MCID: BRS099
MIFTS: 62

Breast Ductal Carcinoma

Categories: Cancer diseases

Aliases & Classifications for Breast Ductal Carcinoma

MalaCards integrated aliases for Breast Ductal Carcinoma:

Name: Breast Ductal Carcinoma 12 15
Ductal Breast Carcinoma 54 6 71
Mammary Ductal Carcinoma 71
Carcinoma, Ductal 43
Ductal Carcinoma 71
Duct Carcinoma 12

Classifications:



External Ids:

Disease Ontology 12 DOID:3007
MeSH 43 D044584
UMLS 71 C0021367 C1176475 C1527349

Summaries for Breast Ductal Carcinoma

Disease Ontology : 12 A breast carcinoma that derives from the lining of milk ducts.

MalaCards based summary : Breast Ductal Carcinoma, also known as ductal breast carcinoma, is related to squamous cell bile duct carcinoma and bile duct cancer. An important gene associated with Breast Ductal Carcinoma is RAD54L (RAD54 Like), and among its related pathways/superpathways are ERK Signaling and Nanog in Mammalian ESC Pluripotency. The drugs Sufentanil and Ondansetron have been mentioned in the context of this disorder. Affiliated tissues include breast, lymph node and testes, and related phenotypes are Increased cell death in breast cancer cell lines (MCF10A, MDA-MB-435) and Increased focal adhesion (FA) area, decreased number of small and round FAs, increased peripheral FA formation, increased cell spreading

Related Diseases for Breast Ductal Carcinoma

Diseases related to Breast Ductal Carcinoma via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 532)
# Related Disease Score Top Affiliating Genes
1 squamous cell bile duct carcinoma 33.8 KRT8 KRT19
2 bile duct cancer 33.4 TP53 KRT19 ERBB2 EGFR CTNNB1 CDH1
3 breast cystic hypersecretory carcinoma 33.3 ERBB2 CDH1
4 intrahepatic cholangiocarcinoma 33.2 TP53 KRT19 ERBB2 EGFR CTNNB1 CDH1
5 cholangiocarcinoma 32.9 TP53 TFF1 KRT8 KRT19 ERBB2 EGFR
6 bile duct adenocarcinoma 32.8 TP53 KRT19 ERBB2 EGFR CTNNB1 CDH1
7 adenoma 31.6 TP53 MKI67 CTNNB1 CDH1 CCND1
8 pleomorphic adenoma 31.5 TP53 ERBB2 CTNNB1
9 in situ carcinoma 31.5 TP53 PIP PGR KRT8 ESR1 ERBB2
10 adenocarcinoma 31.4 VEGFD TP53 ERBB2 EGFR CTNNB1 CDH1
11 ductal carcinoma in situ 31.3 TP53 PIP PGR MKI67 KRT8 ESR1
12 breast cancer 31.2 ZFAS1 VEGFD TP53 TFF1 RAD54L PIP
13 cystadenocarcinoma 31.2 TP53 PGR ERBB2 BRCA1
14 salivary gland carcinoma 31.1 TP53 ERBB2 EGFR BRCA1
15 leiomyosarcoma 31.1 TP53 PGR ESR1 CCND1
16 tubular adenocarcinoma 31.1 PGR ESR1 ERBB2 EGFR CTNNB1 CDH1
17 cholecystitis 30.9 TP53 EGFR CDH1
18 comedo carcinoma 30.8 TP53 PGR ESR1 ERBB2
19 pancreatic ductal carcinoma 30.8 TP53 ERBB2 EGFR CDH1
20 polymorphous low-grade adenocarcinoma 30.8 MKI67 CTNNB1 CCND1
21 renal cell carcinoma, papillary, 1 30.8 TP53 KRT19 ERBB2 EGFR CTNNB1 CDH1
22 keratinizing squamous cell carcinoma 30.8 TP53 EGFR CDH1
23 linitis plastica 30.8 PIP PGR ERBB2 CDH1
24 sporadic breast cancer 30.8 TP53 PGR ESR1 ERBB2 EGFR CDH1
25 papillary adenocarcinoma 30.7 TP53 PIP PGR NME1 KRT19 ERBB2
26 carcinosarcoma 30.7 TP53 PGR ERBB2 EGFR CTNNB1 CDH1
27 spindle cell carcinoma 30.7 PGR KRT8 KRT19 ESR1 CDH1
28 transitional cell carcinoma 30.7 TP53 NME1 MKI67 KRT8 KRT19 ERBB2
29 cystadenoma 30.7 PGR CCND1 BRCA1
30 papillary carcinoma 30.6 PGR NME1 KRT19 ESR1 ERBB2 CDH1
31 gallbladder cancer 30.6 TP53 NME1 KRT19 ERBB2 EGFR CTNNB1
32 clear cell renal cell carcinoma 30.6 TP53 EGFR CTNNB1 CDH1 CCND1
33 mucoepidermoid carcinoma 30.6 TP53 MKI67 KRT19 ERBB2 EGFR CTNNB1
34 papilloma 30.5 TP53 KRT8 ESR1 EGFR CDH1 CCND1
35 signet ring cell adenocarcinoma 30.5 TP53 PIP ERBB2 CTNNB1 CDH1
36 apocrine adenocarcinoma 30.5 TP53 PIP PGR ESR1 ERBB2 EGFR
37 vaginal cancer 30.5 TP53 PGR ESR1
38 adenoid cystic carcinoma 30.5 TP53 PGR KRT8 KRT19 ERBB2 EGFR
39 mucinous adenocarcinoma 30.5 TP53 PGR KRT19 ESR1 ERBB2 EGFR
40 inverted papilloma 30.5 TP53 MKI67 EGFR CCND1
41 differentiated thyroid carcinoma 30.4 VEGFD TP53 EGFR
42 intravenous leiomyomatosis 30.4 PGR ESR1
43 angiomyolipoma 30.4 VEGFD PGR ESR1
44 mammary paget's disease 30.4 PIP PGR KRT8 ESR1 ERBB2 EGFR
45 renal pelvis adenocarcinoma 30.4 KRT19 CDH1
46 prostatic hypertrophy 30.4 PGR ESR1 EGFR
47 nasopharyngeal carcinoma 30.4 TP53 NME1 ERBB2 EGFR CTNNB1 CDH1
48 lymphoepithelioma-like carcinoma 30.3 KRT8 KRT19 CDH1
49 female breast cancer 30.3 TP53 PIP PGR ESR1 ERBB2 EGFR
50 breast adenocarcinoma 30.3 TP53 PIP PGR ESR1 ERBB2 EGFR

Graphical network of the top 20 diseases related to Breast Ductal Carcinoma:



Diseases related to Breast Ductal Carcinoma

Symptoms & Phenotypes for Breast Ductal Carcinoma

GenomeRNAi Phenotypes related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Increased cell death in breast cancer cell lines (MCF10A, MDA-MB-435) GR00104-A-0 9.35 CCND1 ESR1 MKI67 PIP VEGFD
2 Increased focal adhesion (FA) area, decreased number of small and round FAs, increased peripheral FA formation, increased cell spreading GR00210-A 8.32 CTNNB1

