B-THAL
MCID: BTT014
MIFTS: 70

Beta-Thalassemia (B-THAL)

Categories: Blood diseases, Endocrine diseases, Genetic diseases, Immune diseases, Liver diseases, Nephrological diseases, Rare diseases
Data Licensing
For inquiries, contact:

Aliases & Classifications for Beta-Thalassemia

MalaCards integrated aliases for Beta-Thalassemia:

Name: Beta-Thalassemia 57 24 19 58 75 73 53 43 36
Beta Thalassemia 11 42 73 28 5 14 71 75
Beta Thalassemia Intermedia 19 28 5 71
Mediterranean Anemia 24 19 42 73
Cooley's Anemia 24 19 73 71
Erythroblastic Anemia 19 42 73
Thalassemia, Hispanic Gamma-Delta-Beta 57 19
Beta-Plus-Thalassemia 5 71
Thalassemia Minor 73 71
Thalassemia Major 73 53
Beta Thalassaemia Syndrome 33
Beta Thalassaemia Disease 33
Beta Thalassemia Major 19
Beta Thalassemia Minor 19
Thalassemia, Beta Type 42
Mediterranean Anaemia 33
Mediterranean Disease 33
Thalassemias, Beta- 19
Thalassemia, Beta 57
B-Thal 73

Characteristics:


Inheritance:

Autosomal dominant,Autosomal recessive 58

Prevelance:

1-9/100000 (Worldwide) 1-9/1000000 (France) 1-5/10000 (Europe) 58

Age Of Onset:

Childhood,Infancy 58

Classifications:

Orphanet: 58  
Rare renal diseases
Rare endocrine diseases
Rare haematological diseases


External Ids:

Disease Ontology 11 DOID:12241
OMIM® 57 613985
ICD9CM 34 282.44
MeSH 43 D017086
NCIt 49 C34375
SNOMED-CT 68 65959000
ICD10 31 D56.1
MESH via Orphanet 44 D017086
ICD10 via Orphanet 32 D56.1
UMLS via Orphanet 72 C0005283
Orphanet 58 ORPHA848
ICD11 33 2063292324
UMLS 71 C0002875 C0005283 C0085578 more

Summaries for Beta-Thalassemia

MedlinePlus Genetics: 42 Beta thalassemia is a blood disorder that reduces the production of hemoglobin. Hemoglobin is the iron-containing protein in red blood cells that carries oxygen to cells throughout the body.In people with beta thalassemia, low levels of hemoglobin reduce oxygen levels in the body. Affected individuals also have a shortage of red blood cells (anemia), which can cause pale skin, weakness, fatigue, and more serious complications. People with beta thalassemia are at an increased risk of developing abnormal blood clots.Beta thalassemia is classified into two types depending on the severity of symptoms: thalassemia major (also known as transfusion-dependent thalassemia or Cooley's anemia) and thalassemia intermedia (which is a non-transfusion-dependent thalassemia). Of the two types, thalassemia major is more severe.The signs and symptoms of thalassemia major appear within the first 2 years of life. Children develop life-threatening anemia. They do not gain weight and grow at the expected rate (failure to thrive) and may develop yellowing of the skin and whites of the eyes (jaundice). Affected individuals may have an enlarged spleen, liver, and heart, and their bones may be misshapen. Puberty is delayed in some adolescents with thalassemia major. Many people with thalassemia major have such severe symptoms that they need frequent blood transfusions to replenish their red blood cell supply. Over time, an influx of iron-containing hemoglobin from chronic blood transfusions can lead to a buildup of iron in the body, resulting in liver, heart, and hormone problems.Thalassemia intermedia is milder than thalassemia major. The signs and symptoms of thalassemia intermedia appear in early childhood or later in life. Affected individuals have mild to moderate anemia and may also have slow growth, bone abnormalities, and an increased risk of developing abnormal blood clots.

MalaCards based summary: Beta-Thalassemia, also known as beta thalassemia, is related to thrombocytopenia with beta-thalassemia, x-linked and hemoglobin lepore-beta-thalassemia syndrome. An important gene associated with Beta-Thalassemia is HBB (Hemoglobin Subunit Beta), and among its related pathways/superpathways are Response to elevated platelet cytosolic Ca2+ and Golgi-to-ER retrograde transport. The drugs Metformin and Peginterferon alfa-2b have been mentioned in the context of this disorder. Affiliated tissues include liver, spleen and bone, and related phenotypes are splenomegaly and pallor

GARD: 19 Beta-thalassemia is a blood disorder that reduces the body's production of hemoglobin. Low levels of hemoglobin lead to a shortage of mature red blood cells and a lack of oxygen in the body. People with Beta-thalassemia have anemia, which can cause paleness, weakness, fatigue, and more serious complications. There are two main forms of Beta-thalassemia, classified based on the severity of symptoms: Thalassemia major (also called Cooley's anemia) - the more severe form, causing severe anemia and enlarged liver and spleen (hepatosplenomegaly). Thalassemia intermedia - the less severe form causing milder anemia that does not require regular blood transfusions. People with this form are also at risk for iron overload. Beta-thalassemia is caused by genetic changes in the HBB gene and is typically inherited in an autosomal recessive manner. This means that people with thalassemia major or thalassemia intermedia have a genetic change in both of their copies of the HBB gene. People who have only one HBB genetic change (carriers) typically are said to have thalassemia minor (or trait) and usually do not have symptoms, but may have some symptoms of anemia. Very rarely, the inheritance of Beta-thalassemia may be dominant. In this case, a person has only one mutated HBB gene, but has signs and symptoms of Beta-thalassemia major or Beta-thalassemia intermedia.

OMIM®: 57 Beta-thalassemia is characterized by a reduced production of hemoglobin A (HbA, alpha-2/beta-2), which results from the reduced synthesis of beta-globin chains relative to alpha-globin chains, thus causing an imbalance in globin chain production and hence abnormal erythropoiesis. The disorder is clinically heterogeneous (summary by Ottolenghi et al., 1975). Absence of beta globin causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. For clinical purposes, beta-thalassemia is divided into thalassemia major (transfusion dependent), thalassemia intermedia (of intermediate severity), and thalassemia minor (asymptomatic, carrier state). The molecular and clinical aspects of the beta-thalassemias were reviewed by Olivieri (1999). The remarkable phenotypic diversity of the beta-thalassemias reflects the heterogeneity of mutations at the HBB locus, the action of many secondary and tertiary modifiers, and a wide range of environmental factors (Weatherall, 2001). For a review of beta-thalassemia, see Taher et al. (2021). (613985) (Updated 08-Dec-2022)

UniProtKB/Swiss-Prot: 73 A form of thalassemia. Thalassemias are common monogenic diseases occurring mostly in Mediterranean and Southeast Asian populations. The hallmark of beta-thalassemia is an imbalance in globin-chain production in the adult HbA molecule. Absence of beta chain causes beta(0)-thalassemia, while reduced amounts of detectable beta globin causes beta(+)-thalassemia. In the severe forms of beta-thalassemia, the excess alpha globin chains accumulate in the developing erythroid precursors in the marrow. Their deposition leads to a vast increase in erythroid apoptosis that in turn causes ineffective erythropoiesis and severe microcytic hypochromic anemia. Clinically, beta-thalassemia is divided into thalassemia major which is transfusion dependent, thalassemia intermedia (of intermediate severity), and thalassemia minor that is asymptomatic.

