0472767 C0599528 more

SNOMED-CT via HPO ⁶⁹ 111293003 128241005 16294009 more

ICD11 ³³ 2063292324

UMLS ⁷¹ C0002875 C0005283 C0085578 more

Sources

Summaries for Beta-Thalassemia

MedlinePlus Genetics: ⁴² Beta thalassemia is a blood disorder that reduces the production of hemoglobin. Hemoglobin is the iron-containing protein in red blood cells that carries oxygen to cells throughout the body.In people with beta thalassemia, low levels of hemoglobin reduce oxygen levels in the body. Affected individuals also have a shortage of red blood cells (anemia), which can cause pale skin, weakness, fatigue, and more serious complications. People with beta thalassemia are at an increased risk of developing abnormal blood clots.Beta thalassemia is classified into two types depending on the severity of symptoms: thalassemia major (also known as transfusion-dependent thalassemia or Cooley's anemia) and thalassemia intermedia (which is a non-transfusion-dependent thalassemia). Of the two types, thalassemia major is more severe.The signs and symptoms of thalassemia major appear within the first 2 years of life. Children develop life-threatening anemia. They do not gain weight and grow at the expected rate (failure to thrive) and may develop yellowing of the skin and whites of the eyes (jaundice). Affected individuals may have an enlarged spleen, liver, and heart, and their bones may be misshapen. Puberty is delayed in some adolescents with thalassemia major. Many people with thalassemia major have such severe symptoms that they need frequent blood transfusions to replenish their red blood cell supply. Over time, an influx of iron-containing hemoglobin from chronic blood transfusions can lead to a buildup of iron in the body, resulting in liver, heart, and hormone problems.Thalassemia intermedia is milder than thalassemia major. The signs and symptoms of thalassemia intermedia appear in early childhood or later in life. Affected individuals have mild to moderate anemia and may also have slow growth, bone abnormalities, and an increased risk of developing abnormal blood clots.

MalaCards based summary: Beta-Thalassemia, also known as beta thalassemia, is related to thrombocytopenia with beta-thalassemia, x-linked and hemoglobin lepore-beta-thalassemia syndrome. An important gene associated with Beta-Thalassemia is HBB (Hemoglobin Subunit Beta), and among its related pathways/superpathways are Response to elevated platelet cytosolic Ca2+ and Golgi-to-ER retrograde transport. The drugs Metformin and Peginterferon alfa-2b have been mentioned in the context of this disorder. Affiliated tissues include liver, spleen and bone, and related phenotypes are splenomegaly and pallor

GARD: ¹⁹ Beta-thalassemia is a blood disorder that reduces the body's production of hemoglobin. Low levels of hemoglobin lead to a shortage of mature red blood cells and a lack of oxygen in the body. People with Beta-thalassemia have anemia, which can cause paleness, weakness, fatigue, and more serious complications. There are two main forms of Beta-thalassemia, classified based on the severity of symptoms: Thalassemia major (also called Cooley's anemia) - the more severe form, causing severe anemia and enlarged liver and spleen (hepatosplenomegaly). Thalassemia intermedia - the less severe form causing milder anemia that does not require regular blood transfusions. People with this form are also at risk for iron overload. Beta-thalassemia is caused by genetic changes in the HBB gene and is typically inherited in an autosomal recessive manner. This means that people with thalassemia major or thalassemia intermedia have a genetic change in both of their copies of the HBB gene. People who have only one HBB genetic change (carriers) typically are said to have thalassemia minor (or trait) and usually do not have symptoms, but may have some symptoms of anemia. Very rarely, the inheritance of Beta-thalassemia may be dominant. In this case, a person has only one mutated HBB gene, but has signs and symptoms of Beta-thalassemia major or Beta-thalassemia intermedia.

OMIM®: ⁵⁷ Beta-thalassemia is characterized by a reduced production of hemoglobin A (HbA, alpha-2/beta-2), which results from the reduced synthesis of beta-globin chains relative to alpha-globin chains, thus causing an imbalance in globin chain production and hence abnormal erythropoiesis. The disorder is clinically heterogeneous (summary by Ottolenghi et al., 1975). Absence of beta globin causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. For clinical purposes, beta-thalassemia is divided into thalassemia major (transfusion dependent), thalassemia intermedia (of intermediate severity), and thalassemia minor (asymptomatic, carrier state). The molecular and clinical aspects of the beta-thalassemias were reviewed by Olivieri (1999). The remarkable phenotypic diversity of the beta-thalassemias reflects the heterogeneity of mutations at the HBB locus, the action of many secondary and tertiary modifiers, and a wide range of environmental factors (Weatherall, 2001). For a review of beta-thalassemia, see Taher et al. (2021). (613985) (Updated 08-Dec-2022)

UniProtKB/Swiss-Prot: ⁷³ A form of thalassemia. Thalassemias are common monogenic diseases occurring mostly in Mediterranean and Southeast Asian populations. The hallmark of beta-thalassemia is an imbalance in globin-chain production in the adult HbA molecule. Absence of beta chain causes beta(0)-thalassemia, while reduced amounts of detectable beta globin causes beta(+)-thalassemia. In the severe forms of beta-thalassemia, the excess alpha globin chains accumulate in the developing erythroid precursors in the marrow. Their deposition leads to a vast increase in erythroid apoptosis that in turn causes ineffective erythropoiesis and severe microcytic hypochromic anemia. Clinically, beta-thalassemia is divided into thalassemia major which is transfusion dependent, thalassemia intermedia (of intermediate severity), and thalassemia minor that is asymptomatic.

Orphanet: ⁵⁸ Beta-thalassemia (BT) is characterized by deficiency (Beta+) or absence (Beta0) of synthesis of the beta globin chains of hemoglobin (Hb).

Disease Ontology: ¹¹ A thalassemia characterized by the reduced or absent synthesis of the beta globin chains of hemoglobin.

Wikipedia: ⁷⁵ Beta thalassemias (β thalassemias) are a group of inherited blood disorders. They are forms of... more...

GeneReviews: NBK1426

Sources

Related Diseases for Beta-Thalassemia

Diseases in the Thalassemia family:

Alpha-Thalassemia	Beta-Thalassemia
Autosomal Dominant Beta Thalassemia	Beta-Thalassemia and Related Diseases
Alpha-Thalassemia and Related Disorders

Diseases related to Beta-Thalassemia via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 802)

#	Related Disease	Score	Top Affiliating Genes
1	thrombocytopenia with beta-thalassemia, x-linked	33.4	HBG2 GATA1
2	hemoglobin lepore-beta-thalassemia syndrome	33.3	HBD HBB
3	beta-thalassemia intermedia	33.2	TFRC TFR2 KLF1 HFE HBS1L HBG2
4	autosomal dominant beta thalassemia	33.2	TFR2 KLF1 HFE HBS1L HBG2 HBG1
5	hereditary persistence of fetal hemoglobin-beta-thalassemia syndrome	33.0	KLF1 HBG2 HBG1 HBB
6	thalassemia minor	32.7	HBG2 HBG1 HBD HBB HBA2 GATA1
7	hemoglobin e-beta-thalassemia syndrome	32.4	LOC107133510 LOC106099062 HBB
8	beta-thalassemia, dominant inclusion body type	32.0	LOC110006319 LOC107133510 LOC106099062 HBB
9	fetal hemoglobin quantitative trait locus 1	32.0	LOC110006319 LOC107133510 LOC106099062 KLF1 HBS1L HBG2
10	iron metabolism disease	32.0	TFRC TFR2 TF HFE HBB G6PD
11	thalassemia	32.0	TFRC TFR2 TF LOC110006319 LOC107133510 KLF1
12	splenomegaly	31.8	HBB HBA2 EPO
13	beta-thalassemia major	31.8	TFRC TFR2 LOC110006319 LOC107133510 LOC106099062 KLF1
14	iron deficiency anemia	31.7	TFRC TFR2 TF HFE HBG2 G6PD
15	iron overload	31.6	TFR2 TF HFE
16	siderosis	31.6	TFRC TF HFE
17	hemosiderosis	31.6	TFRC TFR2 TF HFE EPO
18	hemochromatosis, type 1	31.6	TFRC TFR2 TF HFE HBS1L HBB
19	microcytic anemia	31.5	TFRC TFR2 TF HFE HBB HBA2
20	anemia, sideroblastic, 1	31.5	TFRC TFR2 KLF1 HFE HBB GATA1
21	histiocytosis-lymphadenopathy plus syndrome	31.4	HBB HBA2 G6PD
22	glucosephosphate dehydrogenase deficiency	31.3	HBG2 HBB HBA2 G6PD
23	hypochromic microcytic anemia	31.3	TFRC TF HBB HBA2 EPO
24	hemoglobin h disease	31.3	TFRC HBB HBA2 AHSP
25	hereditary spherocytosis	31.2	TFRC KLF1 HFE HBG1 HBB GATA1
26	polycythemia	31.1	TFRC HBB HBA2 GATA1 EPO
27	splenic sequestration	31.0	HBB EPO
28	acute erythroid leukemia	31.0	TFRC KLF1 GATA1 EPO
29	erythroleukemia	31.0	TFRC KLF1 HBG1 HBB GATA1 EPO
30	congenital dyserythropoietic anemia	31.0	KLF1 HFE GATA1
31	hemoglobin e disease	30.9	TFRC LOC107133510 LOC106099062 KLF1 HBS1L HBG2
32	anemia, congenital dyserythropoietic, type ia	30.9	TFRC KLF1 GATA1 EPO
33	neonatal anemia	30.8	TFRC KLF1 HBB EPO
34	porphyria	30.8	TFRC TFR2 HFE GATA1 EPO
35	nutritional deficiency disease	30.7	TFRC TF EPO
36	plasmodium falciparum malaria	30.7	HBB G6PD CHIT1
37	myelodysplastic syndrome	30.7	TFRC TF HFE GATA1 EPO
38	porphyria cutanea tarda	30.7	TFRC TFR2 TF HFE GATA1 EPO
39	deficiency anemia	30.7	TFRC TFR2 TF LOC107133510 LOC106099062 KLF1
40	hfe hemochromatosis	30.6	TF HFE
41	sideroblastic anemia	30.6	TFRC TFR2 HFE
42	hemolytic anemia	30.5	TFRC TF LOC107133510 LOC106099062 KLF1 HFE
43	sickle cell anemia	30.5	TFRC LOC110006319 LOC107133510 LOC106099062 KLF1 HBS1L
44	congenital hemolytic anemia	30.5	TFRC TF KLF1 HBG2 HBG1 HBD
45	methemoglobinemia	30.5	HBG2 HBB G6PD
46	alpha-thalassemia	30.4	TFRC LOC110006319 LOC107133510 LOC106099062 KLF1 HFE
47	sickle cell disease	30.4	LOC110006319 LOC107133510 LOC106099062 HBS1L HBG2 HBG1
48	hemoglobinopathy	30.4	TFRC TFR2 TF LOC110006319 LOC107133510 LOC106099062
49	hemochromatosis, type 3	30.4	TFRC TFR2 HFE
50	hemochromatosis type 2	30.4	TFRC TFR2 HFE