MGI Mouse Phenotypes related to Breast Ductal Carcinoma:

45 (show all 17)
# Description MGI Source Accession Score Top Affiliating Genes
1 cardiovascular system MP:0005385 10.38 BRCA1 CCND1 CDH1 CTNNB1 EGFR ERBB2
2 cellular MP:0005384 10.37 BRCA1 CCND1 CDH1 CTNNB1 CTSD EGFR
3 endocrine/exocrine gland MP:0005379 10.37 BRCA1 CCND1 CDH1 CDH3 CTNNB1 CTSD
4 digestive/alimentary MP:0005381 10.36 BRCA1 CCND1 CDH1 CTNNB1 CTSD EGFR
5 growth/size/body region MP:0005378 10.36 BRCA1 CCND1 CDH1 CTNNB1 CTSD EGFR
6 homeostasis/metabolism MP:0005376 10.32 BRCA1 CCND1 CDH1 CTNNB1 CTSD EGFR
7 immune system MP:0005387 10.3 BRCA1 CCND1 CDH1 CTNNB1 CTSD EGFR
8 hematopoietic system MP:0005397 10.27 BRCA1 CCND1 CTNNB1 CTSD EGFR ESR1
9 integument MP:0010771 10.25 BRCA1 CCND1 CDH1 CDH3 CTNNB1 CTSD
10 embryo MP:0005380 10.24 BRCA1 CDH1 CTNNB1 EGFR ERBB2 ESR1
11 mortality/aging MP:0010768 10.24 BRCA1 CCND1 CDH1 CTNNB1 CTSD EGFR
12 neoplasm MP:0002006 10.13 BRCA1 CCND1 CDH1 CTNNB1 EGFR ERBB2
13 limbs/digits/tail MP:0005371 9.95 BRCA1 CTNNB1 EGFR ERBB2 ESR1 PGR
14 normal MP:0002873 9.93 BRCA1 CCND1 CDH1 CTNNB1 EGFR ERBB2
15 no phenotypic analysis MP:0003012 9.86 CDH1 CTNNB1 EGFR ESR1 KRT19 MKI67
16 reproductive system MP:0005389 9.73 BRCA1 CCND1 CDH1 CTNNB1 EGFR ERBB2
17 respiratory system MP:0005388 9.23 BRCA1 CCND1 CTNNB1 EGFR ERBB2 ESR1

Drugs & Therapeutics for Breast Ductal Carcinoma

Drugs for Breast Ductal Carcinoma (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 265)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Sufentanil Approved, Investigational Phase 4 56030-54-7 41693
2
Ondansetron Approved Phase 4 99614-02-5 4595
3
Ropivacaine Approved Phase 4 84057-95-4 71273 175805
4 Analgesics Phase 4
5 Narcotics Phase 4
6 Anesthetics, General Phase 4
7 Analgesics, Opioid Phase 4
8 Anesthetics, Intravenous Phase 4
9
Vinorelbine Approved, Investigational Phase 3 71486-22-1 60780 44424639
10
Bevacizumab Approved, Investigational Phase 2, Phase 3 216974-75-3
11
Lapatinib Approved, Investigational Phase 2, Phase 3 231277-92-2, 388082-78-8 208908 9941095
12
mometasone furoate Approved, Investigational, Vet_approved Phase 3 83919-23-7
13
Medroxyprogesterone acetate Approved, Investigational Phase 3 71-58-9
14
Octreotide Approved, Investigational Phase 3 83150-76-9 383414 6400441
15
Pertuzumab Approved Phase 3 380610-27-5, 145040-37-5 2540
16
Oxybutynin Approved, Investigational Phase 3 5633-20-5 4634
17
Metformin Approved Phase 3 657-24-9 14219 4091
18
Sodium citrate Approved, Investigational Phase 3 68-04-2
19
Fulvestrant Approved, Investigational Phase 3 129453-61-8 104741 17756771
20
Tamoxifen Approved Phase 3 10540-29-1 2733526
21
Trastuzumab Approved, Investigational Phase 3 180288-69-1 9903
22
Progesterone Approved, Vet_approved Phase 3 57-83-0 5994
23
Doxorubicin Approved, Investigational Phase 3 23214-92-8 31703
24
Triamcinolone Approved, Vet_approved Phase 3 124-94-7 31307
25
Cyclophosphamide Approved, Investigational Phase 3 50-18-0, 6055-19-2 2907
26
Carboplatin Approved Phase 3 41575-94-4 10339178 38904 498142
27
Docetaxel Approved, Investigational Phase 3 114977-28-5 148124
28
Epirubicin Approved Phase 3 56420-45-2 41867
29
Atezolizumab Approved, Investigational Phase 3 1380723-44-3
30
Exemestane Approved, Investigational Phase 3 107868-30-4 60198
31
Leuprolide Approved, Investigational Phase 2, Phase 3 53714-56-0 657181 3911
32
Goserelin Approved Phase 2, Phase 3 65807-02-5 5311128 47725
33
Daunorubicin Approved Phase 3 20830-81-3 30323
34
Letrozole Approved, Investigational Phase 3 112809-51-5 3902
35
Paclitaxel Approved, Vet_approved Phase 3 33069-62-4 36314
36
Hyaluronic acid Approved, Vet_approved Phase 3 9004-61-9 53477741
37
Toremifene Approved, Investigational Phase 3 89778-26-7 3005573
38
Citric acid Approved, Nutraceutical, Vet_approved Phase 3 77-92-9 311
39 Atamestane Investigational Phase 3 96301-34-7
40 Estrogens, Conjugated (USP) Phase 3
41 Anti-Inflammatory Agents Phase 3
42 Anti-Allergic Agents Phase 3
43 Contraceptive Agents, Male Phase 3
44
Medroxyprogesterone Phase 3 520-85-4 10631
45 Neurotransmitter Agents Phase 3
46 Gastrointestinal Agents Phase 3
47 Parasympatholytics Phase 3
48 Cholinergic Agents Phase 3
49 Mandelic Acids Phase 3
50 Muscarinic Antagonists Phase 3

Interventional clinical trials:

(show top 50) (show all 417)
# Name Status NCT ID Phase Drugs
1 A Clinical Evaluation Of Adipose Derived Regenerative Cells In The Treatment Of Patients With BrEast Deformities Post Segmental Breast ResecTion (Lumpectomy) With Or Without Radiation ThErapy. A Phase IV Post Market Study. Completed NCT00616135 Phase 4
2 Electronic Xoft Intersociety Brachytherapy Trial Completed NCT00742222 Phase 4
3 The Ultrasound-guided Multiple-injection Costotransverse Block for Mastectomy and Primary Reconstructive Surgery. A Double Blind, Randomised, Placebo Controlled Trial. Recruiting NCT04248179 Phase 4 Ropivacaine injection;Saline 0.9%;Sufentanil and PONV prophylaxis
4 Interstitial Brachytherapy Alone Versus External Beam Radiation Therapy After Breast Conserving Surgery for Low-risk Invasive Carcinoma and Low-risk Ductal Carcinoma in Situ (DCIS) of the Female Breast Unknown status NCT00402519 Phase 3
5 A Randomized Phase III Study to Investigate the Efficacy and Safety of Docetaxel + Capecitabine vs. Vinorelbine + Capecitabine Followed by Capecitabine Alone as 1st Therapy on Locally Advanced and Metastatic Breast Cancer Patients. Unknown status NCT01126138 Phase 3 Vinorelbine plus Capecitabine for 6 cycles, followed by Capecitabine;Docetaxel plus Capecitabine for 6 cycles, followed by Capecitabine
6 A Randomized Phase III Trial Comparing Nanoparticle-based Paclitaxel With Solvent-based Paclitaxel as Part of Neoadjuvant Chemotherapy for Patients With Early Breast Cancer (GeparSepto) Unknown status NCT01583426 Phase 3 nab-Paclitaxel;Paclitaxel
7 Randomized Phase Ⅲ Trial Comparing Dose-dense Epirubicin and Cyclophosphamide Followed by Paclitaxel With Paclitaxel Plus Carboplatin as Adjuvant Therapy for Triple-negative Breast Cancer. Unknown status NCT01378533 Phase 3 epirubicin, cyclophosphamide, paclitaxel, carboplatin, G-CSF
8 A Clinical Trial Comparing Anastrozole With Tamoxifen in Postmenopausal Patients With Ductal Carcinoma in Situ (DCIS) Undergoing Lumpectomy With Radiation Therapy Completed NCT00053898 Phase 3 anastrozole;tamoxifen citrate
9 Phase III Randomized Double-Blind Study of Mometasone Furoate Versus Placebo in the Prevention of Radiation Dermatitis in Breast Cancer Patients Receiving Radiation Therapy Completed NCT00438659 Phase 3 mometasone furoate
10 A Phase III Prospective, Randomized, Double-Blind Clinical Trial of Hormone Replacement Therapy In Postmenopausal Women With A History Of Node-Negative Or Ductal Carcinoma In Situ Who Are Receiving Adjuvant Tamoxifen Completed NCT00026286 Phase 3 conjugated estrogens;medroxyprogesterone
11 Genetic Counseling for Newly Diagnosed Breast Cancer Patients Completed NCT00262899 Phase 3
12 A Randomized Comparison Of Medroxyprogesterone Acetate (MA) And Observation For Prevention Of Endometrial Pathology In Postmenopausal Breast Cancer Patients Treated With Tamoxifen, Phase III Completed NCT00002920 Phase 3 medroxyprogesterone;tamoxifen citrate
13 Evaluation of the Diagnostic Performance of MRI±Biopsy to Optimize Resection of Ductal Carcinoma In Situ (DCIS) Breast Cancer Completed NCT01112254 Phase 3
14 Conservative Surgery With or Without Axillary Lymphnode Removal in Treating Women With T1N0 Breast Cancer Completed NCT01508546 Phase 3
15 Evaluation of a New Intraoperative Gamma Camera for the Sentinel Lymph Node Procedure in Breast Cancer Completed NCT00757302 Phase 3
16 Phase III Study of Atamestane Plus Toremifene Versus Letrozole in Advanced Breast Cancer Completed NCT00044291 Phase 3 atamestane;toremifene;letrozole;aromatase inhibition
17 CirCe01 Study: Evaluation of the Use of Circulating Tumour Cells to Guide Chemotherapy From the 3rd Line of Chemotherapy for Metastatic Breast Cancer Completed NCT01349842 Phase 3
18 A Phase III Study to Evaluate Letrozole as Adjuvant Endocrine Therapy for Postmenopausal Women With Receptor (ER and/or PgR) Positive Tumors Completed NCT00004205 Phase 3 letrozole;tamoxifen citrate
19 A Clinical Trial to Evaluate the Benefit of Adding Octreotide (SMS 201-995 PA LAR) to Tamoxifen Alone or to Tamoxifen and Chemotherapy in Patients With Axillary Node-Negative, Estrogen-Receptor-Positive, Primary Invasive Breast Cancer Completed NCT00002967 Phase 3 cyclophosphamide;doxorubicin hydrochloride;octreotide pamoate;tamoxifen citrate
20 Prospective Trial Comparing the Use of Conventional Electric Scalpel and Harmonic Scalpel in Mastectomy Completed NCT01391988 Phase 3
21 Phase III Study in the Conservative Management of Breast Carcinoma by Tumorectomy and Radiotherapy: Assessment of the Role of a Booster Dose of Radiotherapy (Joint Study of the European Organisation for Research and Treatment of Cancer Radiotherapy Cooperative Group and Breast Cancer Cooperative Group) Completed NCT02295033 Phase 3
22 A Phase III, Double-Blind, Controlled Trial of Oxybutynin in the Management of Hot Flashes Completed NCT02961790 Phase 3 Oxybutynin Chloride
23 A Phase III Randomized Double Blind Study of Letrozole Versus Placebo in Women With Primary Breast Cancer Completing Five or More Years of Adjuvant Tamoxifen Completed NCT00003140 Phase 3 letrozole
24 A Randomized Phase II Trial Investigating the Addition of Carboplatin to Neoadjuvant Therapy for Triple-negative and HER2-positive Early Breast Cancer Completed NCT01426880 Phase 2, Phase 3 Carboplatin;background treatment
25 A Randomized Phase III Trial Comparing Two Dose-dense, Dose-intensified Approaches (ETC and PM(Cb)) for Neoadjuvant Treatment of Patients With High-risk Early Breast Cancer (GeparOcto) Completed NCT02125344 Phase 3 non-pegylated liposomal doxorubicin;Carboplatin;Paclitaxel;Epirubicin;Cyclophosphamide;Pertuzumab;Trastuzumab;Ferric carboxymaltose
26 Phase 3 Study of Weekly Paclitaxel in Combination With Cisplatin as Adjuvant Chemotherapy for Early Stage Human Epidermal Growth Factor Receptor-2 (HER2) Negative Breast Cancer in High-risk Women Recruiting NCT03201861 Phase 3 Paclitaxel, Cisplatin;EC to docetaxel or paclitaxel
