MCID: BTT017
MIFTS: 53

Beta-Thalassemia Major

Categories: Blood diseases, Genetic diseases

Aliases & Classifications for Beta-Thalassemia Major

Summaries for Beta-Thalassemia Major

CDC : 3 Thalassemia is an inherited (i.e., passed from parents to children through genes) blood disorder caused when the body doesn't make enough of a protein called hemoglobin, an important part of red blood cells. When there isn't enough hemoglobin, the body's red blood cells don't function properly and they last shorter periods of time, so there are fewer healthy red blood cells traveling in the bloodstream. Red blood cells carry oxygen to all the cells of the body. Oxygen is a sort of food that cells use to function. When there are not enough healthy red blood cells, there is also not enough oxygen delivered to all the other cells of the body, which may cause a person to feel tired, weak or short of breath. This is a condition called anemia. People with thalassemia may have mild or severe anemia. Severe anemia can damage organs and lead to death.

MalaCards based summary : Beta-Thalassemia Major, also known as cooley's anemia, is related to thalassemia and beta-thalassemia intermedia. An important gene associated with Beta-Thalassemia Major is HBB (Hemoglobin Subunit Beta), and among its related pathways/superpathways are Transcription_Role of VDR in regulation of genes involved in osteoporosis and Naphthalene metabolism. The drugs Methotrexate and Levoleucovorin have been mentioned in the context of this disorder. Affiliated tissues include bone marrow, spleen and liver, and related phenotypes are pallor and persistence of hemoglobin f

Disease Ontology : 12 A beta thalassemia that is characterized by severe anemia and enlarged liver and spleen before 2 years of age.

Related Diseases for Beta-Thalassemia Major

Diseases related to Beta-Thalassemia Major via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 332)
# Related Disease Score Top Affiliating Genes
1 thalassemia 31.8 LOC110006319 LOC107133510 LOC106099062 HBB-LCR HBB
2 beta-thalassemia intermedia 31.0 LOC110006319 LOC107133510 LOC106099062 HBB
3 sickle cell disease 30.8 LOC110006319 LOC107133510 LOC106099062 HBB
4 hemoglobinopathy 30.8 LOC110006319 LOC107133510 LOC106099062 HFE HBB
5 thalassemia minor 30.8 LOC107133510 LOC106099062 HBB
6 beta-thalassemia 30.4 VDR MTHFR LOC110006319 LOC107133510 LOC106099062 HFE
7 hemolytic anemia 30.3 LOC107133510 LOC106099062 HFE HBB F2
8 bone resorption disease 30.3 VDR COL1A1 BGLAP
9 hemoglobin d disease 30.3 LOC110006319 LOC107133510 HBB
10 thrombophilia 30.2 MTHFR F5 F2
11 portal vein thrombosis 30.2 MTHFR F5 F2
12 protein c deficiency 30.0 MTHFR F5 F2
13 osteoporosis 29.8 VDR TERT MTHFR COL1A1 BGLAP
14 thrombophilia due to activated protein c resistance 29.8 MTHFR F5 F2
15 gaucher's disease 29.8 MTHFR F5 F2 BGLAP
16 polycythemia 29.8 HBB F5 F2
17 homocysteinemia 29.8 MTHFR F5 F2
18 placenta disease 29.8 MTHFR F5 F2
19 sickle cell anemia 29.8 MTHFR LOC110006319 LOC107133510 LOC106099062 HBB F2
20 hemoglobin e disease 29.7 LOC107133510 LOC106099062 HBB F5 F2
21 osteonecrosis 29.7 MTHFR F2 BGLAP
22 alpha-thalassemia 29.6 TERT LOC110006319 LOC107133510 LOC106099062 HFE HBB-LCR
23 deficiency anemia 29.5 LOC107133510 LOC106099062 HFE HBB GSTM1 F5
24 cerebrovascular disease 29.5 MTHFR GSTM1 F5 F2
25 aplastic anemia 29.3 VDR TERT HFE GSTT1 GSTM1
26 diabetes mellitus 28.3 VDR MTHFR HFE HBB GSTM1 F2
27 autosomal dominant beta thalassemia 11.2
28 hemosiderosis 11.0
29 rare hereditary hemochromatosis 11.0
30 hypogonadism 10.7
31 graft-versus-host disease 10.6
32 siderosis 10.6
33 hemochromatosis, type 1 10.6
34 hypothyroidism 10.6
35 acute graft versus host disease 10.6
36 hypogonadotropic hypogonadism 10.5
37 hypoparathyroidism 10.5
38 hepatitis c virus 10.5
39 hepatitis c 10.5
40 bone mineral density quantitative trait locus 8 10.4
41 bone mineral density quantitative trait locus 15 10.4
42 congestive heart failure 10.4
43 pulmonary hypertension 10.3
44 rickets 10.3
45 47,xyy 10.3
46 atrial fibrillation 10.3
47 neutropenia 10.3
48 thrombocytosis 10.3
49 chronic graft versus host disease 10.3
50 amaurosis fugax 10.3 MTHFR F5