Orphanet: 58 Beta-thalassemia (BT) is characterized by deficiency (Beta+) or absence (Beta0) of synthesis of the beta globin chains of hemoglobin (Hb).

Disease Ontology: 11 A thalassemia characterized by the reduced or absent synthesis of the beta globin chains of hemoglobin.

Wikipedia: 75 Beta thalassemias (β thalassemias) are a group of inherited blood disorders. They are forms of... more...

GeneReviews: NBK1426

Related Diseases for Beta-Thalassemia

Diseases in the Thalassemia family:

Alpha-Thalassemia Beta-Thalassemia
Autosomal Dominant Beta Thalassemia Beta-Thalassemia and Related Diseases
Alpha-Thalassemia and Related Disorders

Diseases related to Beta-Thalassemia via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 802)
# Related Disease Score Top Affiliating Genes
1 thrombocytopenia with beta-thalassemia, x-linked 33.4 HBG2 GATA1
2 hemoglobin lepore-beta-thalassemia syndrome 33.3 HBD HBB
3 beta-thalassemia intermedia 33.2 TFRC TFR2 KLF1 HFE HBS1L HBG2
4 autosomal dominant beta thalassemia 33.2 TFR2 KLF1 HFE HBS1L HBG2 HBG1
5 hereditary persistence of fetal hemoglobin-beta-thalassemia syndrome 33.0 KLF1 HBG2 HBG1 HBB
6 thalassemia minor 32.7 HBG2 HBG1 HBD HBB HBA2 GATA1
7 hemoglobin e-beta-thalassemia syndrome 32.4 LOC107133510 LOC106099062 HBB
8 beta-thalassemia, dominant inclusion body type 32.0 LOC110006319 LOC107133510 LOC106099062 HBB
9 fetal hemoglobin quantitative trait locus 1 32.0 LOC110006319 LOC107133510 LOC106099062 KLF1 HBS1L HBG2
10 iron metabolism disease 32.0 TFRC TFR2 TF HFE HBB G6PD
11 thalassemia 32.0 TFRC TFR2 TF LOC110006319 LOC107133510 KLF1
12 splenomegaly 31.8 HBB HBA2 EPO
13 beta-thalassemia major 31.8 TFRC TFR2 LOC110006319 LOC107133510 LOC106099062 KLF1
14 iron deficiency anemia 31.7 TFRC TFR2 TF HFE HBG2 G6PD
15 iron overload 31.6 TFR2 TF HFE
16 siderosis 31.6 TFRC TF HFE
17 hemosiderosis 31.6 TFRC TFR2 TF HFE EPO
18 hemochromatosis, type 1 31.6 TFRC TFR2 TF HFE HBS1L HBB
19 microcytic anemia 31.5 TFRC TFR2 TF HFE HBB HBA2
20 anemia, sideroblastic, 1 31.5 TFRC TFR2 KLF1 HFE HBB GATA1
21 histiocytosis-lymphadenopathy plus syndrome 31.4 HBB HBA2 G6PD
22 glucosephosphate dehydrogenase deficiency 31.3 HBG2 HBB HBA2 G6PD
23 hypochromic microcytic anemia 31.3 TFRC TF HBB HBA2 EPO
24 hemoglobin h disease 31.3 TFRC HBB HBA2 AHSP
25 hereditary spherocytosis 31.2 TFRC KLF1 HFE HBG1 HBB GATA1
26 polycythemia 31.1 TFRC HBB HBA2 GATA1 EPO
27 splenic sequestration 31.0 HBB EPO
28 acute erythroid leukemia 31.0 TFRC KLF1 GATA1 EPO
29 erythroleukemia 31.0 TFRC KLF1 HBG1 HBB GATA1 EPO
30 congenital dyserythropoietic anemia 31.0 KLF1 HFE GATA1
31 hemoglobin e disease 30.9 TFRC LOC107133510 LOC106099062 KLF1 HBS1L HBG2
32 anemia, congenital dyserythropoietic, type ia 30.9 TFRC KLF1 GATA1 EPO
33 neonatal anemia 30.8 TFRC KLF1 HBB EPO
34 porphyria 30.8 TFRC TFR2 HFE GATA1 EPO
35 nutritional deficiency disease 30.7 TFRC TF EPO
36 plasmodium falciparum malaria 30.7 HBB G6PD CHIT1
37 myelodysplastic syndrome 30.7 TFRC TF HFE GATA1 EPO
38 porphyria cutanea tarda 30.7 TFRC TFR2 TF HFE GATA1 EPO
39 deficiency anemia 30.7 TFRC TFR2 TF LOC107133510 LOC106099062 KLF1
40 hfe hemochromatosis 30.6 TF HFE
41 sideroblastic anemia 30.6 TFRC TFR2 HFE
42 hemolytic anemia 30.5 TFRC TF LOC107133510 LOC106099062 KLF1 HFE
43 sickle cell anemia 30.5 TFRC LOC110006319 LOC107133510 LOC106099062 KLF1 HBS1L
44 congenital hemolytic anemia 30.5 TFRC TF KLF1 HBG2 HBG1 HBD
45 methemoglobinemia 30.5 HBG2 HBB G6PD
46 alpha-thalassemia 30.4 TFRC LOC110006319 LOC107133510 LOC106099062 KLF1 HFE
47 sickle cell disease 30.4 LOC110006319 LOC107133510 LOC106099062 HBS1L HBG2 HBG1
48 hemoglobinopathy 30.4 TFRC TFR2 TF LOC110006319 LOC107133510 LOC106099062
49 hemochromatosis, type 3 30.4 TFRC TFR2 HFE
50 hemochromatosis type 2 30.4 TFRC TFR2 HFE

Graphical network of the top 20 diseases related to Beta-Thalassemia:



Diseases related to Beta-Thalassemia

Symptoms & Phenotypes for Beta-Thalassemia

Human phenotypes related to Beta-Thalassemia:

58 30 (show all 24)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 splenomegaly 58 30 Hallmark (90%) Very frequent (99-80%)
HP:0001744
2 pallor 58 30 Hallmark (90%) Very frequent (99-80%)
HP:0000980
3 microcytic anemia 58 30 Hallmark (90%) Very frequent (99-80%)
HP:0001935
4 abnormal hemoglobin 58 30 Hallmark (90%) Very frequent (99-80%)
HP:0011902
5 muscle weakness 58 30 Frequent (33%) Frequent (79-30%)
HP:0001324
6 respiratory insufficiency 58 30 Frequent (33%) Frequent (79-30%)
HP:0002093
7 hepatomegaly 58 30 Frequent (33%) Frequent (79-30%)
HP:0002240
8 reduced bone mineral density 58 30 Frequent (33%) Frequent (79-30%)
HP:0004349
9 irritability 58 30 Frequent (33%) Frequent (79-30%)
HP:0000737
10 abnormal skull morphology 58 30 Frequent (33%) Frequent (79-30%)
HP:0000929
11 abnormality of temperature regulation 58 30 Frequent (33%) Frequent (79-30%)
HP:0004370
12 abnormality of iron homeostasis 58 30 Frequent (33%) Frequent (79-30%)
HP:0011031
13 hypogonadotropic hypogonadism 30 Frequent (33%) HP:0000044
14 hepatitis 58 30 Occasional (7.5%) Occasional (29-5%)
HP:0012115
15 cholelithiasis 58 30 Occasional (7.5%) Occasional (29-5%)
HP:0001081
16 hypertrophic cardiomyopathy 58 30 Occasional (7.5%) Occasional (29-5%)
HP:0001639
17 thrombocytopenia 58 30 Occasional (7.5%) Occasional (29-5%)
HP:0001873
18 venous thrombosis 58 30 Occasional (7.5%) Occasional (29-5%)
HP:0004936
19 skin ulcer 58 30 Occasional (7.5%) Occasional (29-5%)
HP:0200042
20 anemia 58 Very frequent (99-80%)
21 abnormality of the skeletal system 58 Very frequent (99-80%)
22 hypogonadotrophic hypogonadism 58 Frequent (79-30%)
23 hypochromic microcytic anemia 30 HP:0004840
24 reduced beta/alpha synthesis ratio 30 HP:0011906

Clinical features from OMIM®:

613985 (Updated 08-Dec-2022)

GenomeRNAi Phenotypes related to Beta-Thalassemia according to GeneCards Suite gene sharing:

25
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Increased shRNA abundance GR00327-A 8.92 EPO G6PD HBD HBG2

MGI Mouse Phenotypes related to Beta-Thalassemia:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 liver/biliary system MP:0005370 9.76 EPO GATA1 HBB HBD HFE KLF1
2 immune system MP:0005387 9.73 AHSP CHIT1 EPO G6PD GATA1 HBB
3 hematopoietic system MP:0005397 9.44 AHSP EPO G6PD GATA1 HBA2 HBB

Drugs & Therapeutics for Beta-Thalassemia

Drugs for Beta-Thalassemia (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 193)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Metformin Approved Phase 4 1115-70-4, 657-24-9 4091
2
Peginterferon alfa-2b Approved Phase 4 215647-85-1, 99210-65-8
3
Peginterferon alfa-2a Approved, Investigational Phase 4 198153-51-4
4
Ribavirin Approved Phase 4 36791-04-5 37542
5
Deferiprone Approved Phase 4 30652-11-0 2972
6
Zinc cation Approved, Experimental, Investigational Phase 4 7440-66-6, 23713-49-7 32051
7
Ledipasvir Approved Phase 4 1256388-51-8 67505836
8
Sofosbuvir Approved Phase 4 1190307-88-0 45375808
9
Hyaluronic acid Approved, Vet_approved Phase 4 9004-61-9 53477741
10
Zinc sulfate Approved, Investigational Phase 4 7733-02-0
11
Busulfan Approved, Investigational Phase 4 55-98-1 2478
12
Fludarabine Approved Phase 4 75607-67-9, 21679-14-1 30751 657237
13
Mycophenolic acid Approved, Investigational Phase 4 24280-93-1 446541
14
Tacrolimus Approved, Investigational Phase 4 104987-11-3 6473866 445643
15
Sodium citrate Approved, Investigational Phase 4 68-04-2 23431961
16
Sildenafil Approved, Investigational Phase 4 139755-83-2, 171599-83-0 5212 135398744
17
Luspatercept Approved, Investigational Phase 4 1373715-00-4
18
Basiliximab Approved, Investigational Phase 4 179045-86-4
19
Levoleucovorin Approved, Experimental, Investigational Phase 4 68538-85-2, 58-05-9, 73951-54-9 149436 6006
20
Methotrexate Approved Phase 4 1959-05-2, 59-05-2 4112 126941
21
Citric acid Approved, Nutraceutical, Vet_approved Phase 4 77-92-9 311
22
Arginine Approved, Investigational, Nutraceutical Phase 4 74-79-3 6322
23
Folic acid Approved, Nutraceutical, Vet_approved Phase 4 59-30-3 6037
24 Anti-Infective Agents Phase 4
25 Immunologic Factors Phase 4
26 Antiviral Agents Phase 4
27 Interferon alpha-2 Phase 4
28 interferons Phase 4
29 Interferon-alpha Phase 4
30 Interferon-alfa-1b Phase 4
31 Liver Extracts Phase 4
32 Ledipasvir, sofosbuvir drug combination Phase 4
33 Vaccines Phase 4
34 Trace Elements Phase 4
35 Micronutrients Phase 4
36 Heptavalent Pneumococcal Conjugate Vaccine Phase 4
37 Immunoglobulins, Intravenous Phase 4
38 Immunoglobulins Phase 4
39 Calcineurin Inhibitors Phase 4
40 Antimetabolites Phase 4
41 Thymoglobulin Phase 4
42 Antitubercular Agents Phase 4
43 Antibodies Phase 4
44 Phosphodiesterase Inhibitors Phase 4
45 Phosphodiesterase 5 Inhibitors Phase 4
46 Vasodilator Agents Phase 4
47 Citrate Phase 4
48 Hematinics Phase 4
49 Immunoglobulin Fc Fragments Phase 4
50 Dermatologic Agents Phase 4

Interventional clinical trials:

(show top 50) (show all 237)
# Name Status NCT ID Phase Drugs
1 The Potential Hepatoprotective Effect of Metformin in Patients With Beta Thalasemia Major Unknown status NCT02984475 Phase 4 Metformin
2 Efficacy of Basiliximab in the Prevention of Acute Graft-versus-host Disease in Unrelated Allogeneic Hematopoietic Stem Cell Transplantation Therapy for Thalassemia Major Treatment: a Multi-center, Open, Randomized, Controlled Clinical Study Unknown status NCT02342145 Phase 4 Basiliximab,;cyclosporine A;Methotrexate;Mycophenolate mofetil
3 A Randomized, Placebo Controlled, Double Blind Trial of the Effect of Combined Therapy With Deferoxamine and Deferiprone on Myocardial Iron in Thalassemia Major Using Cardiovascular Magnetic Resonance Unknown status NCT00103753 Phase 4 deferiprone
4 Study of the B Memory Cell Response to Vaccination With the 13-valent Pneumococcal Conjugate Vaccine in Asplenic Individuals With Beta-thalassemia Major Unknown status NCT01846923 Phase 4
5 Haploidentical Hematopoietic Stem Cell Transplantation for Patients With Thalassemia Major Unknown status NCT03171831 Phase 4 Busulfan;Cyclophosphamide;Fludarabine;Mycophenolate mofetil;Tacrolimus;Methotrexate;Thymoglobulin;Basiliximab
6 The Effect of Vitamin D Supplementation on Calcium Excretion in Thalassemia: a Dose Response Study Unknown status NCT01323608 Phase 4 Vitamin D3;Placebo
7 Investigation of Signal Pathway Induced by Colla Corri Asini Regulating Globin Level in Beta Thalassemia Patients With Pregnancy Anemia Unknown status NCT03392298 Phase 4 Colla corii asini
8 Phase IV Study of Effectiveness of Interferon and Ribavirin Treatment in Thalassemia Major Patients With Chronic Viral Hepatitis C Unknown status NCT00887081 Phase 4 PEG-IFN alpha2a or PEG-IFN alpha2b and Ribavirin
9 Phase IV Study of the Use of Sequential DFP-DFO Versus DFP in Thalassemia Major Patients Completed NCT00733811 Phase 4 Deferiprone (DFP) and Deferoxamine (DFO);Deferiprone (DFP)
10 Evaluating the Efficacy of Deferasirox in Transfusion Dependent Chronic Anaemias (Myelodysplastic Syndrome, Beta-thalassaemia Patients) With Chronic Iron Overload Completed NCT00564941 Phase 4 deferasirox
11 1-year Extension to CICL670A2402 an Open-label, Multi-center Trial of the Efficacy and Safety of Long-term Treatment With Deferasirox (10 to 20 mg/kg/Day) in Beta-thalassemia Patients With Transfusional Hemosiderosis (Study Amended to 2- Year Duration) Completed NCT00171301 Phase 4 Deferasirox
12 A Phase II, Multi-center, Single-arm, Prospective Study to Evaluate the Safety and Efficacy of Deferasirox in Beta-thalassemia Major Patients After Hematopoietic Stem Cell Transplantation. Completed NCT01610297 Phase 4 ICL670
13 Safety and Efficacy of Early-start Deferiprone Treatment in Infants and Young Children Newly Diagnosed With Transfusion-dependent Beta Thalassemia Completed NCT03591575 Phase 4 Deferiprone oral solution;Placebo
14 Evaluation of Liver Fibrosis by Serum Hyalornic Acid Measurement in β-Thalassemic Children Infected With Hepatitis C Virus Before and After Direct-Acting Antiviral Therapy Completed NCT03961828 Phase 4 Ledipasvir 90 MG / Sofosbuvir 400 MG [Harvoni]
15 Pilot Pharmacokinetic Study In Patients With Inadequate Response To Deferasirox (Exjade) Completed NCT00749515 Phase 4 Deferoxamine;Deferasirox
16 Increased Survival and Reversion of Iron-Induced Cardiac Disease in Patients With Thalassemia Major Receiving Intensive Combined Chelation Therapy Completed NCT00800761 Phase 4 Deferoxamine and Deferiprone;Deferoxamine
17 Pneumococcal Vaccination for Splenectomised Thalassemia Major Patients in Indonesia Completed NCT03095326 Phase 4 Sucrose
18 Randomized Trial Comparing the Relative Efficacy of Deferiprone to That of Deferoxamine in Removing Excess Cardiac Iron in Thalassemia Major Patients Completed NCT00105495 Phase 4 Ferriprox (deferiprone);Desferal (deferoxamine)
19 Zinc Supplementation on Cellular Immunity in Thalassemia Major Completed NCT03117192 Phase 4 Zinc Sulfate;Sucrose Syrup
20 Prospective Crossover Study on Beta(ß)-Thalassaemia Transfusion-dependent to Evaluate the Impact on Transfusion Regimen of Two Pre-storage Leukoreduced PRBCs(In-line Filtration + B-C Separation; Whole Blood Filtration + B-C Conservation) Completed NCT03992001 Phase 4
21 Comparative Clinical Study Evaluating the Effect of L-arginine Versus Sildenafil in Children With Beta Thalassemia Associated With Pulmonary Hypertension Recruiting NCT03402191 Phase 4 L-arginine;Sildenafil
22 Hematopoietic Stem Cell Transplantation for Patients With Thalassemia Major: A Multicenter, Prospective Clinical Study Recruiting NCT04009525 Phase 4 Busulfan;Cyclophosphamide;Fludarabine;Thymoglobulin;cyclosporine A;Mycophenolate mofetil;Tacrolimus;Methotrexate;Basiliximab;Ruxolitinib
23 The Safety and Efficiency of Luspatercept in Chinese Adults With Transfusion Dependent β-thalassemia: a Real-world Study Recruiting NCT05462548 Phase 4 Luspatercept Injectable Product
24 An Open Label Study to Evaluate the Pharmacokinetics, Safety, Tolerability and Efficacy of Deferasirox Administered to Chinese Patients With β-thalassemia Major Aged From 2 to Less Than 6 Years Old Withdrawn NCT01724138 Phase 4 Deferasirox
25 Efficacy and Safety Study of Sugammadex in Children 0-2 Years Old Unknown status NCT03728543 Phase 2, Phase 3 Sugammadex
26 Pharmacokinetics of Sofosbuvir and Ledipasvir in Hepatitis C Virus - Infected Adolescent Patients With Haematological Disorders Unknown status NCT04353986 Phase 3 Sofosbuvir and Ledipasvir