Graphical network of the top 20 diseases related to Beta-Thalassemia:

Sources

Symptoms & Phenotypes for Beta-Thalassemia

Human phenotypes related to Beta-Thalassemia:

⁵⁸ ³⁰ (show all 24)

#	Description	HPO Frequency	Orphanet Frequency	HPO Source Accession
1	splenomegaly ⁵⁸ ³⁰	Hallmark (90%)	Very frequent (99-80%)	HP:0001744
2	pallor ⁵⁸ ³⁰	Hallmark (90%)	Very frequent (99-80%)	HP:0000980
3	microcytic anemia ⁵⁸ ³⁰	Hallmark (90%)	Very frequent (99-80%)	HP:0001935
4	abnormal hemoglobin ⁵⁸ ³⁰	Hallmark (90%)	Very frequent (99-80%)	HP:0011902
5	muscle weakness ⁵⁸ ³⁰	Frequent (33%)	Frequent (79-30%)	HP:0001324
6	respiratory insufficiency ⁵⁸ ³⁰	Frequent (33%)	Frequent (79-30%)	HP:0002093
7	hepatomegaly ⁵⁸ ³⁰	Frequent (33%)	Frequent (79-30%)	HP:0002240
8	reduced bone mineral density ⁵⁸ ³⁰	Frequent (33%)	Frequent (79-30%)	HP:0004349
9	irritability ⁵⁸ ³⁰	Frequent (33%)	Frequent (79-30%)	HP:0000737
10	abnormal skull morphology ⁵⁸ ³⁰	Frequent (33%)	Frequent (79-30%)	HP:0000929
11	abnormality of temperature regulation ⁵⁸ ³⁰	Frequent (33%)	Frequent (79-30%)	HP:0004370
12	abnormality of iron homeostasis ⁵⁸ ³⁰	Frequent (33%)	Frequent (79-30%)	HP:0011031
13	hypogonadotropic hypogonadism ³⁰	Frequent (33%)		HP:0000044
14	hepatitis ⁵⁸ ³⁰	Occasional (7.5%)	Occasional (29-5%)	HP:0012115
15	cholelithiasis ⁵⁸ ³⁰	Occasional (7.5%)	Occasional (29-5%)	HP:0001081
16	hypertrophic cardiomyopathy ⁵⁸ ³⁰	Occasional (7.5%)	Occasional (29-5%)	HP:0001639
17	thrombocytopenia ⁵⁸ ³⁰	Occasional (7.5%)	Occasional (29-5%)	HP:0001873
18	venous thrombosis ⁵⁸ ³⁰	Occasional (7.5%)	Occasional (29-5%)	HP:0004936
19	skin ulcer ⁵⁸ ³⁰	Occasional (7.5%)	Occasional (29-5%)	HP:0200042
20	anemia ⁵⁸		Very frequent (99-80%)
21	abnormality of the skeletal system ⁵⁸		Very frequent (99-80%)
22	hypogonadotrophic hypogonadism ⁵⁸		Frequent (79-30%)
23	hypochromic microcytic anemia ³⁰			HP:0004840
24	reduced beta/alpha synthesis ratio ³⁰			HP:0011906

Clinical features from OMIM®:

613985 (Updated 08-Dec-2022)

GenomeRNAi Phenotypes related to Beta-Thalassemia according to GeneCards Suite gene sharing:

²⁵

#	Description	GenomeRNAi Source Accession	Score	Top Affiliating Genes
1	Increased shRNA abundance	GR00327-A	8.92	EPO G6PD HBD HBG2

MGI Mouse Phenotypes related to Beta-Thalassemia:

⁴⁵

#	Description	MGI Source Accession	Score	Top Affiliating Genes
1	liver/biliary system	MP:0005370	9.76	EPO GATA1 HBB HBD HFE KLF1
2	immune system	MP:0005387	9.73	AHSP CHIT1 EPO G6PD GATA1 HBB
3	hematopoietic system	MP:0005397	9.44	AHSP EPO G6PD GATA1 HBA2 HBB

Sources

Drugs & Therapeutics for Beta-Thalassemia

Drugs for Beta-Thalassemia (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 193)

Name

Status

Phase

Clinical Trials

Cas Number

PubChem Id

Metformin

Approved

Phase 4

1115-70-4, 657-24-9

4091

Peginterferon alfa-2b

Approved

Phase 4

215647-85-1, 99210-65-8

Peginterferon alfa-2a

Approved, Investigational

Phase 4

198153-51-4

Ribavirin

Approved

Phase 4

36791-04-5

37542

Deferiprone

Approved

Phase 4

30652-11-0

2972

Zinc cation

Approved, Experimental, Investigational

Phase 4

7440-66-6, 23713-49-7

32051

Ledipasvir

Approved

Phase 4

1256388-51-8

67505836

Sofosbuvir

Approved

Phase 4

1190307-88-0

45375808

Hyaluronic acid

Approved, Vet_approved

Phase 4

9004-61-9

53477741

Zinc sulfate

Approved, Investigational

Phase 4

7733-02-0

Busulfan

Approved, Investigational

Phase 4

55-98-1

2478

Fludarabine

Approved

Phase 4

75607-67-9, 21679-14-1

30751 657237

Mycophenolic acid

Approved, Investigational

Phase 4

24280-93-1

446541

Tacrolimus

Approved, Investigational

Phase 4

104987-11-3

6473866 445643

Sodium citrate

Approved, Investigational

Phase 4

68-04-2

23431961

Sildenafil

Approved, Investigational

Phase 4

139755-83-2, 171599-83-0

5212 135398744

Luspatercept

Approved, Investigational

Phase 4

1373715-00-4

Basiliximab

Approved, Investigational

Phase 4

179045-86-4

Levoleucovorin

Approved, Experimental, Investigational

Phase 4

68538-85-2, 58-05-9, 73951-54-9

149436 6006

Methotrexate

Approved

Phase 4

1959-05-2, 59-05-2

4112 126941

Citric acid

Approved, Nutraceutical, Vet_approved

Phase 4

77-92-9

311

Arginine

Approved, Investigational, Nutraceutical

Phase 4

74-79-3

6322

Folic acid

Approved, Nutraceutical, Vet_approved

Phase 4

59-30-3

6037

Anti-Infective Agents

Phase 4

Immunologic Factors

Phase 4

Antiviral Agents

Phase 4

Interferon alpha-2

Phase 4

interferons

Phase 4

Interferon-alpha

Phase 4

Interferon-alfa-1b

Phase 4

Liver Extracts

Phase 4

Ledipasvir, sofosbuvir drug combination

Phase 4

Vaccines

Phase 4

Trace Elements

Phase 4

Micronutrients

Phase 4

Heptavalent Pneumococcal Conjugate Vaccine

Phase 4

Immunoglobulins, Intravenous

Phase 4

Immunoglobulins

Phase 4

Calcineurin Inhibitors

Phase 4

Antimetabolites

Phase 4

Thymoglobulin

Phase 4

Antitubercular Agents

Phase 4

Antibodies

Phase 4

Phosphodiesterase Inhibitors

Phase 4

Phosphodiesterase 5 Inhibitors

Phase 4

Vasodilator Agents

Phase 4

Citrate

Phase 4

Hematinics

Phase 4

Immunoglobulin Fc Fragments

Phase 4

Dermatologic Agents

Phase 4

Interventional clinical trials:

(show top 50) (show all 237)