Graphical network of the top 20 diseases related to Beta-Thalassemia Major:



Diseases related to Beta-Thalassemia Major

Symptoms & Phenotypes for Beta-Thalassemia Major

Human phenotypes related to Beta-Thalassemia Major:

31 (show all 46)
# Description HPO Frequency HPO Source Accession
1 pallor 31 hallmark (90%) HP:0000980
2 persistence of hemoglobin f 31 hallmark (90%) HP:0011904
3 hypochromic microcytic anemia 31 hallmark (90%) HP:0004840
4 anisopoikilocytosis 31 hallmark (90%) HP:0004823
5 reduced hemoglobin a 31 hallmark (90%) HP:0011905
6 decreased mean corpuscular volume 31 hallmark (90%) HP:0025066
7 decreased mean corpuscular hemoglobin concentration 31 hallmark (90%) HP:0025547
8 splenomegaly 31 frequent (33%) HP:0001744
9 hepatomegaly 31 frequent (33%) HP:0002240
10 abnormality of the dentition 31 frequent (33%) HP:0000164
11 genu valgum 31 frequent (33%) HP:0002857
12 osteoporosis 31 frequent (33%) HP:0000939
13 failure to thrive in infancy 31 frequent (33%) HP:0001531
14 abnormality of iron homeostasis 31 frequent (33%) HP:0011031
15 hypersplenism 31 frequent (33%) HP:0001971
16 dyspnea 31 frequent (33%) HP:0002094
17 feeding difficulties 31 frequent (33%) HP:0011968
18 hypoplasia of the musculature 31 frequent (33%) HP:0009004
19 hyperpigmentation of the skin 31 frequent (33%) HP:0000953
20 extramedullary hematopoiesis 31 frequent (33%) HP:0001978
21 frontal bossing 31 occasional (7.5%) HP:0002007
22 diabetes mellitus 31 occasional (7.5%) HP:0000819
23 hypothyroidism 31 occasional (7.5%) HP:0000821
24 depressed nasal bridge 31 occasional (7.5%) HP:0005280
25 delayed puberty 31 occasional (7.5%) HP:0000823
26 hepatic fibrosis 31 occasional (7.5%) HP:0001395
27 cirrhosis 31 occasional (7.5%) HP:0001394
28 irritability 31 occasional (7.5%) HP:0000737
29 venous thrombosis 31 occasional (7.5%) HP:0004936
30 skin ulcer 31 occasional (7.5%) HP:0200042
31 jaundice 31 occasional (7.5%) HP:0000952
32 dilated cardiomyopathy 31 occasional (7.5%) HP:0001644
33 arthralgia 31 occasional (7.5%) HP:0002829
34 upslanted palpebral fissure 31 occasional (7.5%) HP:0000582
35 hypoparathyroidism 31 occasional (7.5%) HP:0000829
36 diarrhea 31 occasional (7.5%) HP:0002014
37 hepatosplenomegaly 31 occasional (7.5%) HP:0001433
38 recurrent fever 31 occasional (7.5%) HP:0001954
39 malar prominence 31 occasional (7.5%) HP:0010620
40 hypopituitarism 31 occasional (7.5%) HP:0040075
41 chronic infection 31 occasional (7.5%) HP:0031035
42 high-output congestive heart failure 31 occasional (7.5%) HP:0001722
43 hyperplasia of the maxilla 31 occasional (7.5%) HP:0430028
44 arrhythmia 31 very rare (1%) HP:0011675
45 adrenal insufficiency 31 very rare (1%) HP:0000846
46 hepatocellular carcinoma 31 very rare (1%) HP:0001402