27 Radiotherapy Versus Low-Dose Tamoxifen Following Breast Conserving Surgery for Low-Risk and Estrogen Receptor-Positive Ductal Carcinoma in Situ of Breast: an International Open-label Randomized Non-inferiority Trial Recruiting NCT04046159 Phase 3 Low-dose tamoxifen
28 RT CHARM: Phase III Randomized Trial of Hypofractionated Post Mastectomy Radiation With Breast Reconstruction Recruiting NCT03414970 Phase 3
29 The Efficacy of Levamisole Hcl in Advanced Intrahepatic Cholangiocarcinoma . A Multicenter, Open, Randomized, Prospective Study Recruiting NCT03940378 Phase 3 Levamisole Hydrochloride;Anlotinib Hydrochloride Capsules
30 Prospective Randomized Study of Accelerated Radiation Therapy (PRART) Recruiting NCT04175210 Phase 3
31 Management of Low Risk Ductal Carcinoma in Situ (Low-risk DCIS): a Randomized, Multicentre, Non-inferiority Trial, Between Standard Therapy Approach Versus Active Surveillance Recruiting NCT02492607 Phase 3
32 A Randomized Phase III Trial of Comparing Combination Administration of Paclitaxel and Cisplatin Versus CEF as Adjuvant Chemotherapy in Breast Cancer Patients With Pathological Partial Response and Complete Response to Neoadjuvant Chemotherapy Recruiting NCT02879513 Phase 3 Paclitaxel;Cisplatin;Epirubicin;Cyclophosphamide;5-fluoruracil
33 Testing for Atypia in Random Periareolar Fine Needle Aspiration (RPFNA) Cytology After 12 Months Metformin (1, 1-Dimethylbiguanide Hydrochloride) Chemoprevention Versus Placebo Control in Premenopausal Women Recruiting NCT01905046 Phase 3 metformin hydrochloride
34 Efficacy and Safety Study of TA(E)C-GP Versus A(E)C-T for the High Risk Triple-negative Breast Cancer Patients Predicted by the Messenger RNA (mRNA)-Long Non-coding RNA (lncRNA) Signature and Validation of the Signature's Efficacy Recruiting NCT02641847 Phase 2, Phase 3 docetaxel;doxorubicin or epirubicin;cyclophosphamide;gemcitabine;cisplatin
35 A Phase III Clinical Trial Comparing Trastuzumab Given Concurrently With Radiation Therapy and Radiation Therapy Alone for Women With HER2-Positive Ductal Carcinoma In Situ Resected by Lumpectomy Active, not recruiting NCT00769379 Phase 3
36 Phase III Trial of Tamoxifen Alone vs. Tamoxifen Plus Radiation Therapy for Good Risk Duct Carcinoma In-Situ (DCIS) of the Female Breast Active, not recruiting NCT00003857 Phase 3 tamoxifen citrate
37 A Randomised Phase III Study of Radiation Doses and Fractionation Schedules in Non-low Risk Ductal Carcinoma In Situ (DCIS) of the Breast Active, not recruiting NCT00470236 Phase 3
38 A Multicentric Phase III Trial Evaluating the Impact of a Radiation Boost (16Gy) After Breast Conserving Surgery and a Whole Breast Irradiation (50Gy) for DCIS Active, not recruiting NCT00907868 Phase 3
39 International Breast Cancer Intervention Study II (IBIS-II) (DCIS) Active, not recruiting NCT00072462 Phase 3 tamoxifen citrate;Anastrozole
40 Neo-Adjuvant Study With the PDL1-directed Antibody in Triple Negative Locally Advanced Breast Cancer Undergoing Treatment With Nab-paclitaxel and Carboplatin Active, not recruiting NCT02620280 Phase 3 Carboplatin;Abraxane;MPDL3280A;Anthra
41 Alternate Approaches for Clinical Stage II or III Estrogen Receptor Positive Breast Cancer Neoadjuvant Treatment (ALTERNATE) in Postmenopausal Women: A Phase III Study Active, not recruiting NCT01953588 Phase 3 fulvestrant;anastrozole
42 A Phase III, Randomized Clinical Trial of Standard Adjuvant Endocrine Therapy +/- Chemotherapy in Patients With 1-3 Positive Nodes, Hormone Receptor-Positive and HER2-Negative Breast Cancer With Recurrence Score (RS) of 25 or Less. RxPONDER: A Clinical Trial Rx for Positive Node, Endocrine Responsive Breast Cancer Active, not recruiting NCT01272037 Phase 3 Anastrozole;Exemestane;Letrozole;Systemic Chemotherapy;Tamoxifen Citrate
43 A Prospective, Randomized, Open-label Comparison of Preoperative Weekly Paclitaxel and Cisplatin With or Without Endocrine Therapy in Patients With Operable Hormone Receptor Positive and Triple Negative Locally Advanced Breast Cancer Active, not recruiting NCT02221999 Phase 2, Phase 3 Paclitaxel;Cisplatin;Gonadotropin-releasing hormone agonist;Letrozole
44 A Phase III Trial of Accelerated Whole Breast Irradiation With Hypofractionation Plus Concurrent Boost Versus Standard Whole Breast Irradiation Plus Sequential Boost for Early-Stage Breast Cancer Active, not recruiting NCT01349322 Phase 3
45 International Breast Cancer Intervention Study Active, not recruiting NCT00078832 Phase 3 anastrozole;placebo
46 MINDACT (Microarray In Node-Negative and 1 to 3 Positive Lymph Node Disease May Avoid Chemotherapy): A Prospective, Randomized Study Comparing the 70-Gene Signature With the Common Clinical-Pathological Criteria in Selecting Patients for Adjuvant Chemotherapy in Breast Cancer With 0 to 3 Positive Nodes Active, not recruiting NCT00433589 Phase 3 anthracycline-based;docetaxel and capecitabine
47 A Phase III Clinical Trial Comparing the Combination of Docetaxel Plus Cyclophosphamide to Anthracycline-Based Chemotherapy Regimens for Women With Node-Positive or High-Risk Node-Negative, HER2-Negative Breast Cancer Active, not recruiting NCT01547741 Phase 3 Doxorubicin;Cyclophosphamide;Docetaxel;Paclitaxel
48 International Breast Cancer Intervention Study: A Multicentre Trial of Tamoxifen to Prevent Breast Cancer Active, not recruiting NCT00002644 Phase 3 Tamoxifen Citrate 20Mg Tab
49 A Randomized Phase III Trial of Adjuvant Therapy Comparing Chemotherapy Alone (Six Cycles of Docetaxel Plus Cyclophosphamide or Four Cycles of Doxorubicin Plus Cyclophosphamide Followed by Weekly Paclitaxel) to Chemotherapy Plus Trastuzumab in Women With Node-Positive or High-Risk Node-Negative HER2-Low Invasive Breast Cancer Active, not recruiting NCT01275677 Phase 3 Cyclophosphamide;Docetaxel;Doxorubicin;Doxorubicin Hydrochloride;Paclitaxel
50 Evaluation of the LightPath® Imaging System and the PET Tracer 68Ga-RM2 in Wide Local Excision (WLE) for Breast Cancer Not yet recruiting NCT03731026 Phase 3 68Ga-RM2