#	Name	Status	NCT ID	Phase	Drugs
1	The Potential Hepatoprotective Effect of Metformin in Patients With Beta Thalasemia Major	Unknown status	NCT02984475	Phase 4	Metformin
2	Efficacy of Basiliximab in the Prevention of Acute Graft-versus-host Disease in Unrelated Allogeneic Hematopoietic Stem Cell Transplantation Therapy for Thalassemia Major Treatment: a Multi-center, Open, Randomized, Controlled Clinical Study	Unknown status	NCT02342145	Phase 4	Basiliximab,;cyclosporine A;Methotrexate;Mycophenolate mofetil
3	A Randomized, Placebo Controlled, Double Blind Trial of the Effect of Combined Therapy With Deferoxamine and Deferiprone on Myocardial Iron in Thalassemia Major Using Cardiovascular Magnetic Resonance	Unknown status	NCT00103753	Phase 4	deferiprone
4	Study of the B Memory Cell Response to Vaccination With the 13-valent Pneumococcal Conjugate Vaccine in Asplenic Individuals With Beta-thalassemia Major	Unknown status	NCT01846923	Phase 4
5	Haploidentical Hematopoietic Stem Cell Transplantation for Patients With Thalassemia Major	Unknown status	NCT03171831	Phase 4	Busulfan;Cyclophosphamide;Fludarabine;Mycophenolate mofetil;Tacrolimus;Methotrexate;Thymoglobulin;Basiliximab
6	The Effect of Vitamin D Supplementation on Calcium Excretion in Thalassemia: a Dose Response Study	Unknown status	NCT01323608	Phase 4	Vitamin D3;Placebo
7	Investigation of Signal Pathway Induced by Colla Corri Asini Regulating Globin Level in Beta Thalassemia Patients With Pregnancy Anemia	Unknown status	NCT03392298	Phase 4	Colla corii asini
8	Phase IV Study of Effectiveness of Interferon and Ribavirin Treatment in Thalassemia Major Patients With Chronic Viral Hepatitis C	Unknown status	NCT00887081	Phase 4	PEG-IFN alpha2a or PEG-IFN alpha2b and Ribavirin
9	Phase IV Study of the Use of Sequential DFP-DFO Versus DFP in Thalassemia Major Patients	Completed	NCT00733811	Phase 4	Deferiprone (DFP) and Deferoxamine (DFO);Deferiprone (DFP)
10	Evaluating the Efficacy of Deferasirox in Transfusion Dependent Chronic Anaemias (Myelodysplastic Syndrome, Beta-thalassaemia Patients) With Chronic Iron Overload	Completed	NCT00564941	Phase 4	deferasirox
11	1-year Extension to CICL670A2402 an Open-label, Multi-center Trial of the Efficacy and Safety of Long-term Treatment With Deferasirox (10 to 20 mg/kg/Day) in Beta-thalassemia Patients With Transfusional Hemosiderosis (Study Amended to 2- Year Duration)	Completed	NCT00171301	Phase 4	Deferasirox
12	A Phase II, Multi-center, Single-arm, Prospective Study to Evaluate the Safety and Efficacy of Deferasirox in Beta-thalassemia Major Patients After Hematopoietic Stem Cell Transplantation.	Completed	NCT01610297	Phase 4	ICL670
13	Safety and Efficacy of Early-start Deferiprone Treatment in Infants and Young Children Newly Diagnosed With Transfusion-dependent Beta Thalassemia	Completed	NCT03591575	Phase 4	Deferiprone oral solution;Placebo
14	Evaluation of Liver Fibrosis by Serum Hyalornic Acid Measurement in β-Thalassemic Children Infected With Hepatitis C Virus Before and After Direct-Acting Antiviral Therapy	Completed	NCT03961828	Phase 4	Ledipasvir 90 MG / Sofosbuvir 400 MG [Harvoni]
15	Pilot Pharmacokinetic Study In Patients With Inadequate Response To Deferasirox (Exjade)	Completed	NCT00749515	Phase 4	Deferoxamine;Deferasirox
16	Increased Survival and Reversion of Iron-Induced Cardiac Disease in Patients With Thalassemia Major Receiving Intensive Combined Chelation Therapy	Completed	NCT00800761	Phase 4	Deferoxamine and Deferiprone;Deferoxamine
17	Pneumococcal Vaccination for Splenectomised Thalassemia Major Patients in Indonesia	Completed	NCT03095326	Phase 4	Sucrose
18	Randomized Trial Comparing the Relative Efficacy of Deferiprone to That of Deferoxamine in Removing Excess Cardiac Iron in Thalassemia Major Patients	Completed	NCT00105495	Phase 4	Ferriprox (deferiprone);Desferal (deferoxamine)
19	Zinc Supplementation on Cellular Immunity in Thalassemia Major	Completed	NCT03117192	Phase 4	Zinc Sulfate;Sucrose Syrup
20	Prospective Crossover Study on Beta(ß)-Thalassaemia Transfusion-dependent to Evaluate the Impact on Transfusion Regimen of Two Pre-storage Leukoreduced PRBCs(In-line Filtration + B-C Separation; Whole Blood Filtration + B-C Conservation)	Completed	NCT03992001	Phase 4
21	Comparative Clinical Study Evaluating the Effect of L-arginine Versus Sildenafil in Children With Beta Thalassemia Associated With Pulmonary Hypertension	Recruiting	NCT03402191	Phase 4	L-arginine;Sildenafil
22	Hematopoietic Stem Cell Transplantation for Patients With Thalassemia Major: A Multicenter, Prospective Clinical Study	Recruiting	NCT04009525	Phase 4	Busulfan;Cyclophosphamide;Fludarabine;Thymoglobulin;cyclosporine A;Mycophenolate mofetil;Tacrolimus;Methotrexate;Basiliximab;Ruxolitinib
23	The Safety and Efficiency of Luspatercept in Chinese Adults With Transfusion Dependent β-thalassemia: a Real-world Study	Recruiting	NCT05462548	Phase 4	Luspatercept Injectable Product
24	An Open Label Study to Evaluate the Pharmacokinetics, Safety, Tolerability and Efficacy of Deferasirox Administered to Chinese Patients With β-thalassemia Major Aged From 2 to Less Than 6 Years Old	Withdrawn	NCT01724138	Phase 4	Deferasirox
25	Efficacy and Safety Study of Sugammadex in Children 0-2 Years Old	Unknown status	NCT03728543	Phase 2, Phase 3	Sugammadex
26	Pharmacokinetics of Sofosbuvir and Ledipasvir in Hepatitis C Virus - Infected Adolescent Patients With Haematological Disorders	Unknown status	NCT04353986	Phase 3	Sofosbuvir and Ledipasvir
27	Zoledronic Acid for the Prevention of Bone Loss Post-bone Marrow Transplantation for Thalassemia Major Patients: A Prospective Pilot Study	Unknown status	NCT01016093	Phase 2, Phase 3	Zoledronic acid;Placebo
28	Combined Therapy of Silymarin and Desferrioxamine in Patients With B-thalassemia Major: a Randomized Double-blind Clinical Trial	Unknown status	NCT00999349	Phase 2, Phase 3	Silymarin (LEGALON);Placebo
29	A Prospective Randomized Comparative Study of Efficacy and Safety of Combined Deferiprone (DFP) and Deferasirox Versus DFP and Desferrioxamine (DFO) Therapy in Diseases With Severe Iron Overload	Unknown status	NCT01511848	Phase 2, Phase 3	DFP (ferriprox) and deferasirox (ICL 670);DFP, DFO
30	A Decisional Algorithm to Start Iron Chelation in Minimally Transfused Young Beta-thalassemia Major Patients Naive to Iron Chelation Therapy. A Comparative Randomized Prospective Study	Unknown status	NCT02173951	Phase 2, Phase 3	Deferiprone
31	Study of Safty and Efficacy of Adjuvant Vitamin c in Augmenting Iron Chelation	Unknown status	NCT02083575	Phase 2, Phase 3	Vitamin C, Defriprone, deferisarox;deferiprone , deferesarox
32	Phase 2 Study of Therapeutic Effect and Safety of Combined Hydroxyurea With Recombinant Human Erythropoietin.	Unknown status	NCT01624038	Phase 2, Phase 3	Hydroxyurea ,Epiao;hydroxyurea, blood transfusion
33	Effect of Zinc Supplementation on Glucose Homeostasis in Patients With β-Thalassemia Major Complicated With Diabetes Mellitus	Completed	NCT03851055	Phase 3	Zinc
34	A Phase 3, Double-Blind, Placebo Controlled Multicenter Study to Determine the Efficacy and Safety of Luspatercept (ACE-536) in Adults With Transfusion Dependent Beta (B)-Thalassemia	Completed	NCT02604433	Phase 3	Luspatercept
35	A Study of Efficacy and Safety of Long-term Treatment With Deferasirox in Patients With Beta-thalassemia and Transfusional Hemosiderosis	Completed	NCT00171171	Phase 3	deferasirox
36	A Randomized, Comparative, Open Label Phase III Trial on Efficacy & Safety of Long-term Treatment With ICL670 Compared to Deferoxamine in Beta-thalassemia Patients With Transfusional Hemosiderosis	Completed	NCT00061750	Phase 3	ICL670;deferoxamine
37	A Phase 3 Single Arm Study Evaluating the Efficacy and Safety of Gene Therapy in Subjects With Transfusion-dependent β-Thalassemia, Who do Not Have a β0/β0 Genotype, by Transplantation of Autologous CD34+ Stem Cells Transduced Ex Vivo With a Lentiviral βA-T87Q-Globin Vector in Subjects ≤50 Years of Age	Completed	NCT02906202	Phase 3
38	Impact of Combination Therapy Between Hydroxy Urea, Omega 3, Nigella Sativa and Honey on Antioxidant-oxidant Status and Reduction of Iron Overload in Pediatric Major Thalassemia	Completed	NCT04292314	Phase 2, Phase 3	Omega 3;Nigella Sativa Oil;Hydroxyurea;Honey;Deferoxamine
39	An Extension Study of Iron Chelation Therapy With Deferasirox (ICL670)in β-thalassemia Patients With Transfusional Iron Overload	Completed	NCT00171210	Phase 3	Deferasirox
40	Amlodipine Use in the Prevention and Treatment of Iron Overload in Patients With Thalassemia Major	Completed	NCT01125254	Phase 2, Phase 3	Amlodipine
41	Efficacy and Safety of Combination of Hydroxyurea and Low-dose Thalidomide on Hemoglobin Synthesis in Thalassemia Patients	Completed	NCT05132270	Phase 2, Phase 3	hydroxyurea and thalidomide
42	Amlodipine in the Prevention and Treatment of Iron Overload in Patients With Thalassemia Major: a Randomized, Controlled Trial	Completed	NCT01395199	Phase 3	Amlodipine
43	A Randomized Controlled Study to Evaluate Efficacy and Safety of S 303 Treated Red Blood Cells (RBC) in Subjects With Thalassemia Major Requiring Chronic RBC Transfusion	Completed	NCT01740531	Phase 3
44	Clinical Study to Evaluate the Possible Efficacy and Safety of L- Carnitine and Sildenafil in Children Having Beta Thalassemia With Increased Tricuspid Regurgitant Jet Velocity	Recruiting	NCT05584956	Phase 3	L_carnitine;Sildenafil
45	A Phase 3, Double-Blind, Randomized, Placebo-Controlled, Multicenter Study Evaluating the Efficacy and Safety of Mitapivat in Subjects With Transfusion-Dependent Alpha- or Beta-Thalassemia (ENERGIZE-T)	Recruiting	NCT04770779	Phase 3	Placebo Matching Mitapivat;Mitapivat
46	A Phase 3, Double-Blind, Randomized, Placebo-Controlled, Multicenter Study Evaluating the Efficacy and Safety of Mitapivat in Subjects With Non-Transfusion-Dependent Alpha- or Beta-Thalassemia (ENERGIZE)	Recruiting	NCT04770753	Phase 3	Placebo Matching Mitapivat;Mitapivat
47	A Phase 3b, Open-label, Single-arm, Rollover Study to Evaluate Long-term Safety in Subjects Who Have Participated in Other Luspatercept (ACE-536) Clinical Trials	Recruiting	NCT04064060	Phase 3	Luspatercept
48	A Phase 3 Study to Evaluate the Safety and Efficacy of a Single Dose of CTX001 in Pediatric Subjects With Transfusion-Dependent β-Thalassemia	Recruiting	NCT05356195	Phase 3
49	A Phase 3b Study to Evaluate Efficacy and Safety of a Single Dose of Autologous CRISPR Cas9 Modified CD34+ Human Hematopoietic Stem and Progenitor Cells (CTX001) in Subjects With Transfusion-Dependent β-Thalassemia or Severe Sickle Cell Disease	Recruiting	NCT05477563	Phase 3
50	A Phase 3 Single Arm Study Evaluating the Efficacy and Safety of Gene Therapy in Subjects With Transfusion-dependent β-Thalassemia by Transplantation of Autologous CD34+ Stem Cells Transduced Ex Vivo With a Lentiviral βA-T87Q-Globin Vector in Subjects ≤50 Years of Age	Active, not recruiting	NCT03207009	Phase 3