Drugs & Therapeutics for Beta-Thalassemia Major

Drugs for Beta-Thalassemia Major (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 105)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Methotrexate Approved Phase 4 1959-05-2, 59-05-2 126941
2
Levoleucovorin Approved, Investigational Phase 4 68538-85-2 149436
3
Clotrimazole Approved, Vet_approved Phase 4 23593-75-1 2812
4
Miconazole Approved, Investigational, Vet_approved Phase 4 22916-47-8 4189
5
Basiliximab Approved, Investigational Phase 4 152923-56-3, 179045-86-4
6
Metformin Approved Phase 4 657-24-9 4091 14219
7
Iron Approved Phase 4 7439-89-6 23925 29936
8
Deferasirox Approved, Investigational Phase 4 201530-41-8 5493381 214348
9
Deferiprone Approved Phase 4 30652-11-0 2972
10
Folic acid Approved, Nutraceutical, Vet_approved Phase 4 59-30-3 6037
11 Vitamin B9 Phase 4
12 Folic Acid Antagonists Phase 4
13 Cyclosporins Phase 4
14 Dermatologic Agents Phase 4
15 Vitamin B Complex Phase 4
16 Folate Phase 4
17 Antifungal Agents Phase 4
18 Hypoglycemic Agents Phase 4
19 Heptavalent Pneumococcal Conjugate Vaccine Phase 4
20 Vaccines Phase 4
21 Chelating Agents Phase 4
22 Iron Chelating Agents Phase 4
23 Pharmaceutical Solutions Phase 4
24
Zinc Approved, Investigational Phase 3 7440-66-6 32051
25
Denosumab Approved Phase 3 615258-40-7
26
Zoledronic Acid Approved Phase 3 118072-93-8 68740
27
Busulfan Approved, Investigational Phase 1, Phase 2 55-98-1 2478
28 N,N'-Bis(2-mercaptoethyl)isophthalamide Phase 2
29
Deferoxamine Approved, Investigational Phase 1 70-51-9 2973
30
Lactitol Approved, Investigational Phase 1 585-86-4 157355
31 Antioxidants Phase 1
32 Protective Agents Phase 1
33 silymarin Phase 1
34
Pentetic acid Approved 67-43-6
35
Edetic Acid Approved, Vet_approved 62-33-9, 60-00-4 6049
36
Tocopherol Approved, Investigational 1406-66-2
37
Hyaluronic acid Approved, Vet_approved 9004-61-9 53477741
38
Amlodipine Approved 88150-42-9 2162
39
Sargramostim Approved, Investigational 123774-72-1, 83869-56-1
40
Lenograstim Approved, Investigational 135968-09-1
41
Hydroxyurea Approved 127-07-1 3657
42
Mycophenolic acid Approved Early Phase 1 24280-93-1 446541
43
Dexamethasone Approved, Investigational, Vet_approved Early Phase 1 50-02-2 5743
44
Fludarabine Approved Early Phase 1 21679-14-1, 75607-67-9 30751
45
Dexamethasone acetate Approved, Investigational, Vet_approved Early Phase 1 1177-87-3
46
Tacrolimus Approved, Investigational Early Phase 1 104987-11-3 6473866 445643 439492
47
Ichthammol Approved Early Phase 1 8029-68-3
48
Cyclophosphamide Approved, Investigational Early Phase 1 50-18-0, 6055-19-2 2907
49
rituximab Approved Early Phase 1 174722-31-7 10201696
50
Bortezomib Approved, Investigational Early Phase 1 179324-69-7 93860 387447

Interventional clinical trials:

(show all 35)
# Name Status NCT ID Phase Drugs
1 Efficacy of Basiliximab in the Prevention of Acute Graft-versus-host Disease in Unrelated Allogeneic Hematopoietic Stem Cell Transplantation Therapy for Thalassemia Major Treatment: a Multi-center, Open, Randomized, Controlled Clinical Study Unknown status NCT02342145 Phase 4 Basiliximab,;cyclosporine A;Methotrexate;Mycophenolate mofetil
2 The Potential Hepatoprotective Effect of Metformin in Patients With Beta Thalasemia Major Unknown status NCT02984475 Phase 4 Metformin
3 Study of the B Memory Cell Response to Vaccination With the 13-valent Pneumococcal Conjugate Vaccine in Asplenic Individuals With Beta-thalassemia Major Unknown status NCT01846923 Phase 4
4 1-year Extension to CICL670A2402 an Open-label, Multi-center Trial of the Efficacy and Safety of Long-term Treatment With Deferasirox (10 to 20 mg/kg/Day) in Beta-thalassemia Patients With Transfusional Hemosiderosis (Study Amended to 2- Year Duration) Completed NCT00171301 Phase 4 Deferasirox
5 Safety and Efficacy of Early-start Deferiprone Treatment in Infants and Young Children Newly Diagnosed With Transfusion-dependent Beta Thalassemia Completed NCT03591575 Phase 4 Deferiprone oral solution;Placebo
6 A Phase II, Multi-center, Single-arm, Prospective Study to Evaluate the Safety and Efficacy of Deferasirox in Beta-thalassemia Major Patients After Hematopoietic Stem Cell Transplantation. Completed NCT01610297 Phase 4 ICL670
7 A Prospective Randomized Comparative Study of Efficacy and Safety of Combined Deferiprone (DFP) and Deferasirox Versus DFP and Desferrioxamine (DFO) Therapy in Diseases With Severe Iron Overload Unknown status NCT01511848 Phase 2, Phase 3 DFP (ferriprox) and deferasirox (ICL 670);DFP, DFO
8 A Decisional Algorithm to Start Iron Chelation in Minimally Transfused Young Beta-thalassemia Major Patients Naive to Iron Chelation Therapy. A Comparative Randomized Prospective Study Unknown status NCT02173951 Phase 2, Phase 3 Deferiprone
9 Combined Therapy of Silymarin and Desferrioxamine in Patients With B-thalassemia Major: a Randomized Double-blind Clinical Trial Unknown status NCT00999349 Phase 2, Phase 3 Silymarin (LEGALON);Placebo
10 Effect of Zinc Supplementation on Glucose Homeostasis in Patients With β-Thalassemia Major Complicated With Diabetes Mellitus Completed NCT03851055 Phase 3 Zinc
11 Denosumab Versus Zoledronic Acid for Patients With Beta-Thalassemia Major-Induced Osteoporosis Terminated NCT03040765 Phase 3 Denosumab 60 MG/ML Prefilled Syringe;Zoledronic Acid 5Mg/Bag 100Ml Inj
12 A Phase 1/2 Open Label Study Evaluating the Safety and Efficacy of Gene Therapy of the β-Hemoglobinopathies (Sickle Cell Anemia and β-Thalassemia Major) by Transplantation of Autologous CD34+ Stem Cells Transduced Ex Vivo With a Lentiviral β-A-T87Q Globin Vector (LentiGlobin BB305 Drug Product) Completed NCT02151526 Phase 1, Phase 2 LentiGlobin BB305 Drug Product
13 EMERA007 - An Open Label, Active-treatment Controlled, Phase 2a Pilot Study to Explore Safety and Efficacy of NBMI Treatment in Patients With Beta Thalassemia Major, Requiring Iron Chelation Recruiting NCT04092205 Phase 2 Emeramide
14 A Phase 2A, Open-label Dose Finding Study to Determine the Safety and Tolerability of Sotatercept (ACE-011) in Adults With BETA(b)-THALASSEMIA. Active, not recruiting NCT01571635 Phase 2 SOTATERCEPT (ACE-011)