Search NIH Clinical Center for Breast Ductal Carcinoma

Cochrane evidence based reviews: carcinoma, ductal

Genetic Tests for Breast Ductal Carcinoma

Anatomical Context for Breast Ductal Carcinoma

MalaCards organs/tissues related to Breast Ductal Carcinoma:

40
Breast, Lymph Node, Testes, Pancreas, Liver, Salivary Gland, Skin

Publications for Breast Ductal Carcinoma

Articles related to Breast Ductal Carcinoma:

(show top 50) (show all 1781)
# Title Authors PMID Year
1
Mutations in the RAD54 recombination gene in primary cancers. 6
10362365 1999
2
Concomitant expression of epithelial-mesenchymal transition biomarkers in breast ductal carcinoma: association with progression. 61 54
20043090 2010
3
E-cadherin expression in estrogen receptor-positive and negative breast carcinomas of postmenopausal women. 61 54
20349789 2010
4
[Relationship of ezrin protein expression to the carcinogenesis and prognosis of infitrating breast ductal carcinoma]. 61 54
18788632 2008
5
[Clinicopathologic significance of chromosome 17 polysomy in breast cancer]. 54 61
18681318 2008
6
P63 and cytokeratin8/18 expression in breast, atypical ductal hyperplasia, ductal carcinoma in situ and invasive duct carcinoma. 54 61
19190693 2007
7
A mutation in the 5' untranslated region of the BRCA1 gene in sporadic breast cancer causes downregulation of translation efficiency. 54 61
17697535 2007
8
Promoter hypermethylation of TMS1, BRCA1, ERalpha and PRB in serum and tumor DNA of invasive ductal breast carcinoma patients. 61 54
17599361 2007
9
Correlation of HER-2/neu protein overexpression with other prognostic and predictive factors in invasive ductal breast cancer. 61 54
17708365 2007
10
Identification of a basal-like subtype of breast ductal carcinoma in situ. 54 61
17234468 2007
11
Expression of nm23, MMP-2, TIMP-2 in breast neoplasm in Zhengzhou Center Hospital, China. 54 61
17642161 2007
12
An expression signature of syndecan-1 (CD138), E-cadherin and c-met is associated with factors of angiogenesis and lymphangiogenesis in ductal breast carcinoma in situ. 61 54
17244359 2007
13
CD44 expression and axillary lymph node metastasis in infiltrating ductal carcinoma of the breast. 61 54
18376796 2006
14
E-cadherin immunohistochemical expression as a prognostic factor in infiltrating ductal carcinoma of the breast: a systematic review and meta-analysis. 61 54
16791476 2006
15
Smad4-expression is decreased in breast cancer tissues: a retrospective study. 61 54
16438724 2006
16
Localisation of COX-2 protein is different in breast ductal carcinoma and adjacent non-tumour ductal epithelium. 61 54
16131446 2005
17
Expression of hypoxia-inducible factor (HIF-1alpha), VEGF-C and VEGF-D in non-invasive and invasive breast ductal carcinomas. 61 54
16080559 2005
18
Transient transfection of epidermal growth factor receptor gene into MCF7 breast ductal carcinoma cell line. 54 61
15584089 2005
19
PPARgamma expression in breast cancer: clinical value and correlation with ERbeta. 61 54
15656884 2005
20
Correlation of KIT and EGFR overexpression with invasive ductal breast carcinoma of the solid-tubular subtype, nuclear grade 3, and mesenchymal or myoepithelial differentiation. 54 61
15649255 2005
21
The prognostic value of p53 and c-erbB-2 expression, proliferative activity and angiogenesis in node-negative breast carcinoma. 54 61
15850004 2005
22
Real-time quantitative PCR of microdissected paraffin-embedded breast carcinoma: an alternative method for HER-2/neu analysis. 54 61
14736826 2004
23
Immunohistochemical status of p53, MDM2, bcl2, bax, and ER in invasive ductal breast carcinoma in Tunisian patients. 61 54
15033823 2003
24
Hypoxia promotes a dedifferentiated phenotype in ductal breast carcinoma in situ. 54 61
12670886 2003
25
The epithelial-specific ETS transcription factor ESX/ESE-1/Elf-3 modulates breast cancer-associated gene expression. 61 54
12713734 2003
26
Detection of RASSF1A aberrant promoter hypermethylation in sputum from chronic smokers and ductal carcinoma in situ from breast cancer patients. 61 54
12527916 2003
27
Cell proliferation, nuclear ploidy, and EGFr and HER2/neu tyrosine kinase oncoproteins in infiltrating ductal breast carcinoma. 54 61
12419588 2002
28
The angiogenic and lymphangiogenic factor vascular endothelial growth factor-D exhibits a paracrine mode of action in cancer. 61 54
12148568 2002
29
p63 expression in normal, hyperplastic and malignant breast tissues. 61 54
12185332 2002
30
p53 gene alteration and protein expression in Iranian women with infiltrative ductal breast carcinoma. 54 61
11410327 2001
31
pS2 expression in infiltrating ductal carcinoma of the breast correlates with oestrogen receptor positivity but not with histological grade and lymph node status. 54 61
11523925 2001
32
The prognostic significance of P-cadherin in infiltrating ductal breast carcinoma. 54 61
11454996 2001
33
Expression of p21Waf1, p27Kip1 and cyclin D1 proteins in breast ductal carcinoma in situ: Relation with clinicopathologic characteristics and with p53 expression and estrogen receptor status. 61 54
11169147 2001
34
Salivary duct carcinoma--a highly aggressive salivary gland tumor with HER-2/neu oncoprotein overexpression. 61 54
11569926 2001
35
Cytokeratin 8 immunostaining pattern and E-cadherin expression distinguish lobular from ductal breast carcinoma. 61 54
10941333 2000
36
Bcl-2 with loss of apoptosis allows accumulation of genetic alterations: a pathway to metastatic progression in human breast cancer. 54 61
10754491 2000
37
Cyclin D1 overexpression in a model of human breast premalignancy: preferential stimulation of anchorage-independent but not anchorage-dependent growth is associated with increased cdk2 activity. 61 54
10752677 2000
38
Expression of glycodelin in human breast and breast cancer. 61 54
10597188 1999
39
A comparison of the pattern of cathepsin-D expression in fibroadenoma, fibrocystic disease, preinvasive and invasive ductal breast carcinoma. 54 61
10503271 1999
40
[Immunohistochemical tumor markers in infiltrating ductal breast carcinoma]. 54 61
10030093 1998
41
CD44 isoform expression follows two alternative splicing pathways in breast tissue. 54 61
9665479 1998
42
p53 protein expression in benign and malignant breast lesions. 61 54
9684577 1998
43
Prospective studies of p53 and c-erbB-2 expression in relation to clinicopathological parameters of human ductal breast cancer in the second stage of clinical advancement. 54 61
9568187 1998
44
[Mammary carcinoma in a patient with hyperprolactinemia]. 61 54
9586418 1997
45
Thrombospondin-1 and -2 messenger RNA expression in normal, benign, and neoplastic human breast tissues: correlation with prognostic factors, tumor angiogenesis, and fibroblastic desmoplasia. 54 61
9012463 1997
46
The intermediate filaments and prognostically oriented morphological classification in ductal breast carcinoma. 61 54
9605010 1997
47
Chromosome 1 aneusomy with 1p36 under-representation is related to histologic grade, DNA aneuploidy, high c-erb B-2 and loss of bcl-2 expression in ductal breast carcinoma. 54 61
8900371 1996
48
Reciprocal expression of Bcl-2 and p53 in breast ductal carcinoma. 54 61
8917421 1996
49
Histological grade in invasive ductal carcinoma of breast correlates with the proliferative activity evaluated by BrdU: an immunohistochemical study including correlations with p53, c-erbB-2 and estrogen receptor status. 61 54
8869993 1996
50
Relationship between c-erbB-2 oncoprotein, epidermal growth factor receptor, and estrogen receptor expression in patients with ductal breast carcinoma. Association with tumor phenotypes. 61 54
8744803 1996