Search NIH Clinical Center for Beta-Thalassemia

Inferred drug relations via UMLS ⁷¹ / NDF-RT ⁵⁰ :

Sodium phenylbutyrate

Cochrane evidence based reviews: beta-thalassemia

Sources

Genetic Tests for Beta-Thalassemia

Genetic tests related to Beta-Thalassemia:

#	Genetic test	Affiliating Genes
1	Beta Thalassemia ²⁸	HBB HBB-LCR
2	Beta Thalassemia Intermedia ²⁸

Sources

Anatomical Context for Beta-Thalassemia

Organs/tissues related to Beta-Thalassemia:

MalaCards : Liver, Spleen, Bone, Heart, Skin, Bone Marrow, Whole Blood

Sources

Publications for Beta-Thalassemia

Articles related to Beta-Thalassemia:

(show top 50) (show all 9647)

#	Title	Authors	PMID	Year
1	Interaction of malaria with a common form of severe thalassemia in an Asian population. ⁶² ⁵⁷ ⁵	O'Donnell A...Weatherall DJ	19841268	2009
2	A new TATA box mutation detected at prenatal diagnosis for beta-thalassemia. ⁶² ⁵⁷ ⁵	Cai SP...Kan YW	2741940	1989
3	A genetic score for the prediction of beta-thalassemia severity. ⁶² ²⁴ ⁵	Danjou F...Galanello R	25480500	2015
4	Global epidemiology of haemoglobin disorders and derived service indicators. ⁵⁷ ⁵	Modell B...Darlison M	18568278	2008
5	Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia. ⁶² ²⁴ ⁵⁷	Uda M...Cao A	18245381	2008
6	CRISPR-Cas9 Gene Editing for Sickle Cell Disease and β-Thalassemia. ²⁴ ⁵⁷	Frangoul H...Corbacioglu S	33283989	2021
7	A Phase 3 Trial of Luspatercept in Patients with Transfusion-Dependent β-Thalassemia. ²⁴ ⁵⁷	Cappellini MD...BELIEVE Investigators	32212518	2020
8	Gene Therapy in Patients with Transfusion-Dependent β-Thalassemia. ²⁴ ⁵⁷	Thompson AA...Cavazzana M	29669226	2018
9	Beta-thalassemia. ⁵³ ⁶² ⁵⁷	Cao A...Galanello R	20098328	2010
10	The molecular basis of beta-thalassemia intermedia in southern China: genotypic heterogeneity and phenotypic diversity. ⁵³ ⁶² ⁵	Chen W...Xu X	20181291	2010
11	Hemoglobinopathies in North Africa: a review. ⁵³ ⁶² ⁵	Haj Khelil A...Perrin P	20113284	2010
12	Comparison of the mismatch-specific endonuclease method and denaturing high-performance liquid chromatography for the identification of HBB gene mutations. ⁵³ ⁶² ⁵	Hung CC...Lin WL	18694524	2008
13	The molecular heterogeneity of beta-thalassemia in Greece. ⁵³ ⁶² ⁵	Boussiou M...Loutradi-Anagnostou A	18096416	2008
14	A family with multiple mutations and sequence variations in the alpha- and beta-globin gene clusters. ⁵³ ⁶² ⁵	de Vooght KM...van Solinge WW	18076350	2008
15	A novel silent beta-thalassemia mutation in the distal CACCC box affects the binding and responsiveness to EKLF. ⁵³ ⁶² ⁵	Moi P...Rosatelli MC	15352994	2004
16	Rapid detection of beta-globin gene (HBB) mutations coupling heteroduplex and primer-extension analysis by DHPLC. ⁵³ ⁶² ⁵	Su YN...Hsieh FJ	12955718	2003
17	The beta+-IVS-I-6 (T-->C) mutation accounts for half of the thalassemia chromosomes in the Palestinian populations of the mountain regions. ⁵³ ⁶² ⁵	El-Latif MA...Kanaan M	11939510	2002
18	Haplotype analysis of the Mexican frameshift Cd 11 (-T) and -28 A->C beta-thalassemia alleles. ⁵³ ⁶² ⁵	Perea FJ...Old JM	8619407	1996
19	Molecular characterization of beta-thalassemia intermedia in patients of Italian descent and identification of three novel beta-thalassemia mutations. ⁵³ ⁶² ⁵	Murru S...Pirastu M	2001456	1991
20	The Spectrum of Beta-Thalassemia Mutations in Syrian Refugees and Turkish Citizens. ⁶² ⁵	Gunes AK...Gozden HE	34258108	2021
21	Molecular characteristics of thalassemia and hemoglobin variants in prenatal diagnosis program in northern Thailand. ⁶² ⁵	Mankhemthong K...Sanguansermsri T	31240559	2019
22	Borderline hemoglobin A2 levels in northern Thai population: HBB genotypes and effects of coinherited alpha-thalassemia. ⁶² ⁵	Chaweephisal P...Charoenkwan P	30309760	2019
23	Prevalence of hemoglobin variants and hemoglobinopathies using cation-exchange high-performance liquid chromatography in central reference laboratory of India: A report of 65779 cases. ⁶² ⁵	Warghade S...Shah N	29403210	2018
24	Genotype-phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis. ⁶² ⁵	Traivaree C...Boonyawat B	29695942	2018
25	Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. ⁶² ⁵	Rizo-de-la-Torre LC...Perea-Diaz FJ	28603845	2017
26	Clinical and biological specificity of beta-thalassemia intermedia: a case report. ⁶² ⁵	Girard JM...Denis MC	27848919	2016
27	Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East. ⁶² ⁵	Mahdieh N...Rabbani B	27453201	2016
28	The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population. ⁶² ⁵	Yasmeen H...Foroni L	27263053	2016
29	Novel Βeta (β)-Thalassemia Mutation in Turkish Children. ⁶² ⁵	Ulasli M...Arslan A	25825561	2015
30	Very mild forms of Hb S/beta(+)-thalassemia in Brazilian children. ⁶² ⁵	Belisario AR...Viana MB	26041423	2015
31	Tetra-Primer ARMS PCR Optimization for Detection of IVS-II-I (G-A) and FSC 8/9 InsG Mutations in β-Thalassemia Major Patients in Isfahan Population. ⁶² ⁵	Hajihoseini S...Alerasool N	25905082	2015
32	Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology. ⁶² ⁵	Hassan SM...Harteveld CL	24880717	2014
33	Hemoglobin Constant Spring is markedly high in women of an ethnic minority group in Vietnam: a community-based survey and hematologic features. ⁶² ⁵	Nguyen VH...Schelp FP	24368026	2014
34	Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah. ⁶² ⁵	Teh LK...Ismail P	24369358	2014
35	Clinical and molecular characterization of Hb Hofu in eastern India. ⁶² ⁵	Purohit P...Patel DK	23889802	2014
36	Molecular epidemiological characterization and health burden of thalassemia in Jiangxi Province, P. R. China. ⁶² ⁵	Lin M...Yang LY	25000193	2014
37	Frequency of beta-thalassemia or beta-hemoglobinopathy carriers simultaneously affected with alpha-thalassemia in Iran. ⁶² ⁵	Alizadeh S...Saki N	25016698	2014
38	Coexistence of two β-globin gene deletions in a Chinese girl with β-thalassemia minor. ⁶² ⁵	Huang G...Ye LZ	24200214	2014
39	Spectrum of Beta Globin Gene Mutations in Egyptian Children with β-Thalassemia. ⁶² ⁵	El-Shanshory M...Sharaf E	25408857	2014
40	Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study. ⁶² ⁵	Boonyawat B...Traivaree C	25525381	2014
41	β-Thalassemia major resulting from compound heterozygosity for HBB: c.92+2T>C [formerly known as IVS-I-2 (T>C)] and a novel β(0)-thalassemia frameshift mutation: HBB: c.209delG; p.Gly70Valfs*20. ⁶² ⁵	Kluge ML...Oliveira JL	24986053	2014
42	Genotyping of beta thalassemia trait by high-resolution DNA melting analysis. ⁶² ⁵	Saetung R...Sanguansermsri T	24450243	2013
43	Clinical characteristics of pediatric thalassemia in Korea: a single institute experience. ⁶² ⁵	Hong CR...Ahn HS	24265529	2013
44	Association between clinical expression and molecular heterogeneity in β-thalassemia Tunisian patients. ⁶² ⁵	Jouini L...Messaoud T	24065537	2013
45	Hereditary hemolytic anemia in Korea from 2007 to 2011: A study by the Korean Hereditary Hemolytic Anemia Working Party of the Korean Society of Hematology. ⁶² ⁵	Park ES...Hah JO	24086942	2013
46	Mosaic segmental uniparental isodisomy and progressive clonal selection: a common mechanism of late onset β-thalassemia major. ⁶² ⁵	Harteveld CL...Giordano PC	22983591	2013
47	The spectrum of β-thalassemia mutations in Gaza Strip, Palestine. ⁶² ⁵	Sirdah MM...Timmann C	23321370	2013
48	β Thalassemia major due to acquired uniparental disomy in a previously healthy adolescent. ⁶² ⁵	Bento C...Ribeiro ML	22875618	2013
49	Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China. ⁶² ⁵	Lin M...Yang LY	23383304	2013
50	Molecular study and genotype/phenotype correlation of β Thalassemia in Malaysia. ⁶² ⁵	Sivalingam M...Jamal R	22335963	2012

Sources

Genes for Beta-Thalassemia

Genes/enhancers related to Beta-Thalassemia (5 elite genes):

(show top 50) (show all 86)