27 Zoledronic Acid for the Prevention of Bone Loss Post-bone Marrow Transplantation for Thalassemia Major Patients: A Prospective Pilot Study Unknown status NCT01016093 Phase 2, Phase 3 Zoledronic acid;Placebo
28 Combined Therapy of Silymarin and Desferrioxamine in Patients With B-thalassemia Major: a Randomized Double-blind Clinical Trial Unknown status NCT00999349 Phase 2, Phase 3 Silymarin (LEGALON);Placebo
29 A Prospective Randomized Comparative Study of Efficacy and Safety of Combined Deferiprone (DFP) and Deferasirox Versus DFP and Desferrioxamine (DFO) Therapy in Diseases With Severe Iron Overload Unknown status NCT01511848 Phase 2, Phase 3 DFP (ferriprox) and deferasirox (ICL 670);DFP, DFO
30 A Decisional Algorithm to Start Iron Chelation in Minimally Transfused Young Beta-thalassemia Major Patients Naive to Iron Chelation Therapy. A Comparative Randomized Prospective Study Unknown status NCT02173951 Phase 2, Phase 3 Deferiprone
31 Study of Safty and Efficacy of Adjuvant Vitamin c in Augmenting Iron Chelation Unknown status NCT02083575 Phase 2, Phase 3 Vitamin C, Defriprone, deferisarox;deferiprone , deferesarox
32 Phase 2 Study of Therapeutic Effect and Safety of Combined Hydroxyurea With Recombinant Human Erythropoietin. Unknown status NCT01624038 Phase 2, Phase 3 Hydroxyurea ,Epiao;hydroxyurea, blood transfusion
33 Effect of Zinc Supplementation on Glucose Homeostasis in Patients With β-Thalassemia Major Complicated With Diabetes Mellitus Completed NCT03851055 Phase 3 Zinc
34 A Phase 3, Double-Blind, Placebo Controlled Multicenter Study to Determine the Efficacy and Safety of Luspatercept (ACE-536) in Adults With Transfusion Dependent Beta (B)-Thalassemia Completed NCT02604433 Phase 3 Luspatercept
35 A Study of Efficacy and Safety of Long-term Treatment With Deferasirox in Patients With Beta-thalassemia and Transfusional Hemosiderosis Completed NCT00171171 Phase 3 deferasirox
36 A Randomized, Comparative, Open Label Phase III Trial on Efficacy & Safety of Long-term Treatment With ICL670 Compared to Deferoxamine in Beta-thalassemia Patients With Transfusional Hemosiderosis Completed NCT00061750 Phase 3 ICL670;deferoxamine
37 A Phase 3 Single Arm Study Evaluating the Efficacy and Safety of Gene Therapy in Subjects With Transfusion-dependent β-Thalassemia, Who do Not Have a β0/β0 Genotype, by Transplantation of Autologous CD34+ Stem Cells Transduced Ex Vivo With a Lentiviral βA-T87Q-Globin Vector in Subjects ≤50 Years of Age Completed NCT02906202 Phase 3
38 Impact of Combination Therapy Between Hydroxy Urea, Omega 3, Nigella Sativa and Honey on Antioxidant-oxidant Status and Reduction of Iron Overload in Pediatric Major Thalassemia Completed NCT04292314 Phase 2, Phase 3 Omega 3;Nigella Sativa Oil;Hydroxyurea;Honey;Deferoxamine
39 An Extension Study of Iron Chelation Therapy With Deferasirox (ICL670)in β-thalassemia Patients With Transfusional Iron Overload Completed NCT00171210 Phase 3 Deferasirox
40 Amlodipine Use in the Prevention and Treatment of Iron Overload in Patients With Thalassemia Major Completed NCT01125254 Phase 2, Phase 3 Amlodipine
41 Efficacy and Safety of Combination of Hydroxyurea and Low-dose Thalidomide on Hemoglobin Synthesis in Thalassemia Patients Completed NCT05132270 Phase 2, Phase 3 hydroxyurea and thalidomide
42 Amlodipine in the Prevention and Treatment of Iron Overload in Patients With Thalassemia Major: a Randomized, Controlled Trial Completed NCT01395199 Phase 3 Amlodipine
43 A Randomized Controlled Study to Evaluate Efficacy and Safety of S 303 Treated Red Blood Cells (RBC) in Subjects With Thalassemia Major Requiring Chronic RBC Transfusion Completed NCT01740531 Phase 3
44 Clinical Study to Evaluate the Possible Efficacy and Safety of L- Carnitine and Sildenafil in Children Having Beta Thalassemia With Increased Tricuspid Regurgitant Jet Velocity Recruiting NCT05584956 Phase 3 L_carnitine;Sildenafil
45 A Phase 3, Double-Blind, Randomized, Placebo-Controlled, Multicenter Study Evaluating the Efficacy and Safety of Mitapivat in Subjects With Transfusion-Dependent Alpha- or Beta-Thalassemia (ENERGIZE-T) Recruiting NCT04770779 Phase 3 Placebo Matching Mitapivat;Mitapivat
46 A Phase 3, Double-Blind, Randomized, Placebo-Controlled, Multicenter Study Evaluating the Efficacy and Safety of Mitapivat in Subjects With Non-Transfusion-Dependent Alpha- or Beta-Thalassemia (ENERGIZE) Recruiting NCT04770753 Phase 3 Placebo Matching Mitapivat;Mitapivat
47 A Phase 3b, Open-label, Single-arm, Rollover Study to Evaluate Long-term Safety in Subjects Who Have Participated in Other Luspatercept (ACE-536) Clinical Trials Recruiting NCT04064060 Phase 3 Luspatercept
48 A Phase 3 Study to Evaluate the Safety and Efficacy of a Single Dose of CTX001 in Pediatric Subjects With Transfusion-Dependent β-Thalassemia Recruiting NCT05356195 Phase 3
49 A Phase 3b Study to Evaluate Efficacy and Safety of a Single Dose of Autologous CRISPR Cas9 Modified CD34+ Human Hematopoietic Stem and Progenitor Cells (CTX001) in Subjects With Transfusion-Dependent β-Thalassemia or Severe Sickle Cell Disease Recruiting NCT05477563 Phase 3
50 A Phase 3 Single Arm Study Evaluating the Efficacy and Safety of Gene Therapy in Subjects With Transfusion-dependent β-Thalassemia by Transplantation of Autologous CD34+ Stem Cells Transduced Ex Vivo With a Lentiviral βA-T87Q-Globin Vector in Subjects ≤50 Years of Age Active, not recruiting NCT03207009 Phase 3