Variations for Breast Ductal Carcinoma

ClinVar genetic disease variations for Breast Ductal Carcinoma:

6 (show top 50) (show all 258) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 RAD54L NM_003579.4(RAD54L):c.973G>A (p.Gly325Arg)SNV Pathogenic 6193 rs121908690 1:46733212-46733212 1:46267540-46267540
2 CCDC180 NM_020893.4(CCDC180):c.1975C>G (p.Pro659Ala)SNV Uncertain significance 221302 rs869025225 9:100092618-100092618 9:97330336-97330336
3 MICAL2 NM_014632.4(MICAL2):c.3131A>G (p.Asp1044Gly)SNV Uncertain significance 221304 rs869025227 11:12278507-12278507 11:12256960-12256960
4 CORO6 NM_032854.3(CORO6):c.1348G>A (p.Val450Met)SNV Uncertain significance 221307 rs772136445 17:27942821-27942821 17:29615803-29615803
5 CPAMD8 NM_015692.5(CPAMD8):c.4015G>A (p.Ala1339Thr)SNV Uncertain significance 221309 rs869025231 19:17017774-17017774 19:16906964-16906964
6 ZNF473 NM_015428.4(ZNF473):c.2359A>T (p.Arg787Ter)SNV Uncertain significance 221311 rs869025232 19:50550059-50550059 19:50046802-50046802
7 CCDC71L NM_175884.6(CCDC71L):c.478A>C (p.Ser160Arg)SNV Uncertain significance 221313 rs869025233 7:106300865-106300865 7:106660419-106660419
8 CREB3 NM_006368.5(CREB3):c.823T>G (p.Tyr275Asp)SNV Uncertain significance 221316 rs869025236 9:35736430-35736430 9:35736433-35736433
9 KNDC1 NM_152643.8(KNDC1):c.2914G>T (p.Glu972Ter)SNV Uncertain significance 221318 rs869025238 10:135013889-135013889 10:133200385-133200385
10 ARHGAP35 NM_004491.5(ARHGAP35):c.1959_1960delinsAA (p.Pro654Thr)indel Uncertain significance 221320 rs869312173 19:47423891-47423892 19:46920634-46920635
11 FUBP1 NM_003902.5(FUBP1):c.1611G>A (p.Trp537Ter)SNV Uncertain significance 221322 rs869025239 1:78422351-78422351 1:77956666-77956666
12 CPXM2 NM_198148.3(CPXM2):c.497G>A (p.Gly166Glu)SNV Uncertain significance 221324 rs869025241 10:125622146-125622146 10:123862630-123862630
13 NTS NM_006183.5(NTS):c.185G>A (p.Cys62Tyr)SNV Uncertain significance 221327 rs869025243 12:86272172-86272172 12:85878394-85878394
14 covers 16 genes, none of which curated to show dosage sensitivity chr17:45008570..45994044 complex variantcomplex Uncertain significance 221347 17:45008570-45994044
15 CDH7 , HMSD , SERPINB10 , SERPINB11 , SERPINB2 , SERPINB7 , SERPINB8 complex Uncertain significance 221348 18:61387312-63489378
16 covers 25 genes, none of which curated to show dosage sensitivity complex Uncertain significance 221349 19:9001833-10085054
17 PML NM_033238.3(PML):c.2264G>C (p.Arg755Pro)SNV Uncertain significance 221319 rs780746013 15:74336964-74336964 15:74044623-74044623
18 RRP1 NM_003683.6(RRP1):c.340C>T (p.Arg114Cys)SNV Uncertain significance 221321 rs763767114 21:45213265-45213265 21:43793384-43793384
19 subset of 326 genes: ACD , ANKRD11 , CDH1 , CTCF , FOXC2 , FOXF1 complex Uncertain significance 221345 16:56368689-90141355
20 RNF212 NM_001131034.4(RNF212):c.314T>C (p.Leu105Ser)SNV Uncertain significance 221323 rs869025240 4:1079732-1079732 4:1085944-1085944
21 subset of 43 genes: PMP22 complex Uncertain significance 221346 17:9586165-16325968
22 ZNF420 NM_144689.5(ZNF420):c.362A>G (p.Asn121Ser)SNV Uncertain significance 221310 rs771433810 19:37618255-37618255 19:37127353-37127353
23 CACNA1C NM_000719.7(CACNA1C):c.5143C>T (p.Arg1715Trp)SNV Uncertain significance 221325 rs373996684 12:2788661-2788661 12:2679495-2679495
24 KRTAP10-3 NM_198696.3(KRTAP10-3):c.7A>G (p.Thr3Ala)SNV Uncertain significance 221312 rs452472 21:45978592-45978592 21:44558709-44558709
25 ABCC9 NM_005691.3(ABCC9):c.2663G>T (p.Gly888Val)SNV Uncertain significance 221326 rs869025242 12:22005137-22005137 12:21852203-21852203
26 HTRA2 NM_013247.4(HTRA2):c.695T>A (p.Leu232Gln)SNV Uncertain significance 221314 rs869025234 2:74757932-74757932 2:74530805-74530805
27 LRAT NM_004744.5(LRAT):c.78T>A (p.Ser26Arg)SNV Uncertain significance 221315 rs869025235 4:155665556-155665556 4:154744404-154744404
28 CNNM1 NM_020348.3(CNNM1):c.957G>C (p.Glu319Asp)SNV Uncertain significance 221303 rs869025226 10:101090101-101090101 10:99330344-99330344
29 ALOX5 NM_000698.5(ALOX5):c.490T>G (p.Leu164Val)SNV Uncertain significance 221317 rs869025237 10:45907697-45907697 10:45412249-45412249
30 KDM4E NM_001161630.1(KDM4E):c.1493A>G (p.Asn498Ser)SNV Uncertain significance 221305 rs869025228 11:94760214-94760214 11:95027050-95027050
31 TSPAN8 NM_004616.3(TSPAN8):c.528T>A (p.Asp176Glu)SNV Uncertain significance 221306 rs869025229 12:71526521-71526521 12:71132741-71132741
32 NOTCH3 NM_000435.3(NOTCH3):c.5161T>A (p.Trp1721Arg)SNV Uncertain significance 221308 rs869025230 19:15280935-15280935 19:15170124-15170124
33 SYT6 NM_001253772.2(SYT6):c.1471G>A (p.Ala491Thr)SNV Uncertain significance 221298 rs142164979 1:114640393-114640393 1:114097771-114097771
34 ZDBF2 NM_020923.3(ZDBF2):c.5795G>A (p.Arg1932His)SNV Uncertain significance 221299 rs763186071 2:207175047-207175047 2:206310323-206310323
35 YEATS2 NM_018023.5(YEATS2):c.3131C>T (p.Pro1044Leu)SNV Uncertain significance 221300 rs376025260 3:183515744-183515744 3:183797956-183797956
36 PHF24 NM_001304333.3(PHF24):c.242G>A (p.Arg81Gln)SNV Uncertain significance 221301 rs374394658 9:34971537-34971537 9:34971540-34971540
37 CACNA1H NM_021098.3(CACNA1H):c.1624G>A (p.Glu542Lys)SNV Uncertain significance 221328 rs761025927 16:1252074-1252074 16:1202074-1202074
38 AMFR NM_001144.6(AMFR):c.1786C>T (p.Arg596Cys)SNV Uncertain significance 221329 rs869025244 16:56396967-56396967 16:56363055-56363055
39 SPEN NM_015001.3(SPEN):c.6999_7014del (p.Gln2333fs)deletion Uncertain significance 221330 rs869312174 1:16259732-16259747 1:15933237-15933252
40 AKAP1 NM_003488.4(AKAP1):c.946_966GGCTTGGATAGAAATGAGGAG[1] (p.316_322GLDRNEE[1])short repeat Uncertain significance 221331 rs746089021 17:55183751-55183771 17:57106390-57106410
41 SLITRK6 NM_032229.3(SLITRK6):c.1915dup (p.Tyr639fs)duplication Uncertain significance 221332 rs869312872 13:86368728-86368729 13:85794593-85794594
42 RP1 NM_006269.2(RP1):c.5001del (p.Arg1668fs)deletion Uncertain significance 221333 rs869320622 8:55541442-55541442 8:54628882-54628882
43 subset of 318 genes: CAMTA1 , CASZ1 , GNB1 , SDHB , SPEN complex Uncertain significance 221334 1:909238-24706269
44 IBA57 , OBSCN complex Uncertain significance 221335 1:228353651-228547901
45 ZNF717 complex Uncertain significance 221336 3:75786278-75790822
46 DSPP complex Uncertain significance 221337 4:88537268-88537420
47 HLA-A , POLR1H , PPP1R11 , RNF39 , TRIM31 chr6:29910378..30075843 complex variantcomplex Uncertain significance 221338 6:29910378-30075843
48 CCHCR1 , CDSN , HLA-B , HLA-C , POU5F1 , PSORS1C1 , PSORS1C2 , TCF19 complex Uncertain significance 221339 6:31085200-31324647
49 BTNL2 , HLA-DQA1 , HLA-DQB1 , HLA-DRA , HLA-DRB1 , HLA-DRB5 , NOTCH4 , TSBP1 complex Uncertain significance 221340 6:32188383-32629802
50 KRBA1 , ZNF467 , ZNF746 , ZNF777 complex Uncertain significance 221341 7:149152906-149518148