- Elite gene

- Cancer Census gene in COSMIC

#	Symbol	Description	Category	Score	Evidence	PubMed IDs
1	HBB	Hemoglobin Subunit Beta	Protein Coding	1375.78	Molecular basis known ⁵⁷ Pathogenic ⁵ Causative variation ⁷³ Genetic Tests ²⁸ Likely pathogenic ⁵ DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Disorders Publications (show sections)	88735 721609 893136 (more) 1112610 1177278 1301199 1301930 1301952 1374896 1390250 1398296 1420507 1428943 1463768 1483699 1487424 1511973 1515453 1517107 1517108 1517109 1517111 1545796 1577489 1581247 1586746 1634236 1634368 1686262 1698102 1705411 1716997 1719807 1728311 1729892 1734721 1740317 1769663 1772786 1777603 1814858 1856830 1873227 1897518 1911391 1917531 1951306 1954392 1960615 1967205 1971109 1974422 1985702 1986379 2001456 2004023 2005117 2014803 2070092 2071159 2120891 2123063 2197725 2200760 2200762 2207008 2214342 2272839 2272840 2283297 2283303 2291577 2298457 2298920 2306523 2310691 2346726 2375912 2393018 2393712 2399911 2424301 2439149 2446680 2456798 2458145 2467892 2525253 2539344 2542242 2563949 2577233 2606727 2634667 2634674 2665856 2703241 2713503 2730955 2736244 2741940 2753736 2775294 2804366 2822177 2875755 2888754 2897787 2898955 2901867 2915972 2917118 2920213 2920214 2987224 2987809 3002527 3014870 3021139 3021607 3031297 3048433 3114175 3382401 3387213 3403716 3408672 3417300 3422218 3446652 3457470 3462712 3557998 3671081 3683554 3689700 3828533 3955238 4018033 4078867 4351905 4413625 5481775 5658717 5672850 5863839 5925329 6089938 6101206 6162860 6166632 6188062 6189507 6190800 6198908 6264391 6264477 6270663 6275383 6280057 6280138 6292840 6298782 6308558 6310991 6316272 6318797 6457059 6469698 6572978 6583683 6583702 6585381 6585831 6664996 6668188 6714226 6733281 6826539 6895866 6896219 6985481 7076659 7104238 7151176 7173395 7177196 7312624 7395858 7507641 7522523 7530406 7558874 7558878 7558879 7599641 7632967 7655036 7663000 7669681 7683931 7713749 7759073 7794779 7795641 7852087 7864023 7899267 7909640 8019567 8081396 8094943 8144356 8144358 8161774 8172199 8199027 8225319 8226099 8330981 8435318 8438884 8477263 8485062 8562944 8602996 8619407 8638609 8682512 8703815 8718703 8807345 8839873 8856098 8889595 8978308 8980256 9028819 9048934 9101282 9101288 9113933 9140720 9160698 9163586 9225979 9255617 9340427 9342003 9353871 9401495 9415843 9415845 9450794 9494052 9494053 9560205 9629504 9653159 9792288 9875660 9949622 10233364 10367791 10520021 10569722 10569730 10606872 10706767 10756381 10776695 10815781 10870887 10997336 11186262 11300343 11300352 11425418 11532628 11559932 11570721 11791869 11791873 11857738 11857746 11939510 12139763 12144057 12149194 12172041 12210807 12324499 12368169 12403488 12430907 12488606 12508270 12709369 12752111 12764548 12779270 12850492 12885342 12908806 12955718 13716727 13716853 14576320 14649318 14715623 14734204 15009072 15108284 15114532 15153712 15181845 15257926 15278762 15315794 15352994 15470211 15481886 15481893 15481896 15641237 15654898 15658193 15768552 15929117 15933066 16044458 16103715 16114182 16114184 16114188 16126871 16225661 16266911 16291734 16311287 16466947 16470532 16821247 16987798 17007829 17008283 17145605 17278112 17331080 17365003 17365006 17486493 17486497 17486505 17598223 17606453 17654075 17768122 17900295 17949282 17994378 18056002 18096416 18266208 18294253 18473248 18495504 18568278 18591626 18603555 18654889 18932071 18976160 19000664 19061217 19103851 19125249 19205970 19205975 19254853 19269866 19372376 19429541 19437135 19460936 19488752 19631632 19657836 19727720 19841268 19843386 19960060 20035706 20113284 20113296 20132300 20181291 20230396 20301599 20324533 20395516 20406103 20412082 20437613 20524821 20532507 20642337 20704537 20737602 20854126 20975770 21119755 21228398 21232998 21250876 21250885 21333566 21389146 21417574 21423179 21509314 21797702 21797703 21801233 21931510 22028795 22074124 22110956 22122796 22180324 22188014 22233277 22271886 22335963 22356097 22409273 22563936 22675570 22690826 22734587 22851993 22875618 22898041 22975760 22981786 22983591 23106651 23297836 23321370 23348723 23398055 23525874 23586372 23590658 23637309 23812938 23878091 24052702 24052746 24065537 24080465 24086942 24200214 24265529 24368026 24369358 24450243 24616209 24719849 24828949 24857915 24880717 24986053 25000193 25016698 25087612 25089872 25135424 25155404 25268796 25332589 25408857 25469539 25480500 25525159 25525381 25572182 25572186 25617386 25657036 25677748 25682598 25825561 25849334 25856402 25905082 25910213 25976460 26041423 26076395 26076396 26079343 26096710 26096776 26097845 26290351 26291967 26524961 26635043 26850598 26877226 26948378 26956563 27117567 27263053 27453201 27492766 27756326 27785405 27821015 27848919 28125089 28366028 28391758 28460555 28475449 28503568 28603845 28635337 28670940 28670947 28671035 28768465 29188602 29313434 29484903 29695942 29893155 30173596 30309760 30422720 31108495 31240559 31395865 31589614 31714438 31934147 32001505 32581362 33851260 34258108 750554 1517110 1520612 1850955 2375910 2837728 2917193 3006832 3780671 3923770 3957694 4808644 6086605 7615400 7819068 8112743 8257991 8318995 8537236 8874232 9371531 11186264 11480785 14555318 15481885 16114187 16732578 17565724 18076350 18339318 18473247 18694524 18818920 20113289 21599435 21704277 22738610 23383304 23510507 23651435 23665927 23859443 23889802 26410419 27635400 28643346 29403210 16304358 15292064 16339671 9668531 17042767 18413893 19205976 20098328 19608680 17716993 7499303 17556711 17041717 10645766 2009949 1547347 7865126 9668554 10190321 10699179 10721715 10870880 17132817 8205005 7877634 7539923 14642006 16032456 20020819 19585085 18932079 18381244 15761692 15630628 14655879 7677966 18757759 16924651 17097070 12192002 11877258 9852674 9056561 17465943 12819500 10926923 10349508 9209003 8634422 1705405 1975554 8917506 17622240 16129689 14627823 12393543 11204841 10773945 1737089 18796252 16674923 14637270 12417921 7703040 20508726 11065350 10840054 9640605 9272169 19657842 20008255 8431522 7847328 9092642 10334122 10722110 12908799 15946310 16139831
1	HBB::GH11J005224	TSS distance: +3.0kb Elite enhancer with elite association with HBB			Curated enhancer-disease association ²³ ( 27569544)	1428943 1634236 1729892 1986379 2018842 2458145 2741940 3002527 3382401 6280057 7076659 16732578 17516066 21801233 26554738
2	HBB-LCR	Beta-Globin Locus Control Region	Functional Element	1018.83	Molecular basis known ⁵⁷ Pathogenic ⁵ Genetic Tests ²⁸ GeneCards inferred via : Publications Summaries (show sections)	25682598
3	LOC106099062	HBB Recombination Region	Functional Element	425	Pathogenic ⁵ Likely pathogenic ⁵	88735 1301930 1301952 (more) 1390250 1428943 1463768 1483699 1487424 1515453 1517107 1517108 1517109 1517111 1545796 1577489 1581247 1586746 1634236 1634368 1686262 1698102 1716997 1729892 1734721 1740317 1769663 1772786 1814858 1873227 1911391 1917531 1951306 1960615 1967205 1974422 1985702 1986379 1995096 2001456 2004023 2014803 2120891 2123063 2197725 2200760 2200762 2214342 2272840 2283297 2283303 2291577 2298920 2306523 2310691 2346726 2375912 2393018 2393712 2439149 2440502 2446680 2458145 2467892 2525253 2539344 2542242 2606727 2634667 2634674 2665856 2703241 2713503 2730955 2736244 2741940 2753736 2775294 2804366 2875755 2888754 2898955 2901867 2915972 2917118 2920213 2921044 2987224 3002527 3021139 3021607 3031297 3048433 3114175 3382401 3403716 3408672 3422218 3457470 3462712 3671081 3683554 3828533 3955238 4351905 4413625 5658717 5863839 6101206 6162860 6166632 6188062 6189507 6190800 6198908 6264391 6264477 6270663 6275383 6280057 6292840 6308558 6310991 6316272 6457059 6469698 6572978 6583683 6583702 6585831 6664996 6668188 6714226 6733281 6826539 6895866 6896219 6985481 7076659 7104238 7151176 7173395 7177196 7312624 7395858 7507641 7522523 7558874 7558878 7558879 7599641 7632967 7655036 7663000 7669681 7683931 7713749 7759073 7794779 7795641 7852087 7864023 7899267 7909640 8019567 8081396 8094943 8144358 8172199 8199027 8225319 8226099 8330981 8435318 8438884 8562944 8602996 8619407 8629112 8638609 8682512 8718703 8807345 8839873 8856098 8889595 8980256 9048934 9101282 9101288 9113933 9140720 9160698 9163586 9225979 9255617 9340427 9401495 9415843 9415845 9450794 9494052 9494053 9629504 9653159 9949622 10233364 10569722 10606872 10706767 10756381 10776695 10815781 10997336 11186262 11425418 11559932 11570721 11791869 11791873 11857738 11857746 11939510 12144057 12149194 12172041 12210807 12324499 12368169 12403488 12488606 12508270 12709369 12752111 12779270 12850492 12885342 12908806 12955718 13716727 13716853 14576320 14715623 14734204 15009072 15108284 15114532 15153712 15181845 15257926 15278762 15315794 15352994 15470211 15481886 15481893 15481896 15641237 15654898 15929117 16044458 16103715 16114182 16114184 16126871 16225661 16291734 16311287 16466947 16470532 16821247 16987798 17008283 17145605 17278112 17365003 17365006 17486493 17486497 17486505 17598223 17768122 17900295 17949282 17994378 18056002 18096416 18266208 18294253 18568278 18603555 18654889 18932071 18976160 19000664 19061217 19103851 19125249 19205970 19269866 19372376 19429541 19437135 19460936 19488752 19631632 19657836 19727720 19841268 19843386 19960060 20035706 20113284 20113295 20113296 20132300 20301599 20324533 20395516 20406103 20412082 20437613 20524821 20532507 20642337 20704537 20737602 20854126 20975770 21119755 21228398 21232998 21250876 21250885 21333566 21389146 21417574 21423179 21509314 21797702 21797703 21801233 21931510 22028795 22074124 22110956 22180324 22188014 22233277 22271886 22335963 22356097 22409273 22675570 22851993 22875618 22898041 22975760 22981786 22983591 23106651 23297836 23321370 23348723 23398055 23586372 23590658 23637309 23812938 24052702 24052746 24065537 24086942 24200214 24265529 24368026 24369358 24450243 24616209 24719849 24828949 24857915 24880717 24986053 25000193 25016698 25087612 25089872 25135424 25155404 25268796 25332589 25408857 25469539 25480500 25525159 25525381 25572182 25572186 25617386 25657036 25677748 25825561 25849334 25856402 25910213 25976460 26041423 26076395 26076396 26079343 26096710 26096776 26097845 26290351 26291967 26635043 26850598 26948378 26956563 27117567 27263053 27453201 27492766 27756326 27785405 27821015 27848919 28366028 28391758 28503568 28603845 28635337 28670940 28670947 28671035 28768465 29182041 29313434 29484903 29695942 29893155 30173596 30309760 30422720 31108495 31395865 31714438 31934147 32581362 33851260 34258108 1517110 1520612 1850955 2577233 2837728 2917193 3006832 3780671 6086605 8257991 8318995 8874232 9371531 11186264 11480785 14555318 15481885 16114187 16732578 18076350 18339318 18473247 18694524 19254853 20113289 21599435 21704277 22738610 23383304 23510507 23665927 26410419 27635400 28643346