15 Evaluation of Safety and Efficacy of Transplantation of Autologous Hematopoietic Stem Cell Genetically Modified in Beta-Thalassemia Major Not yet recruiting NCT03276455 Phase 1, Phase 2
16 Immunomodulatory Effects of Silymarin in Patients With Beta-Thalassemia Major Completed NCT01752153 Phase 1 Desferrioxamine, Legalon® (Silymarin);Silymarin (Legalon)
17 Monitoring of Chimerism After Transplantation in Patients With β Thalassemia Major and the Treatment Strategies for the Reduction of Chimerism Unknown status NCT03101423 Interleukin-2;Donor Regulatory T-Lymphocytes
18 Study of The Therapeutic Benefits of Nigella Sativa in Children With Beta Thalassemia Major Unknown status NCT02816957 Early Phase 1 nigella sativ
19 Assessment ofDermatological Abnrmalities in Beta-thalassemia Major in Assiut University Pediatric Hospital Unknown status NCT03894605
20 Study of The Therapeutic Benefits of Al-hijamah in Children With Beta Thalassemia Major Unknown status NCT02761395 Deferasirox
21 Anthropometric Measurements in Children Having Transfusion-dependent Beta Thalassemia. Completed NCT03947632
22 The Effect of Alpha-tocopherol in Hemolysis and Oxidative Stress Marker on the Red Cell Completed NCT03948737 Alpha-Tocopherol;Placebo oral tablet
23 Effect of Spirulina on Liver Iron Concentration in Beta Thalassemic Children With Hepatitis C Completed NCT02744560
24 Effect of Spirulina on Serum Hyaluronic Acid as a Marker for Liver Fibrosis in Beta Thalassemic Children With Hepatitis C Completed NCT02744547
25 Effect of Spirulina on Liver Fibrosis by Transient Elastography in Beta Thalassemic Children With Hepatitis C Completed NCT02744105
26 the Potential Immunomodulatory Effects of Spirulina on Thalassemic Children Completed NCT02674607
27 Effect of Spirulina Compared to Amlodipine on Cardiac Iron Overload in Children With Beta Thalassemia Completed NCT02671695 Spirulina;Amlodipine
28 A Pilot Trial to Assess the Feasibility and Safety of GCSF Mobilization of CD34+ Hematopoietic Progenitor Cells in Patients With Betathalassemia Major Completed NCT00658385
29 The Shuttle Effect : Combination Therapy With Deferiprone and Deferasirox in Transfusion-dependent Thalassemia Patients. Completed NCT02198508 DFX(Deferasirox);DFP(Deferiprone)
30 A Pilot Study to Assess the Safety and Efficacy of G-CSF Mobilization With and Without Hydroxyurea Pretreatment in Adults With Beta Thalassemia Major Completed NCT00336362 Hydroxyurea
31 Erythrocyte Glutamine Level Relation to Pulmonary Hypertension Risk in Beta Thalassemia Major Children in Assiut University Children Hospital Completed NCT03133169
32 A Pilot Study to Assess the Safety and Efficacy of Mozobil ± G-CSF in Mobilizing Hematopoietic Stem Cells (CD34+ Cells) in Adults With Beta-thalassemia Major Completed NCT01206075 Mozobil;Mozobil;Mozobil
33 Effects of Spirulina on Cardiac Functions in Children With Beta Thalassemia Major Completed NCT02597595
34 Congenital Heart Surgery in Pediatric Patients With Beta-Thalassemia Major : Analysis of Hemolysis During Cardiopulmonary Bypass Completed NCT04367701
35 Pre-Transplant Immunosuppression and Related Haploidentical Hematopoietic Cell Transplantation for Patients With Severe Hemoglobinopathies Recruiting NCT04776850 Early Phase 1 Bortezomib;Busulfan;Cyclophosphamide;Dexamethasone;Fludarabine Phosphate;Mycophenolate Mofetil;Tacrolimus