Cosmic variations for Breast Ductal Carcinoma:

9 (show top 50) (show all 14495)
# Cosmic Mut ID Gene Symbol COSMIC Disease Classification
(Primary site, Site subtype, Primary histology, Histology subtype)
Mutation CDS Mutation AA GRCh38 Location Conf
1 COSM103978702 ZSWIM8 breast,NS,carcinoma,ductal carcinoma c.3423G>A p.K1141= 10:73797261-73797261 12
2 COSM88263804 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.1084G>A p.E362K 23:15822877-15822877 12
3 COSM88263027 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.1406C>T p.S469L 23:15823199-15823199 12
4 COSM88262392 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.1312G>T p.G438C 23:15823105-15823105 12
5 COSM88264460 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.267G>C p.K89N 23:15803751-15803751 12
6 COSM88263630 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.989A>G p.H330R 23:15822782-15822782 12
7 COSM90724063 ZNHIT2 breast,NS,carcinoma,ductal carcinoma c.175G>C p.A59P 11:65117479-65117479 12
8 COSM96875678 ZNF830 breast,NS,carcinoma,ductal carcinoma c.136A>G p.N46D 17:34961702-34961702 12
9 COSM131594768 ZNF668 breast,NS,carcinoma,ductal carcinoma c.925G>A p.G309S 16:31062072-31062072 12
10 COSM131594485 ZNF668 breast,NS,carcinoma,ductal carcinoma c.265G>A p.A89T 16:31064264-31064264 12
11 COSM131594753 ZNF668 breast,NS,carcinoma,ductal carcinoma c.1061C>G p.T354R 16:31061936-31061936 12
12 COSM87511923 ZNF646 breast,NS,carcinoma,ductal carcinoma c.4010A>T p.N1337I 16:31080334-31080334 12
13 COSM91884936 ZNF644 breast,NS,carcinoma,ductal carcinoma c.157G>C p.E53Q 1:90941197-90941197 12
14 COSM91675445 ZNF569 breast,NS,carcinoma,ductal carcinoma c.85C>G p.Q29E 19:37426309-37426309 12
15 COSM90464551 ZNF548 breast,NS,carcinoma,ductal carcinoma c.70G>T p.D24Y 19:57397066-57397066 12
16 COSM90396499 ZNF532 breast,NS,carcinoma,ductal carcinoma c.2465C>T p.S822L 18:58934551-58934551 12
17 COSM110929997 ZNF438 breast,NS,carcinoma,ductal carcinoma c.1143G>C p.K381N 10:30849262-30849262 12
18 COSM94396575 ZNF318 breast,NS,carcinoma,ductal carcinoma c.3820G>C p.G1274R 6:43340178-43340178 12
19 COSM151995735 ZNF281 breast,NS,carcinoma,ductal carcinoma c.1580T>C p.I527T 1:200408126-200408126 12
20 COSM96397396 ZNF277 breast,NS,carcinoma,ductal carcinoma c.994A>T p.I332L 7:112339870-112339870 12
21 COSM96397829 ZNF277 breast,NS,carcinoma,ductal carcinoma c.1335G>C p.L445F 7:112342711-112342711 12
22 COSM84780336 ZNF25 breast,NS,carcinoma,ductal carcinoma c.61G>A p.E21K 10:37957501-37957501 12
23 COSM85593612 ZNF22 breast,NS,carcinoma,ductal carcinoma c.386A>T p.H129L 10:45003754-45003754 12
24 COSM84450409 ZNF10 breast,NS,carcinoma,ductal carcinoma c.257-3C>G p.? 12:133155500-133155500 12
25 COSM89538255 ZMIZ2 breast,NS,carcinoma,ductal carcinoma c.491C>G p.A164G 7:44757500-44757500 12
26 COSM93630414 ZMIZ1 breast,NS,carcinoma,ductal carcinoma c.1651C>G p.L551V 10:79298565-79298565 12
27 COSM91882084 ZKSCAN2 breast,NS,carcinoma,ductal carcinoma c.1258G>A p.E420K 16:25246938-25246938 12
28 COSM88071852 ZIC3 breast,NS,carcinoma,ductal carcinoma c.649C>G p.P217A 23:137567340-137567340 12
29 COSM92035915 ZFYVE26 breast,NS,carcinoma,ductal carcinoma c.3491C>A p.A1164E 14:67785091-67785091 12
30 COSM127364269 ZFHX4 breast,NS,carcinoma,ductal carcinoma c.5524G>A p.V1842M 8:76852445-76852445 12
31 COSM127404443 ZFHX4 breast,NS,carcinoma,ductal carcinoma c.9752C>G p.A3251G 8:76863466-76863466 12
32 COSM149267307 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.4750C>T p.Q1584* 16:72797932-72797932 12
33 COSM149287746 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.1444G>A p.E482K 16:72958702-72958702 12
34 COSM149331846 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.8798C>G p.S2933C 16:72793884-72793884 12
35 COSM149268828 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.9095A>C p.K3032T 16:72793587-72793587 12
36 COSM149318805 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.6871C>T p.Q2291* 16:72795811-72795811 12
37 COSM149302170 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.8043G>C p.K2681N 16:72794639-72794639 12
38 COSM149270810 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.10111C>A p.L3371M 16:72788165-72788165 12
39 COSM149266476 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.4468G>A p.E1490K 16:72798214-72798214 12
40 COSM149259623 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.7667C>T p.A2556V 16:72795015-72795015 12
41 COSM149281651 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.2143C>T p.R715* 16:72958003-72958003 12
42 COSM149328006 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.2714C>G p.A905G 16:72957432-72957432 12
43 COSM149323407 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.7789C>A p.P2597T 16:72794893-72794893 12
44 COSM149288364 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.3757C>T p.R1253C 16:72811684-72811684 12
45 COSM149295256 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.611T>G p.F204C 16:72959535-72959535 12
46 COSM99904315 ZFC3H1 breast,NS,carcinoma,ductal carcinoma c.2306C>A p.A769D 12:71634758-71634758 12
47 COSM99576910 ZDHHC4 breast,NS,carcinoma,ductal carcinoma c.310C>T p.P104S 7:6582191-6582191 12
48 COSM97880763 ZCCHC24 breast,NS,carcinoma,ductal carcinoma c.725G>C p.*242Sext*112 10:79386346-79386346 12
49 COSM87425586 ZCCHC14 breast,NS,carcinoma,ductal carcinoma c.868C>G p.L290V 16:87417564-87417564 12
50 COSM87030274 ZBTB39 breast,NS,carcinoma,ductal carcinoma c.295G>A p.V99I 12:57004623-57004623 12