4	LOC107133510	Origin Of Replication At HBB	Functional Element	425	Pathogenic ⁵ Likely pathogenic ⁵	88735 287080 721609 (more) 893136 1112610 1177278 1301199 1301930 1301952 1374896 1390250 1398296 1420507 1428943 1463768 1483699 1487424 1511973 1515453 1517107 1517108 1517109 1517111 1545796 1577489 1581247 1586746 1634236 1634368 1686262 1698102 1705411 1716997 1719807 1728311 1729892 1734721 1740317 1769663 1772786 1777603 1814858 1856830 1873227 1897518 1911391 1917531 1951306 1954392 1960615 1967205 1971109 1974422 1985702 1986379 1995096 2001456 2004023 2005117 2014803 2070092 2120891 2123063 2197725 2200760 2200762 2207008 2214342 2272840 2283297 2283303 2291577 2298457 2298920 2306523 2310691 2346726 2375912 2393018 2393712 2399911 2424301 2439149 2440502 2446680 2456798 2458145 2467892 2525253 2539344 2542242 2563949 2577233 2606727 2634667 2634674 2665856 2703241 2713503 2730955 2736244 2741940 2753736 2775294 2804366 2822177 2875755 2888754 2897787 2898955 2901867 2915972 2917118 2920213 2920214 2921044 2987224 2987809 3002527 3014870 3021139 3021607 3031297 3048433 3114175 3382401 3387213 3403716 3408672 3417300 3422218 3446652 3457470 3462712 3557998 3671081 3683554 3828533 3955238 4018033 4078867 4351905 4413625 5481775 5658717 5672850 5863839 6089938 6101206 6162860 6166632 6188062 6189507 6190800 6198908 6251466 6264391 6264477 6270663 6275383 6280057 6280138 6292840 6298782 6308558 6310991 6316272 6457059 6469698 6572978 6583683 6583702 6585381 6585831 6664996 6668188 6714226 6733281 6826539 6895866 6896219 6985481 7076659 7104238 7151176 7173395 7177196 7312624 7395858 7507641 7522523 7530406 7558874 7558878 7558879 7599641 7632967 7655036 7663000 7669681 7683931 7713749 7759073 7794779 7795641 7852087 7864023 7899267 7909640 7928376 8019567 8081396 8094943 8144356 8144358 8161774 8172199 8199027 8225319 8226099 8251381 8330981 8435318 8438884 8477263 8485062 8562944 8602996 8619407 8629112 8638609 8682512 8718703 8807345 8839873 8856098 8889595 8978308 8980256 9028819 9048934 9101282 9101288 9113933 9140720 9160698 9163586 9225979 9255617 9340427 9342003 9353871 9401495 9415843 9415845 9450794 9494052 9494053 9560205 9629504 9653159 9792288 9875660 9949622 10233364 10367791 10520021 10569722 10569730 10606872 10706767 10756381 10776695 10815781 10870887 10997336 11186262 11300343 11300352 11425418 11532628 11559932 11570721 11791869 11791873 11857738 11857746 11939510 12139763 12144057 12149194 12172041 12210807 12324499 12368169 12403488 12430907 12488606 12508270 12709369 12752111 12764548 12779270 12850492 12885342 12908806 12955718 13716727 13716853 14576320 14649318 14715623 14734204 15009072 15108284 15114532 15153712 15181845 15257926 15278762 15315794 15352994 15470211 15481886 15481893 15481896 15641237 15654898 15658193 15768552 15929117 15933066 16044458 16103715 16114182 16114184 16114188 16126871 16225661 16266911 16291734 16311287 16466947 16470532 16821247 16987798 17007829 17008283 17145605 17278112 17331080 17365003 17365006 17486493 17486497 17486505 17598223 17606453 17654075 17768122 17900295 17949282 17994378 18056002 18096416 18266208 18294253 18473248 18495504 18568278 18591626 18603555 18654889 18932071 18976160 19000664 19061217 19103851 19125249 19205970 19205975 19254853 19269866 19372376 19429541 19437135 19460936 19488752 19631632 19657836 19727720 19841268 19843386 19960060 20035706 20113284 20113295 20113296 20132300 20181291 20230396 20301599 20324533 20395516 20406103 20412082 20437613 20524821 20532507 20642337 20704537 20737602 20854126 20975770 21119755 21228398 21232998 21250876 21250885 21333566 21389146 21417574 21423179 21509314 21797702 21797703 21801233 21931510 22028795 22074124 22110956 22122796 22180324 22188014 22233277 22271886 22335963 22356097 22409273 22563936 22675570 22690826 22734587 22851993 22875618 22898041 22975760 22981786 22983591 23106651 23297836 23321370 23348723 23398055 23525874 23586372 23590658 23637309 23812938 23878091 24052702 24052746 24065537 24080465 24086942 24200214 24265529 24368026 24369358 24450243 24616209 24719849 24828949 24857915 24880717 24986053 25000193 25016698 25087612 25089872 25135424 25155404 25268796 25332589 25408857 25469539 25480500 25525159 25525381 25572182 25572186 25617386 25657036 25677748 25825561 25849334 25856402 25905082 25910213 25976460 26041423 26076395 26076396 26079343 26096710 26096776 26097845 26290351 26291967 26524961 26635043 26850598 26877226 26948378 26956563 27117567 27263053 27453201 27492766 27756326 27785405 27821015 27848919 28125089 28366028 28391758 28460555 28475449 28503568 28603845 28635337 28670940 28670947 28671035 28768465 29182041 29188602 29313434 29484903 29695942 29893155 30173596 30309760 30422720 31108495 31240559 31395865 31589614 31714438 31934147 32581362 33851260 34258108 750554 1517110 1520612 1850955 2375910 2837728 2917193 3006832 3780671 3923770 3957694 4808644 6086605 7615400 7819068 8112743 8257991 8318995 8537236 8874232 9371531 11186264 11480785 14555318 15481885 16114187 16732578 17565724 18076350 18339318 18473247 18694524 18818920 20113289 21599435 21704277 22738610 23383304 23510507 23651435 23665927 23859443 23889802 26410419 27635400 28643346 29403210
5	LOC110006319	Beta-Globin Gene 3' Regulatory Region	Functional Element	425	Pathogenic ⁵ Likely pathogenic ⁵	287080 721609 893136 (more) 1112610 1177278 1301199 1374896 1390250 1398296 1420507 1463768 1483699 1511973 1517108 1586746 1634236 1634368 1705411 1728311 1740317 1772786 1777603 1856830 1897518 1917531 1954392 1971109 1986379 2005117 2014803 2070092 2123063 2200760 2207008 2298457 2393018 2399911 2424301 2446680 2458145 2563949 2577233 2634667 2822177 2897787 2920213 2987809 3014870 3387213 3417300 3422218 3446652 3557998 3683554 3828533 4018033 4078867 4351905 5481775 5672850 6188062 6251466 6270663 6280057 6280138 6298782 6583702 6585381 7151176 7530406 7558878 7558879 7632967 7928376 8144356 8144358 8161774 8330981 8435318 8477263 8485062 8978308 9028819 9048934 9101288 9140720 9163586 9342003 9353871 9401495 9450794 9560205 9792288 9875660 10367791 10520021 10569730 10606872 10870887 11300343 11300352 11532628 11559932 11857746 12139763 12144057 12430907 12709369 12764548 14649318 15108284 15278762 15481893 15654898 15658193 15768552 15933066 16114188 16266911 16311287 17007829 17331080 17365006 17486497 17606453 17654075 17768122 17994378 18294253 18473248 18495504 18591626 18603555 19205975 19254853 19460936 19657836 20113284 20181291 20230396 20395516 20437613 20524821 20704537 21119755 21250876 22122796 22563936 22690826 22734587 23321370 23525874 23590658 23637309 23878091 24080465 24265529 24719849 25155404 25332589 25480500 25525159 25525381 25677748 25825561 25849334 25905082 26524961 26635043 26877226 27263053 28125089 28460555 28475449 29188602 31240559 31589614 32581362 750554 1301930 2001456 2375910 3923770 3957694 4808644 7599641 7615400 7819068 8112743 8537236 8718703 11186264 12368169 17565724 18818920 19205970 20113289 21423179 21704277 22975760 23651435 23859443 23889802 26041423 26290351 28603845 29403210
6	HBG1	Hemoglobin Subunit Gamma 1	Protein Coding	37.03	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications Proteins (show sections)	16814578 7703040 10699179 (more) 10975440 19365082 12411297 15931385 7677966 16513230 18076350 17951528 17978480 1705405 16131492 17486512 18379999 11063260 17612629 19958188
7	HBA2	Hemoglobin Subunit Alpha 2	Protein Coding	35.53	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	9668531 18768527 15931385 (more) 10872480 10975440 17874450 8294880 16910233 1634369 15230119 16503552 11876981 11204841 10779423 8634456 1737089 14637270 1362099 1586745 19585085 19794088 12192002 19951531 16284800 16019463 10870881 1737090 1380206 12673836 15144711 18181203
8	GATA1	GATA Binding Protein 1	Protein Coding	32.42	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Disorders Publications (show sections)	11809723 17654503 16158817
9	AHSP	Alpha Hemoglobin Stabilizing Protein	Protein Coding	30.88	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications Functions (show sections)	17874450 15545996 16696909 (more) 20063986 16186125
10	HFE	Homeostatic Iron Regulator	Protein Coding	28.81	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	10477452 17303462 17160266 (more) 15538648 11869934 15570296 17335681 9558289 15805002 10706769
11	TFRC	Transferrin Receptor	Protein Coding	27.92	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	12774668 12904899 12870058 (more) 12373360 12801838 16339692 8900849 17721544 16755567
12	HBD	Hemoglobin Subunit Delta	Protein Coding	26.66	DISEASES inferred ¹⁴ GeneCards inferred via : Publications Summaries (show sections)
13	HBS1L	HBS1 Like Translational GTPase	Protein Coding	24.79	DISEASES inferred ¹⁴ GeneCards inferred via : Publications Summaries (show sections)
14	KLF1	KLF Transcription Factor 1	Protein Coding	24.35	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	8288615 7829533 8924208 (more) 15352994
15	EPO	Erythropoietin	Protein Coding	23.65	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	9544165 12465748 9640615 (more) 14586179 11563599 12498775 15153710 7529455 11065350 15755051 11325640 9020369 9401497 1884025 10052837 1868247 16339673 8043875 12513755 10779423 1460323 9640605 9089744 8641410 18543545 9009557 17721544 9185215 15359104 11274756 11770580
16	TFR2	Transferrin Receptor 2	Protein Coding	22.76	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	16755567 15059075
17	TF	Transferrin	Protein Coding	22.2	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	20098432 18175831 11393640 (more) 16339692 15538648 10218766
18	G6PD	Glucose-6-Phosphate Dehydrogenase	Protein Coding	21.89	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	18164966 19710527 2129613 (more) 10762587 1572671 9044721 9841856 17167252 8303876 9322280 20502001 14641141 12406995 2249233 2397966 8491573 18720418
19	HBG2	Hemoglobin Subunit Gamma 2	Protein Coding	21.67	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	15230119 19050890
20	CHIT1	Chitinase 1	Protein Coding	19.21	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	12221666 10349508 11282098 (more) 16137900
21	UGT1A1	UDP Glucuronosyltransferase Family 1 Member A1	Protein Coding	18.99	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	19953640 18081723 11764096
22	HBE1	Hemoglobin Subunit Epsilon 1	Protein Coding	18.6	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
23	BCL11A	BCL11 Transcription Factor A	Protein Coding	17.65	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
24	RHD	Rh Blood Group D Antigen	Protein Coding	17.64	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	11780409 15047982
25	LOC109951029	Delta-Globin 5' Regulatory Region	Functional Element	17.32	GeneCards inferred via : Publications Summaries (show sections)
26	EGID-105180392	Beta-Globin 3' Hypersensitive Site 1	Functional Element	17.14	GeneCards inferred via : Publications Summaries (show sections)
27	HAMP	Hepcidin Antimicrobial Peptide	Protein Coding	16.71	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
28	HBA1	Hemoglobin Subunit Alpha 1	Protein Coding	16.48	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
29	TNFSF11	TNF Superfamily Member 11	Protein Coding	15.75	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	17187195
30	ERFE	Erythroferrone	Protein Coding	15.59	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
31	TNFRSF11B	TNF Receptor Superfamily Member 11b	Protein Coding	15.26	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	17187195 16704959 20445416
32	HJV	Hemojuvelin BMP Co-Receptor	Protein Coding	15.02	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
33	GDF15	Growth Differentiation Factor 15	Protein Coding	14.81	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
34	TMPRSS6	Transmembrane Serine Protease 6	Protein Coding	14.79	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
35	ANXA5	Annexin A5	Protein Coding	14.78	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	8781447 8883264
36	VDR	Vitamin D Receptor	Protein Coding	14.49	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	19337166
37	F2	Coagulation Factor II, Thrombin	Protein Coding	13.81	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
38	EPOR	Erythropoietin Receptor	Protein Coding	13.61	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
39	GSR	Glutathione-Disulfide Reductase	Protein Coding	13.59	DISEASES inferred ¹⁴ Novoseek inferred ⁵³ GeneCards inferred via : Publications (show sections)	8303876
40	IL3	Interleukin 3	Protein Coding	13.57	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
41	JAK2	Janus Kinase 2	Protein Coding	13.57	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
42	INS	Insulin	Protein Coding	13.53	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
43	IGF1	Insulin Like Growth Factor 1	Protein Coding	13.51	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
44	EIF2AK1	Eukaryotic Translation Initiation Factor 2 Alpha Kinase 1	Protein Coding	13.5	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
45	MYB	MYB Proto-Oncogene, Transcription Factor	Protein Coding	13.31	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
46	IL6	Interleukin 6	Protein Coding	13.25	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
47	IREB2	Iron Responsive Element Binding Protein 2	Protein Coding	13.18	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
48	MTHFR	Methylenetetrahydrofolate Reductase	Protein Coding	13.05	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
49	BGLAP	Bone Gamma-Carboxyglutamate Protein	Protein Coding	13.05	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)
50	ENTPD1	Ectonucleoside Triphosphate Diphosphohydrolase 1	Protein Coding	13.02	DISEASES inferred ¹⁴ GeneCards inferred via : Publications (show sections)