Search NIH Clinical Center for Beta-Thalassemia

Inferred drug relations via UMLS 71 / NDF-RT 50 :


Sodium phenylbutyrate

Cochrane evidence based reviews: beta-thalassemia

Genetic Tests for Beta-Thalassemia

Genetic tests related to Beta-Thalassemia:

# Genetic test Affiliating Genes
1 Beta Thalassemia 28 HBB HBB-LCR
2 Beta Thalassemia Intermedia 28

Anatomical Context for Beta-Thalassemia

Organs/tissues related to Beta-Thalassemia:

MalaCards : Liver, Spleen, Bone, Heart, Skin, Bone Marrow, Whole Blood

Publications for Beta-Thalassemia

Articles related to Beta-Thalassemia:

(show top 50) (show all 9647)
# Title Authors PMID Year
1
Interaction of malaria with a common form of severe thalassemia in an Asian population. 62 57 5
19841268 2009
2
A new TATA box mutation detected at prenatal diagnosis for beta-thalassemia. 62 57 5
2741940 1989
3
A genetic score for the prediction of beta-thalassemia severity. 62 24 5
25480500 2015
4
Global epidemiology of haemoglobin disorders and derived service indicators. 57 5
18568278 2008
5
Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia. 62 24 57
18245381 2008
6
CRISPR-Cas9 Gene Editing for Sickle Cell Disease and β-Thalassemia. 24 57
33283989 2021
7
A Phase 3 Trial of Luspatercept in Patients with Transfusion-Dependent β-Thalassemia. 24 57
32212518 2020
8
Gene Therapy in Patients with Transfusion-Dependent β-Thalassemia. 24 57
29669226 2018
9
Beta-thalassemia. 53 62 57
20098328 2010
10
The molecular basis of beta-thalassemia intermedia in southern China: genotypic heterogeneity and phenotypic diversity. 53 62 5
20181291 2010
11
Hemoglobinopathies in North Africa: a review. 53 62 5
20113284 2010
12
Comparison of the mismatch-specific endonuclease method and denaturing high-performance liquid chromatography for the identification of HBB gene mutations. 53 62 5
18694524 2008
13
The molecular heterogeneity of beta-thalassemia in Greece. 53 62 5
18096416 2008
14
A family with multiple mutations and sequence variations in the alpha- and beta-globin gene clusters. 53 62 5
18076350 2008
15
A novel silent beta-thalassemia mutation in the distal CACCC box affects the binding and responsiveness to EKLF. 53 62 5
15352994 2004
16
Rapid detection of beta-globin gene (HBB) mutations coupling heteroduplex and primer-extension analysis by DHPLC. 53 62 5
12955718 2003
17
The beta+-IVS-I-6 (T-->C) mutation accounts for half of the thalassemia chromosomes in the Palestinian populations of the mountain regions. 53 62 5
11939510 2002
18
Haplotype analysis of the Mexican frameshift Cd 11 (-T) and -28 A->C beta-thalassemia alleles. 53 62 5
8619407 1996
19
Molecular characterization of beta-thalassemia intermedia in patients of Italian descent and identification of three novel beta-thalassemia mutations. 53 62 5
2001456 1991
20
The Spectrum of Beta-Thalassemia Mutations in Syrian Refugees and Turkish Citizens. 62 5
34258108 2021
21
Molecular characteristics of thalassemia and hemoglobin variants in prenatal diagnosis program in northern Thailand. 62 5
31240559 2019
22
Borderline hemoglobin A2 levels in northern Thai population: HBB genotypes and effects of coinherited alpha-thalassemia. 62 5
30309760 2019
23
Prevalence of hemoglobin variants and hemoglobinopathies using cation-exchange high-performance liquid chromatography in central reference laboratory of India: A report of 65779 cases. 62 5
29403210 2018
24
Genotype-phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis. 62 5
29695942 2018
25
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. 62 5
28603845 2017
26
Clinical and biological specificity of beta-thalassemia intermedia: a case report. 62 5
27848919 2016
27
Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East. 62 5
27453201 2016
28
The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population. 62 5
27263053 2016
29
Novel Βeta (β)-Thalassemia Mutation in Turkish Children. 62 5
25825561 2015
30
Very mild forms of Hb S/beta(+)-thalassemia in Brazilian children. 62 5
26041423 2015
31
Tetra-Primer ARMS PCR Optimization for Detection of IVS-II-I (G-A) and FSC 8/9 InsG Mutations in β-Thalassemia Major Patients in Isfahan Population. 62 5
25905082 2015
32
Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology. 62 5
24880717 2014
33
Hemoglobin Constant Spring is markedly high in women of an ethnic minority group in Vietnam: a community-based survey and hematologic features. 62 5
24368026 2014
34
Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah. 62 5
24369358 2014
35
Clinical and molecular characterization of Hb Hofu in eastern India. 62 5
23889802 2014
36
Molecular epidemiological characterization and health burden of thalassemia in Jiangxi Province, P. R. China. 62 5
25000193 2014
37
Frequency of beta-thalassemia or beta-hemoglobinopathy carriers simultaneously affected with alpha-thalassemia in Iran. 62 5
25016698 2014
38
Coexistence of two β-globin gene deletions in a Chinese girl with β-thalassemia minor. 62 5
24200214 2014
39
Spectrum of Beta Globin Gene Mutations in Egyptian Children with β-Thalassemia. 62 5
25408857 2014
40
Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study. 62 5
25525381 2014
41
β-Thalassemia major resulting from compound heterozygosity for HBB: c.92+2T>C [formerly known as IVS-I-2 (T>C)] and a novel β(0)-thalassemia frameshift mutation: HBB: c.209delG; p.Gly70Valfs*20. 62 5
24986053 2014
42
Genotyping of beta thalassemia trait by high-resolution DNA melting analysis. 62 5
24450243 2013
43
Clinical characteristics of pediatric thalassemia in Korea: a single institute experience. 62 5
24265529 2013
44
Association between clinical expression and molecular heterogeneity in β-thalassemia Tunisian patients. 62 5
24065537 2013
45
Hereditary hemolytic anemia in Korea from 2007 to 2011: A study by the Korean Hereditary Hemolytic Anemia Working Party of the Korean Society of Hematology. 62 5
24086942 2013
46
Mosaic segmental uniparental isodisomy and progressive clonal selection: a common mechanism of late onset β-thalassemia major. 62 5
22983591 2013
47
The spectrum of β-thalassemia mutations in Gaza Strip, Palestine. 62 5
23321370 2013
48
β Thalassemia major due to acquired uniparental disomy in a previously healthy adolescent. 62 5
22875618 2013
49
Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China. 62 5
23383304 2013
50
Molecular study and genotype/phenotype correlation of β Thalassemia in Malaysia. 62 5
22335963 2012

Variations for Beta-Thalassemia

ClinVar genetic disease variations for Beta-Thalassemia:

5 (show top 50) (show all 390)
# Gene Name Type Significance ClinVarId dbSNP ID Position
1 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.383_385del (p.Gln128_Ala129delinsPro) DEL Pathogenic
15410 rs34502690 GRCh37: 11:5246887-5246889
GRCh38: 11:5225657-5225659
2 LOC106099062, HBB, LOC107133510 NM_000518.4(HBB):c.182T>A (p.Val61Glu) SNV Pathogenic
15411 rs33931779 GRCh37: 11:5247940-5247940
GRCh38: 11:5226710-5226710
3 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.*112A>G SNV Pathogenic
15476 rs63750954 GRCh37: 11:5246716-5246716
GRCh38: 11:5225486-5225486
4 LOC110006319, HBB, LOC107133510 NM_000518.4(HBB):c.320T>G (p.Leu107Arg) SNV Pathogenic
15487 rs33941844 GRCh37: 11:5246952-5246952
GRCh38: 11:5225722-5225722
5 HBB, LOC106099062, LOC107133510 NG_000007.3:g.70444C>G SNV Pathogenic
15586 GRCh37: 11:5248402-5248402
GRCh38: 11:5227172-5227172
6 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.*110T>A SNV Pathogenic
15616 rs33978907 GRCh37: 11:5246718-5246718
GRCh38: 11:5225488-5225488
7 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.*116del DEL Pathogenic
15474 GRCh37: 11:5246712-5246712
GRCh38: 11:5225482-5225482
8 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.*110_*111insG INSERT Pathogenic
15475 GRCh37: 11:5246717-5246718
GRCh38: 11:5225487-5225488
9 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.316-8T>G SNV Pathogenic
Pathogenic
15453 rs34793594 GRCh37: 11:5246964-5246964
GRCh38: 11:5225734-5225734
10 HBB, LOC106099062, LOC107133510 NM_000518.5(HBB):c.-142C>T SNV Pathogenic
Pathogenic
Not Provided
15462 rs34883338 GRCh37: 11:5248393-5248393
GRCh38: 11:5227163-5227163
11 HBB, LOC106099062, LOC107133510 NM_000518.5(HBB):c.-138C>A SNV Pathogenic
Pathogenic
Likely Pathogenic
393701 rs33944208 GRCh37: 11:5248389-5248389
GRCh38: 11:5227159-5227159
12 HBB, LOC106099062, LOC107133510 NC_000011.10:g.5227101A>G SNV Pathogenic
Pathogenic
869290 rs33980857 GRCh37: 11:5248331-5248331
GRCh38: 11:5227101-5227101
13 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.*113A>G SNV Pathogenic
Pathogenic/Likely Pathogenic
15473 rs33985472 GRCh37: 11:5246715-5246715
GRCh38: 11:5225485-5225485
14 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.*111A>G SNV Pathogenic
Likely Pathogenic
15488 rs63751128 GRCh37: 11:5246717-5246717
GRCh38: 11:5225487-5225487
15 HBB, LOC106099062, LOC107133510 NM_000518.5(HBB):c.-82C>A SNV Pathogenic
Pathogenic
15492 rs34500389 GRCh37: 11:5248333-5248333
GRCh38: 11:5227103-5227103
16 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.*110_*114del DEL Pathogenic
Pathogenic
15506 rs35949130 GRCh37: 11:5246714-5246718
GRCh38: 11:5225484-5225488
17 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.344T>C (p.Leu115Pro) SNV Pathogenic
Pathogenic
15513 rs36015961 GRCh37: 11:5246928-5246928
GRCh38: 11:5225698-5225698
18 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.117_118del (p.Gln40fs) DEL Pathogenic
15551 rs267607291 GRCh37: 11:5248004-5248005
GRCh38: 11:5226774-5226775
19 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.316-2A>C SNV Pathogenic
21190 rs33914668 GRCh37: 11:5246958-5246958
GRCh38: 11:5225728-5225728
20 HBB NC_000011.10:g.5216940_5229551del DEL Pathogenic
869213 GRCh37:
GRCh38:
21 overlap with 3 genes NC_000011.10:g.5218346_5226066del DEL Pathogenic
869214 GRCh37: 11:5239576-5247296
GRCh38: 11:5218346-5226066
22 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.170_171insGCAACCCTAAGGTG (p.Gly57_Asn58insGlnProTer) INSERT Pathogenic
869222 rs1847560327 GRCh37: 11:5247951-5247952
GRCh38: 11:5226721-5226722
23 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.176dup (p.Pro59_Lys60insTer) DUP Pathogenic
869223 rs35395625 GRCh37: 11:5247945-5247946
GRCh38: 11:5226715-5226716
24 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.178A>T (p.Lys60Ter) SNV Pathogenic
869224 rs33969400 GRCh37: 11:5247944-5247944
GRCh38: 11:5226714-5226714
25 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.179del (p.Lys60fs) DEL Pathogenic
869225 rs267607293 GRCh37: 11:5247943-5247943
GRCh38: 11:5226713-5226713
26 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.18_19del (p.Glu7fs) DEL Pathogenic
869226 rs281864519 GRCh37: 11:5248233-5248234
GRCh38: 11:5227003-5227004
27 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.184A>T (p.Lys62Ter) SNV Pathogenic
15407 rs33995148 GRCh37: 11:5247938-5247938
GRCh38: 11:5226708-5226708
28 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.187_251dup (p.Thr85fs) DUP Pathogenic
869227 rs1847554565 GRCh37: 11:5247870-5247871
GRCh38: 11:5226640-5226641
29 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.189_195del (p.His64fs) DEL Pathogenic
869228 rs1847558511 GRCh37: 11:5247927-5247933
GRCh38: 11:5226697-5226703
30 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.199A>T (p.Lys67Ter) SNV Pathogenic
869229 rs34165323 GRCh37: 11:5247923-5247923
GRCh38: 11:5226693-5226693
31 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.19G>T (p.Glu7Ter) SNV Pathogenic
869230 rs33930165 GRCh37: 11:5248233-5248233
GRCh38: 11:5227003-5227003
32 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.20_32del (p.Glu7fs) DEL Pathogenic
869232 rs1847586938 GRCh37: 11:5248220-5248232
GRCh38: 11:5226990-5227002
33 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.22G>T (p.Glu8Ter) SNV Pathogenic
869271 rs34948328 GRCh37: 11:5248230-5248230
GRCh38: 11:5227000-5227000
34 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.232del (p.His78fs) DEL Pathogenic
869272 rs63750504 GRCh37: 11:5247890-5247890
GRCh38: 11:5226660-5226660
35 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.235dup (p.Leu79fs) DUP Pathogenic
869273 rs281865475 GRCh37: 11:5247886-5247887
GRCh38: 11:5226656-5226657
36 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.237_256del (p.Asp80fs) DEL Pathogenic
869274 rs1847554171 GRCh37: 11:5247866-5247885
GRCh38: 11:5226636-5226655
37 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.244_265del (p.Asn81_Leu82insTer) DEL Pathogenic
869275 rs1847553585 GRCh37: 11:5247857-5247878
GRCh38: 11:5226627-5226648
38 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.316-3C>G SNV Pathogenic
619687 rs33913413 GRCh37: 11:5246959-5246959
GRCh38: 11:5225729-5225729
39 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.316-98_316-86dup DUP Pathogenic
869277 rs1847534434 GRCh37: 11:5247041-5247042
GRCh38: 11:5225811-5225812
40 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.319C>G (p.Leu107Val) SNV Pathogenic
869278 rs63750596 GRCh37: 11:5246953-5246953
GRCh38: 11:5225723-5225723
41 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.339_345dup (p.Ala116fs) DUP Pathogenic
869279 rs281864527 GRCh37: 11:5246926-5246927
GRCh38: 11:5225696-5225697
42 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.339T>A (p.Cys113Ter) SNV Pathogenic
869280 rs33930977 GRCh37: 11:5246933-5246933
GRCh38: 11:5225703-5225703
43 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.33del (p.Val12fs) DEL Pathogenic
869281 rs1554918214 GRCh37: 11:5248219-5248219
GRCh38: 11:5226989-5226989
44 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.349_350insTGAT (p.His117fs) INSERT Pathogenic
869282 rs63751306 GRCh37: 11:5246922-5246923
GRCh38: 11:5225692-5225693
45 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.354del (p.Phe119fs) DEL Pathogenic
869283 rs281864528 GRCh37: 11:5246918-5246918
GRCh38: 11:5225688-5225688
46 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.375dup (p.Pro126fs) DUP Pathogenic
869284 rs281864544 GRCh37: 11:5246896-5246897
GRCh38: 11:5225666-5225667
47 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.378del (p.Val127fs) DEL Pathogenic
869285 rs34363638 GRCh37: 11:5246894-5246894
GRCh38: 11:5225664-5225664
48 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.93-17_93-1del DEL Pathogenic
15441 rs1554918032 GRCh37: 11:5248030-5248046
GRCh38: 11:5226800-5226816
49 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.93-2A>C SNV Pathogenic
439167 rs63750513 GRCh37: 11:5248031-5248031
GRCh38: 11:5226801-5226801
50 HBB, LOC106099062, LOC107133510 NC_000011.10:g.5227097T>G SNV Pathogenic
869286 rs281864525 GRCh37: 11:5248327-5248327
GRCh38: 11:5227097-5227097