Search NIH Clinical Center for Beta-Thalassemia Major

Genetic Tests for Beta-Thalassemia Major

Anatomical Context for Beta-Thalassemia Major

MalaCards organs/tissues related to Beta-Thalassemia Major:

40
Bone Marrow, Spleen, Liver, Pituitary, Thyroid, Bone, Endothelial

Publications for Beta-Thalassemia Major

Articles related to Beta-Thalassemia Major:

(show top 50) (show all 2091)
# Title Authors PMID Year
1
Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology. 61 6
24880717 2014
2
Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah. 61 6
24369358 2014
3
Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study. 61 6
25525381 2014
4
Frequency of beta-thalassemia or beta-hemoglobinopathy carriers simultaneously affected with alpha-thalassemia in Iran. 6 61
25016698 2014
5
Mosaic segmental uniparental isodisomy and progressive clonal selection: a common mechanism of late onset β-thalassemia major. 6 61
22983591 2013
6
Compound heterozygote condition in beta thalassemia major due to a novel single nucleotide deletion (-T) at codon 69 in association with IVS 1-5 (G>C) mutation. 6 61
22409273 2012
7
Characterization of a novel deletion causing beta-thalassemia major in an Afghan family. 61 6
20113295 2010
8
Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques. 61 6
19437135 2010
9
Screening of Five Common Beta Thalassemia Mutations in the Pakistani Population: A basis for prenatal diagnosis. 6 61
21509314 2009
10
Inherited hemoglobin disorders in Andhra Pradesh, India: a population study. 61 6
19000664 2009
11
Variation and heritability of Hb F and F-cells among beta-thalassemia heterozygotes in Hong Kong. 61 6
18266208 2008
12
Combination of Hb Knossos [Cod 27 (G-T)] and IVSII-745 (C-G) in a Turkish patient with beta-thalassemia major. 61 6
17949282 2007
13
Changes in the epidemiology of thalassemia in North America: a new minority disease. 6 61
16291734 2005
14
[Genetic study on 27 children with beta-thalassemia major and their parents in Sichuan area]. 61 6
15181845 2004
15
Molecular analysis of beta-thalassemia and sickle cell anemia in Antalya. 6 61
15153712 2004
16
Spectrum of beta-thalassemia mutations and their association with allelic sequence polymorphisms at the beta-globin gene cluster in an Eastern Indian population. 61 6
12210807 2002
17
A rare mutation [IVS-I-130 (G-A)] in a Turkish beta-thalassemia major patient. 61 6
10706767 2000
18
Prevalence and genotypes of alpha- and beta-thalassemia carriers in Hong Kong -- implications for population screening. 61 6
9113933 1997
19
Molecular characterization of beta-thalassemia in north Jordan. 6 61
7852087 1994
20
Identification of two novel beta zero-thalassemia mutations in a Filipino family: frameshift codon 67 (-TG) and a beta-globin gene deletion. 61 6
8257991 1993
21
Molecular characterization of beta-thalassemia in Azerbaijan. 6 61
1483699 1992
22
A new frameshift beta zero-thalassemia mutation (codons 27-28 +C) found in a Chinese family. 6 61
1850955 1991
23
The spectrum of beta-thalassemia mutations in Taiwan: identification of a novel frameshift mutation. 61 6
2014803 1991
24
Beta-thalassemia, HB S-beta-thalassemia and sickle cell anemia among Tunisians. 61 6
1917531 1991
25
Beta-thalassemia in Turkey. 61 6
2200760 1990
26
Beta zero-thalassemia in a Thai family is caused by a 3.4 kb deletion including the entire beta-globin gene. 6 61
2272839 1990
27
A novel beta-thalassemia frameshift mutation (codon 14/15), detectable by direct visualization of abnormal restriction fragment in amplified genomic DNA. 6 61
2901867 1988
28
The molecular basis of beta-thalassemia in Lebanon: application to prenatal diagnosis. 61 6
3828533 1987
29
Functional analysis of a beta-globin gene containing a TATA box mutation from a Kurdish Jew with beta thalassemia. 6 61
2987224 1985
30
beta-Thalassemia in a Kurdish Jew. Single base changes in the T-A-T-A box. 61 6
7076659 1982
31
Whole genome sequence-based haplotypes reveal a single origin of the 1393 bp HBB deletion. 6
32001505 2020
32
Whole-genome sequencing of patients with rare diseases in a national health system. 6
32581362 2020
33
Saturation mutagenesis of twenty disease-associated regulatory elements at single base-pair resolution. 6
31395865 2019
34
A Novel Mutation at HBB: c.91delA (Codon 30, -A) Causing β-Thalassemia in a Chinese Family. 6
31108495 2019
35
Codon 14 (+T) (HBB: c.44_45insT): a Rare β-Thalassemia Mutation Reported Only in Azerbaijan. 6
30422720 2018
36
Description of a Rare β-Globin Gene Mutation: -86 (C>G) (HBB: c.-136C>G) Observed in a Syrian Family. 6
30173596 2018
37
Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia. 6
28768465 2018
38
Complex Interaction of Hb Q-Thailand (HBA1: c.223G>C) with β-Thalassemia/Hb E (HBB: c.79G>A) Disease. 6
29484903 2018
39
[Rare thalassemia mutations among southern Chinese population]. 6
29188602 2017
40
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. 6
28603845 2017
41
Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study. 6
28643346 2017
42
Prevalence and genetic analysis of α- and β-thalassemia in Baise region, a multi-ethnic region in southern China. 6
26877226 2017
43
A Novel β-Thalassemia Insertion/Frameshift Mutation Between Codons 77/78 (p.Leu78Profs*13 or HBB: c.235_236insC) Observed in a Family in Bangladesh. 6
29313434 2017
44
Characterization of Two Novel Deletions Involving the 5' Region of the β-Globin Gene. 6
29182041 2017
45
Genetic Background of the Sickle Cell Disease Pediatric Population of Dakar, Senegal, and Characterization of a Novel Frameshift β-Thalassemia Mutation [HBB: c.265_266del; p.Leu89Glufs*2]. 6
28670947 2017
46
Molecular Characterization of β-Thalassemia Mutations in Central Vietnam. 6
28671035 2017
47
The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran. 6
26948378 2017
48
Rare β-Globin Gene Mutations in Pakistan. 6
28670940 2017
49
A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia. 6
28460555 2017
50
A Novel -72 (T→A) β-Promoter Mutation Causing Slightly Elevated HbA2 in a Vietnamese Heterozygote. 6
28503568 2017

Variations for Beta-Thalassemia Major

ClinVar genetic disease variations for Beta-Thalassemia Major:

6 (show top 50) (show all 358)
# Gene Name Type Significance ClinVarId dbSNP ID Position
1 HBB NM_000518.4:c.91+6T>C SNV Pathogenic 393705 GRCh37:
GRCh38:
2 HBB c.17delA Deletion Pathogenic 393708 GRCh37:
GRCh38:
3 HBB NC_000011.10:g.5216940_5229551del Deletion Pathogenic 869213 GRCh37:
GRCh38:
4 HBB , HBB-LCR NC_000011.10:g.5284251_5289110del Deletion Pathogenic 869331 GRCh37: 11:5305477-5310336
GRCh38: 11:5284247-5289106
5 HBB NC_000011.10:g.(?_5225465)_(5227072_?)del Deletion Pathogenic 982009 GRCh37: 11:5246695-5248302
GRCh38:
6 HBB NC_000011.9:g.(5246957_5247806)_(5248302_?)del Deletion Pathogenic 984497 GRCh37: 11:5246957-5248302
GRCh38:
7 overlap with 3 genes NC_000011.10:g.5218346_5226066del Deletion Pathogenic 869214 GRCh37: 11:5239576-5247296
GRCh38: 11:5218346-5226066
8 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-197C>T SNV Pathogenic 15458 rs34451549 GRCh37: 11:5247153-5247153
GRCh38: 11:5225923-5225923
9 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-2A>C SNV Pathogenic 21190 rs33914668 GRCh37: 11:5246958-5246958
GRCh38: 11:5225728-5225728
10 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-106G>C SNV Pathogenic 36281 rs63750681 GRCh37: 11:5248357-5248357
GRCh38: 11:5227127-5227127
11 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-151C>T SNV Pathogenic 15461 rs63751208 GRCh37: 11:5248402-5248402
GRCh38: 11:5227172-5227172
12 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.51del (p.Lys18fs) Deletion Pathogenic 15414 rs35662066 GRCh37: 11:5248201-5248201
GRCh38: 11:5226971-5226971
13 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-142C>T SNV Pathogenic 15462 rs34883338 GRCh37: 11:5248393-5248393
GRCh38: 11:5227163-5227163
14 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.-29G>A SNV Pathogenic 393702 rs34704828 GRCh37: 11:5248280-5248280
GRCh38: 11:5227050-5227050
15 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.*6C>G SNV Pathogenic 393707 rs34809925 GRCh37: 11:5246822-5246822
GRCh38: 11:5225592-5225592
16 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-81A>G SNV Pathogenic 15466 rs33981098 GRCh37: 11:5248332-5248332
GRCh38: 11:5227102-5227102
17 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.-41del Deletion Pathogenic 393703 rs35352549 GRCh37: 11:5248292-5248292
GRCh38: 11:5227062-5227062
18 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.*110T>C SNV Pathogenic 36332 rs33978907 GRCh37: 11:5246718-5246718
GRCh38: 11:5225488-5225488
19 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-137C>T SNV Pathogenic 36287 rs33941377 GRCh37: 11:5248388-5248388
GRCh38: 11:5227158-5227158
20 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.20del (p.Glu7fs) Deletion Pathogenic 15418 rs63749819 GRCh37: 11:5248232-5248232
GRCh38: 11:5227002-5227002
21 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.47G>A (p.Trp16Ter) SNV Pathogenic 15403 rs63750783 GRCh37: 11:5248205-5248205
GRCh38: 11:5226975-5226975
22 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.-18C>G SNV Pathogenic 393704 rs34135787 GRCh37: 11:5248269-5248269
GRCh38: 11:5227039-5227039
23 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.371_378del (p.Thr124fs) Deletion Pathogenic 495998 rs1554917561 GRCh37: 11:5246894-5246901
GRCh38: 11:5225664-5225671
24 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-238C>T SNV Pathogenic 256347 rs558554234 GRCh37: 11:5247194-5247194
GRCh38: 11:5225964-5225964
25 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.2T>G (p.Met1Arg) SNV Pathogenic 15434 rs33941849 GRCh37: 11:5248250-5248250
GRCh38: 11:5227020-5227020
26 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.92+5G>T SNV Pathogenic 15448 rs33915217 GRCh37: 11:5248155-5248155
GRCh38: 11:5226925-5226925
27 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-70C>G SNV Pathogenic 36320 rs193922560 GRCh37: 11:5247026-5247026
GRCh38: 11:5225796-5225796
28 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.164_168delinsGGCATCA (p.Val55fs) Indel Pathogenic 590977 rs1564875331 GRCh37: 11:5247954-5247958
GRCh38: 11:5226724-5226728
29 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.25_26del (p.Lys9fs) Deletion Pathogenic 15413 rs35497102 GRCh37: 11:5248226-5248227
GRCh38: 11:5226996-5226997
30 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-7C>A SNV Pathogenic 869111 rs34483965 GRCh37: 11:5246963-5246963
GRCh38: 11:5225733-5225733