Sources

Variations for Beta-Thalassemia

ClinVar genetic disease variations for Beta-Thalassemia:

⁵ (show top 50) (show all 390)

#	Gene	Name	Type	Significance	ClinVarId	dbSNP ID	Position
1	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.383_385del (p.Gln128_Ala129delinsPro)	DEL	Pathogenic	15410	rs34502690	GRCh37: 11:5246887-5246889 GRCh38: 11:5225657-5225659
2	LOC106099062, HBB, LOC107133510	NM_000518.4(HBB):c.182T>A (p.Val61Glu)	SNV	Pathogenic	15411	rs33931779	GRCh37: 11:5247940-5247940 GRCh38: 11:5226710-5226710
3	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.*112A>G	SNV	Pathogenic	15476	rs63750954	GRCh37: 11:5246716-5246716 GRCh38: 11:5225486-5225486
4	LOC110006319, HBB, LOC107133510	NM_000518.4(HBB):c.320T>G (p.Leu107Arg)	SNV	Pathogenic	15487	rs33941844	GRCh37: 11:5246952-5246952 GRCh38: 11:5225722-5225722
5	HBB, LOC106099062, LOC107133510	NG_000007.3:g.70444C>G	SNV	Pathogenic	15586		GRCh37: 11:5248402-5248402 GRCh38: 11:5227172-5227172
6	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.*110T>A	SNV	Pathogenic	15616	rs33978907	GRCh37: 11:5246718-5246718 GRCh38: 11:5225488-5225488
7	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.*116del	DEL	Pathogenic	15474		GRCh37: 11:5246712-5246712 GRCh38: 11:5225482-5225482
8	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.110_111insG	INSERT	Pathogenic	15475		GRCh37: 11:5246717-5246718 GRCh38: 11:5225487-5225488
9	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.316-8T>G	SNV	Pathogenic Pathogenic	15453	rs34793594	GRCh37: 11:5246964-5246964 GRCh38: 11:5225734-5225734
10	HBB, LOC106099062, LOC107133510	NM_000518.5(HBB):c.-142C>T	SNV	Pathogenic Pathogenic Not Provided	15462	rs34883338	GRCh37: 11:5248393-5248393 GRCh38: 11:5227163-5227163
11	HBB, LOC106099062, LOC107133510	NM_000518.5(HBB):c.-138C>A	SNV	Pathogenic Pathogenic Likely Pathogenic	393701	rs33944208	GRCh37: 11:5248389-5248389 GRCh38: 11:5227159-5227159
12	HBB, LOC106099062, LOC107133510	NC_000011.10:g.5227101A>G	SNV	Pathogenic Pathogenic	869290	rs33980857	GRCh37: 11:5248331-5248331 GRCh38: 11:5227101-5227101
13	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.*113A>G	SNV	Pathogenic Pathogenic/Likely Pathogenic	15473	rs33985472	GRCh37: 11:5246715-5246715 GRCh38: 11:5225485-5225485
14	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.*111A>G	SNV	Pathogenic Likely Pathogenic	15488	rs63751128	GRCh37: 11:5246717-5246717 GRCh38: 11:5225487-5225487
15	HBB, LOC106099062, LOC107133510	NM_000518.5(HBB):c.-82C>A	SNV	Pathogenic Pathogenic	15492	rs34500389	GRCh37: 11:5248333-5248333 GRCh38: 11:5227103-5227103
16	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.110_114del	DEL	Pathogenic Pathogenic	15506	rs35949130	GRCh37: 11:5246714-5246718 GRCh38: 11:5225484-5225488
17	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.344T>C (p.Leu115Pro)	SNV	Pathogenic Pathogenic	15513	rs36015961	GRCh37: 11:5246928-5246928 GRCh38: 11:5225698-5225698
18	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.117_118del (p.Gln40fs)	DEL	Pathogenic	15551	rs267607291	GRCh37: 11:5248004-5248005 GRCh38: 11:5226774-5226775
19	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.316-2A>C	SNV	Pathogenic	21190	rs33914668	GRCh37: 11:5246958-5246958 GRCh38: 11:5225728-5225728
20	HBB	NC_000011.10:g.5216940_5229551del	DEL	Pathogenic	869213		GRCh37: GRCh38:
21	overlap with 3 genes	NC_000011.10:g.5218346_5226066del	DEL	Pathogenic	869214		GRCh37: 11:5239576-5247296 GRCh38: 11:5218346-5226066
22	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.170_171insGCAACCCTAAGGTG (p.Gly57_Asn58insGlnProTer)	INSERT	Pathogenic	869222	rs1847560327	GRCh37: 11:5247951-5247952 GRCh38: 11:5226721-5226722
23	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.176dup (p.Pro59_Lys60insTer)	DUP	Pathogenic	869223	rs35395625	GRCh37: 11:5247945-5247946 GRCh38: 11:5226715-5226716
24	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.178A>T (p.Lys60Ter)	SNV	Pathogenic	869224	rs33969400	GRCh37: 11:5247944-5247944 GRCh38: 11:5226714-5226714
25	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.179del (p.Lys60fs)	DEL	Pathogenic	869225	rs267607293	GRCh37: 11:5247943-5247943 GRCh38: 11:5226713-5226713
26	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.18_19del (p.Glu7fs)	DEL	Pathogenic	869226	rs281864519	GRCh37: 11:5248233-5248234 GRCh38: 11:5227003-5227004
27	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.184A>T (p.Lys62Ter)	SNV	Pathogenic	15407	rs33995148	GRCh37: 11:5247938-5247938 GRCh38: 11:5226708-5226708
28	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.187_251dup (p.Thr85fs)	DUP	Pathogenic	869227	rs1847554565	GRCh37: 11:5247870-5247871 GRCh38: 11:5226640-5226641
29	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.189_195del (p.His64fs)	DEL	Pathogenic	869228	rs1847558511	GRCh37: 11:5247927-5247933 GRCh38: 11:5226697-5226703
30	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.199A>T (p.Lys67Ter)	SNV	Pathogenic	869229	rs34165323	GRCh37: 11:5247923-5247923 GRCh38: 11:5226693-5226693
31	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.19G>T (p.Glu7Ter)	SNV	Pathogenic	869230	rs33930165	GRCh37: 11:5248233-5248233 GRCh38: 11:5227003-5227003
32	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.20_32del (p.Glu7fs)	DEL	Pathogenic	869232	rs1847586938	GRCh37: 11:5248220-5248232 GRCh38: 11:5226990-5227002
33	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.22G>T (p.Glu8Ter)	SNV	Pathogenic	869271	rs34948328	GRCh37: 11:5248230-5248230 GRCh38: 11:5227000-5227000
34	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.232del (p.His78fs)	DEL	Pathogenic	869272	rs63750504	GRCh37: 11:5247890-5247890 GRCh38: 11:5226660-5226660
35	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.235dup (p.Leu79fs)	DUP	Pathogenic	869273	rs281865475	GRCh37: 11:5247886-5247887 GRCh38: 11:5226656-5226657
36	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.237_256del (p.Asp80fs)	DEL	Pathogenic	869274	rs1847554171	GRCh37: 11:5247866-5247885 GRCh38: 11:5226636-5226655
37	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.244_265del (p.Asn81_Leu82insTer)	DEL	Pathogenic	869275	rs1847553585	GRCh37: 11:5247857-5247878 GRCh38: 11:5226627-5226648
38	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.316-3C>G	SNV	Pathogenic	619687	rs33913413	GRCh37: 11:5246959-5246959 GRCh38: 11:5225729-5225729
39	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.316-98_316-86dup	DUP	Pathogenic	869277	rs1847534434	GRCh37: 11:5247041-5247042 GRCh38: 11:5225811-5225812
40	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.319C>G (p.Leu107Val)	SNV	Pathogenic	869278	rs63750596	GRCh37: 11:5246953-5246953 GRCh38: 11:5225723-5225723
41	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.339_345dup (p.Ala116fs)	DUP	Pathogenic	869279	rs281864527	GRCh37: 11:5246926-5246927 GRCh38: 11:5225696-5225697
42	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.339T>A (p.Cys113Ter)	SNV	Pathogenic	869280	rs33930977	GRCh37: 11:5246933-5246933 GRCh38: 11:5225703-5225703
43	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.33del (p.Val12fs)	DEL	Pathogenic	869281	rs1554918214	GRCh37: 11:5248219-5248219 GRCh38: 11:5226989-5226989
44	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.349_350insTGAT (p.His117fs)	INSERT	Pathogenic	869282	rs63751306	GRCh37: 11:5246922-5246923 GRCh38: 11:5225692-5225693
45	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.354del (p.Phe119fs)	DEL	Pathogenic	869283	rs281864528	GRCh37: 11:5246918-5246918 GRCh38: 11:5225688-5225688
46	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.375dup (p.Pro126fs)	DUP	Pathogenic	869284	rs281864544	GRCh37: 11:5246896-5246897 GRCh38: 11:5225666-5225667
47	LOC110006319, HBB, LOC107133510	NM_000518.5(HBB):c.378del (p.Val127fs)	DEL	Pathogenic	869285	rs34363638	GRCh37: 11:5246894-5246894 GRCh38: 11:5225664-5225664
48	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.93-17_93-1del	DEL	Pathogenic	15441	rs1554918032	GRCh37: 11:5248030-5248046 GRCh38: 11:5226800-5226816
49	LOC106099062, HBB, LOC107133510	NM_000518.5(HBB):c.93-2A>C	SNV	Pathogenic	439167	rs63750513	GRCh37: 11:5248031-5248031 GRCh38: 11:5226801-5226801
50	HBB, LOC106099062, LOC107133510	NC_000011.10:g.5227097T>G	SNV	Pathogenic	869286	rs281864525	GRCh37: 11:5248327-5248327 GRCh38: 11:5227097-5227097