UniProtKB/Swiss-Prot genetic disease variations for Beta-Thalassemia:

73
# Symbol AA change Variation ID SNP ID
1 HBB p.Glu27Lys VAR_002907 rs33950507
2 HBB p.Ala116Asp VAR_003037 rs35485099
3 HBB p.Val127Gly VAR_003056 rs33925391
4 HBB p.Leu115Pro VAR_010145 rs36015961

Expression for Beta-Thalassemia

Search GEO for disease gene expression data for Beta-Thalassemia.

Pathways for Beta-Thalassemia

GO Terms for Beta-Thalassemia

Cellular components related to Beta-Thalassemia according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 blood microparticle GO:0072562 10.03 TFRC TF HBG2 HBD HBB HBA2
2 HFE-transferrin receptor complex GO:1990712 9.76 TFRC TFR2 TF HFE
3 haptoglobin-hemoglobin complex GO:0031838 9.65 HBA2 HBB HBD HBG1 HBG2
4 hemoglobin complex GO:0005833 9.4 HBG2 HBG1 HBD HBB HBA2 AHSP

Biological processes related to Beta-Thalassemia according to GeneCards Suite gene sharing:

(show all 18)
# Name GO ID Score Top Affiliating Genes
1 cellular iron ion homeostasis GO:0006879 10.03 TFRC TFR2 TF HFE
2 cellular oxidant detoxification GO:0098869 10.02 HBG2 HBG1 HBD HBB HBA2
3 iron ion homeostasis GO:0055072 10.01 TFR2 TF HFE
4 erythrocyte differentiation GO:0030218 10.01 AHSP EPO GATA1 KLF1
5 acute-phase response GO:0006953 9.99 EPO TFR2 TFRC
6 positive regulation of cell death GO:0010942 9.96 HBG2 HBG1 HBD HBB HBA2
7 iron ion transport GO:0006826 9.95 TFRC TFR2 TF
8 response to iron ion GO:0010039 9.93 TFRC TFR2 HFE
9 positive regulation of peptide hormone secretion GO:0090277 9.88 TFR2 HFE
10 transferrin transport GO:0033572 9.87 TFRC TFR2
11 myeloid cell apoptotic process GO:0033028 9.85 GATA1 EPO
12 cellular response to iron ion GO:0071281 9.85 TFR2 TF HFE
13 hydrogen peroxide catabolic process GO:0042744 9.85 HBA2 HBB HBD HBG1 HBG2
14 nitric oxide transport GO:0030185 9.83 HBB HBA2
15 regulation of iron ion transport GO:0034756 9.8 TF HFE
16 negative regulation of myeloid cell apoptotic process GO:0033033 9.73 GATA1 EPO
17 oxygen transport GO:0015671 9.65 HBG2 HBG1 HBD HBB HBA2
18 carbon dioxide transport GO:0015670 9.32 HBG2 HBG1 HBD HBB HBA2

Molecular functions related to Beta-Thalassemia according to GeneCards Suite gene sharing:

(show all 11)
# Name GO ID Score Top Affiliating Genes
1 heme binding GO:0020037 10.1 HBA2 HBB HBD HBG1 HBG2
2 peroxidase activity GO:0004601 10.07 HBG2 HBG1 HBD HBB HBA2
3 oxygen binding GO:0019825 10.02 HBA2 HBB HBD HBG1 HBG2
4 hemoglobin alpha binding GO:0031721 9.86 HBG2 HBG1 HBD HBB
5 oxygen carrier activity GO:0005344 9.85 HBA2 HBB HBD HBG1 HBG2
6 co-receptor binding GO:0039706 9.8 TFR2 HFE
7 transferrin receptor binding GO:1990459 9.78 TF HFE
8 hemoglobin binding GO:0030492 9.76 HBB AHSP
9 transferrin receptor activity GO:0004998 9.73 TFRC TFR2
10 organic acid binding GO:0043177 9.65 HBG2 HBG1 HBD HBB HBA2
11 haptoglobin binding GO:0031720 9.32 HBG2 HBG1 HBD HBB HBA2

Sources for Beta-Thalassemia

2 CDC
6 CNVD
8 Cosmic
9 dbSNP
10 DGIdb
16 EFO
17 ExPASy
18 FMA
19 GARD
27 GO
28 GTR
29 HMDB
30 HPO
31 ICD10
32 ICD10 via Orphanet
33 ICD11
34 ICD9CM
35 IUPHAR
36 LifeMap
38 LOVD
40 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
52 NINDS
53 Novoseek
55 ODiseA
56 OMIM via Orphanet
57 OMIM® (Updated 08-Dec-2022)
61 PubChem
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....