31 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.170_171insGCAACCCTAAGGTG (p.Asn58_Pro59insGlnProTer) Insertion Pathogenic 869222 GRCh37: 11:5247951-5247952
GRCh38: 11:5226721-5226722
32 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.176dup (p.Pro59_Lys60insTer) Duplication Pathogenic 869223 GRCh37: 11:5247945-5247946
GRCh38: 11:5226715-5226716
33 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.178A>T (p.Lys60Ter) SNV Pathogenic 869224 GRCh37: 11:5247944-5247944
GRCh38: 11:5226714-5226714
34 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.179del (p.Lys60fs) Deletion Pathogenic 869225 GRCh37: 11:5247943-5247943
GRCh38: 11:5226713-5226713
35 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.18_19del (p.Glu7fs) Deletion Pathogenic 869226 GRCh37: 11:5248233-5248234
GRCh38: 11:5227003-5227004
36 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.184A>T (p.Lys62Ter) SNV Pathogenic 15407 rs33995148 GRCh37: 11:5247938-5247938
GRCh38: 11:5226708-5226708
37 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.187_251dup (p.Thr85fs) Duplication Pathogenic 869227 GRCh37: 11:5247870-5247871
GRCh38: 11:5226640-5226641
38 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.189_195del (p.His64fs) Deletion Pathogenic 869228 GRCh37: 11:5247927-5247933
GRCh38: 11:5226697-5226703
39 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.199A>T (p.Lys67Ter) SNV Pathogenic 869229 GRCh37: 11:5247923-5247923
GRCh38: 11:5226693-5226693
40 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.19G>T (p.Glu7Ter) SNV Pathogenic 869230 GRCh37: 11:5248233-5248233
GRCh38: 11:5227003-5227003
41 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.1A>C (p.Met1Leu) SNV Pathogenic 869231 GRCh37: 11:5248251-5248251
GRCh38: 11:5227021-5227021
42 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.1A>G (p.Met1Val) SNV Pathogenic 439140 rs34563000 GRCh37: 11:5248251-5248251
GRCh38: 11:5227021-5227021
43 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.20_32del (p.Glu7fs) Deletion Pathogenic 869232 GRCh37: 11:5248220-5248232
GRCh38: 11:5226990-5227002
44 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.20_45del (p.Glu7fs) Deletion Pathogenic 869233 GRCh37: 11:5248207-5248232
GRCh38: 11:5226977-5227002
45 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-3C>G SNV Pathogenic 619687 rs33913413 GRCh37: 11:5246959-5246959
GRCh38: 11:5225729-5225729
46 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-8T>G SNV Pathogenic 15453 rs34793594 GRCh37: 11:5246964-5246964
GRCh38: 11:5225734-5225734
47 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-98_316-86dup Duplication Pathogenic 869277 GRCh37: 11:5247041-5247042
GRCh38: 11:5225811-5225812
48 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.319C>G (p.Leu107Val) SNV Pathogenic 869278 GRCh37: 11:5246953-5246953
GRCh38: 11:5225723-5225723
49 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.339_345dup (p.Ala116fs) Duplication Pathogenic 869279 GRCh37: 11:5246926-5246927
GRCh38: 11:5225696-5225697
50 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.339T>A (p.Cys113Ter) SNV Pathogenic 869280 GRCh37: 11:5246933-5246933
GRCh38: 11:5225703-5225703

Expression for Beta-Thalassemia Major

Search GEO for disease gene expression data for Beta-Thalassemia Major.

Pathways for Beta-Thalassemia Major

GO Terms for Beta-Thalassemia Major

Cellular components related to Beta-Thalassemia Major according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 endoplasmic reticulum lumen GO:0005788 8.92 F5 F2 COL1A1 BGLAP

Biological processes related to Beta-Thalassemia Major according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 skeletal system development GO:0001501 9.33 VDR COL1A1 BGLAP
2 glutathione derivative biosynthetic process GO:1901687 8.96 GSTT1 GSTM1
3 blood coagulation GO:0007596 8.92 HBB F5 F2 COL1A1

Molecular functions related to Beta-Thalassemia Major according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 glutathione transferase activity GO:0004364 8.62 GSTT1 GSTM1

Sources for Beta-Thalassemia Major

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
20 GARD
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
53 NINDS
54 Novoseek
56 OMIM via Orphanet
57 OMIM® (Updated 05-Apr-2021)
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 Tocris
70 UMLS
71 UMLS via Orphanet
Content
Loading form....