UniProtKB/Swiss-Prot genetic disease variations for Beta-Thalassemia:

⁷³

#	Symbol	AA change	Variation ID	SNP ID
1	HBB	p.Glu27Lys	VAR_002907	rs33950507
2	HBB	p.Ala116Asp	VAR_003037	rs35485099
3	HBB	p.Val127Gly	VAR_003056	rs33925391
4	HBB	p.Leu115Pro	VAR_010145	rs36015961

Sources

Expression for Beta-Thalassemia

Search GEO for disease gene expression data for Beta-Thalassemia.

Sources

Pathways for Beta-Thalassemia

Pathways related to Beta-Thalassemia according to GeneCards Suite gene sharing:

#	Super pathways	Score	Top Affiliating Genes
1	Response to elevated platelet cytosolic Ca2+ ⁶⁶ Show member pathways Disinhibition of SNARE formation ⁶⁶ Hemostasis ⁶⁶ Platelet activation, signaling and aggregation ⁶⁶ Platelet degranulation ⁶⁶	12.8	TF HBG2 HBG1 HBD HBB GATA1
2	Golgi-to-ER retrograde transport ⁶⁶ Show member pathways COPI-dependent Golgi-to-ER retrograde traffic ⁶⁶ Factors involved in megakaryocyte development and platelet production ⁶⁶ Intra-Golgi and retrograde Golgi-to-ER traffic ⁶⁶ Kinesins ⁶⁶ MHC class II antigen presentation ⁶⁶	12.61	HBG2 HBG1 HBD HBB GATA1
3	Insulin receptor recycling ⁶⁶ Show member pathways ATP biosynthesis ⁶¹ Events associated with phagocytolytic activity of PMN cells ⁶⁶ Iron uptake and transport ⁶⁶ melatonin degradation III ⁶¹ ROS and RNS production in phagocytes ⁶⁶ Transferrin endocytosis and recycling ⁶⁶	11.16	TFRC TFR2 TF HFE
4	HIF-1-alpha transcription factor network ⁶¹	11.14	TFRC TF EPO
5	3q29 copy number variation syndrome ⁷⁴	10.92	TFRC TF HFE

Sources

GO Terms for Beta-Thalassemia

Cellular components related to Beta-Thalassemia according to GeneCards Suite gene sharing:

#	Name	GO ID	Score	Top Affiliating Genes
1	blood microparticle	GO:0072562	10.03	TFRC TF HBG2 HBD HBB HBA2
2	HFE-transferrin receptor complex	GO:1990712	9.76	TFRC TFR2 TF HFE
3	haptoglobin-hemoglobin complex	GO:0031838	9.65	HBA2 HBB HBD HBG1 HBG2
4	hemoglobin complex	GO:0005833	9.4	HBG2 HBG1 HBD HBB HBA2 AHSP

Biological processes related to Beta-Thalassemia according to GeneCards Suite gene sharing:

(show all 18)

#	Name	GO ID	Score	Top Affiliating Genes
1	cellular iron ion homeostasis	GO:0006879	10.03	TFRC TFR2 TF HFE
2	cellular oxidant detoxification	GO:0098869	10.02	HBG2 HBG1 HBD HBB HBA2
3	iron ion homeostasis	GO:0055072	10.01	TFR2 TF HFE
4	erythrocyte differentiation	GO:0030218	10.01	AHSP EPO GATA1 KLF1
5	acute-phase response	GO:0006953	9.99	EPO TFR2 TFRC
6	positive regulation of cell death	GO:0010942	9.96	HBG2 HBG1 HBD HBB HBA2
7	iron ion transport	GO:0006826	9.95	TFRC TFR2 TF
8	response to iron ion	GO:0010039	9.93	TFRC TFR2 HFE
9	positive regulation of peptide hormone secretion	GO:0090277	9.88	TFR2 HFE
10	transferrin transport	GO:0033572	9.87	TFRC TFR2
11	myeloid cell apoptotic process	GO:0033028	9.85	GATA1 EPO
12	cellular response to iron ion	GO:0071281	9.85	TFR2 TF HFE
13	hydrogen peroxide catabolic process	GO:0042744	9.85	HBA2 HBB HBD HBG1 HBG2
14	nitric oxide transport	GO:0030185	9.83	HBB HBA2
15	regulation of iron ion transport	GO:0034756	9.8	TF HFE
16	negative regulation of myeloid cell apoptotic process	GO:0033033	9.73	GATA1 EPO
17	oxygen transport	GO:0015671	9.65	HBG2 HBG1 HBD HBB HBA2
18	carbon dioxide transport	GO:0015670	9.32	HBG2 HBG1 HBD HBB HBA2

Molecular functions related to Beta-Thalassemia according to GeneCards Suite gene sharing:

(show all 11)

#	Name	GO ID	Score	Top Affiliating Genes
1	heme binding	GO:0020037	10.1	HBA2 HBB HBD HBG1 HBG2
2	peroxidase activity	GO:0004601	10.07	HBG2 HBG1 HBD HBB HBA2
3	oxygen binding	GO:0019825	10.02	HBA2 HBB HBD HBG1 HBG2
4	hemoglobin alpha binding	GO:0031721	9.86	HBG2 HBG1 HBD HBB
5	oxygen carrier activity	GO:0005344	9.85	HBA2 HBB HBD HBG1 HBG2
6	co-receptor binding	GO:0039706	9.8	TFR2 HFE
7	transferrin receptor binding	GO:1990459	9.78	TF HFE
8	hemoglobin binding	GO:0030492	9.76	HBB AHSP
9	transferrin receptor activity	GO:0004998	9.73	TFRC TFR2
10	organic acid binding	GO:0043177	9.65	HBG2 HBG1 HBD HBB HBA2
11	haptoglobin binding	GO:0031720	9.32	HBG2 HBG1 HBD HBB HBA2