Copy number variations for Breast Ductal Carcinoma from CNVD:

7 (show all 33)
# CNVD ID Chromosome Start End Type Gene Symbol CNVD Disease
1 50888 11 119630000 120260000 Deletion Ductal carcinoma
2 57116 11 63100000 76700000 Amplification CCND1 Ductal carcinoma
3 58629 11 68930000 70160000 Gain Ductal carcinoma
4 58724 11 69230000 69780000 Gain Ductal carcinoma
5 59882 11 78860000 79330000 Deletion Ductal carcinoma
6 60225 11 84000000 88080000 Deletion Ductal carcinoma
7 60766 11 91240000 95940000 Deletion Ductal carcinoma
8 66468 12 2966849 2986303 Copy number FOXM1 Ductal carcinoma
9 98103 16 15360000 17700000 Gain Ductal carcinoma
10 99317 16 25030000 27880000 Gain Ductal carcinoma
11 101507 16 40000 40090000 Gain Ductal carcinoma
12 107663 17 16530000 18020000 Deletion Ductal carcinoma
13 109740 17 28800000 35400000 Amplification ERBB2 Ductal carcinoma
14 116392 17 6500000 10700000 Copy number TP53 Ductal carcinoma
15 117043 17 70920000 72340000 Gain Ductal carcinoma
16 126771 19 20810000 63790000 Gain Ductal carcinoma
17 127047 19 23780000 51950000 Gain Ductal carcinoma
18 128079 19 39420000 40350000 Gain Ductal carcinoma
19 131070 19 52760000 63790000 Gain Ductal carcinoma
20 153161 20 34860000 62370000 Gain Ductal carcinoma
21 153748 20 41100000 62435964 Amplification BMP7 Ductal carcinoma
22 166731 3 107740000 107880000 Deletion Ductal carcinoma
23 166830 3 108620000 110660000 Deletion Ductal carcinoma
24 167069 3 112930000 115910000 Deletion Ductal carcinoma
25 179845 3 99790000 104540000 Deletion Ductal carcinoma
26 196641 5 170120000 170210000 Gain Ductal carcinoma
27 196700 5 170690000 172750000 Gain Ductal carcinoma
28 215548 6 77380000 82650000 Deletion Ductal carcinoma
29 231989 8 110000 5150000 Deletion Ductal carcinoma
30 233354 8 124380000 129070000 Gain Ductal carcinoma
31 234986 8 140450000 141700000 Gain Ductal carcinoma
32 238072 8 29700000 38500000 Amplification FGFR1 Ductal carcinoma
33 239766 8 41480000 42480000 Gain Ductal carcinoma

Expression for Breast Ductal Carcinoma

Search GEO for disease gene expression data for Breast Ductal Carcinoma.

Pathways for Breast Ductal Carcinoma

Pathways related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

(show top 50) (show all 54)
# Super pathways Score Top Affiliating Genes
1
Show member pathways
13.72 VEGFD TP53 PIP ESR1 ERBB2 EGFR
2
Show member pathways
13.28 VEGFD ESR1 ERBB2 EGFR CTNNB1 CDH3
3
Show member pathways
12.92 VEGFD TP53 ERBB2 EGFR CTNNB1 CCND1
4
Show member pathways
12.87 TP53 ERBB2 EGFR CTNNB1 CDH1 CCND1
5
Show member pathways
12.72 TP53 ESR1 ERBB2 CTNNB1 CDH1
6 12.58 VEGFD TP53 ESR1 ERBB2 EGFR CTNNB1
7
Show member pathways
12.55 TP53 ESR1 ERBB2 EGFR CDH1 CCND1
8 12.54 TP53 ERBB2 EGFR CCND1 BRCA1
9
Show member pathways
12.51 VEGFD TFF1 PGR KRT19 ESR1 EGFR
10 12.5 TP53 RAD54L MKI67 CCND1 BRCA1
11
Show member pathways
12.44 TP53 ERBB2 EGFR CTNNB1
12
Show member pathways
12.41 VEGFD ERBB2 EGFR CTNNB1 CDH1
13 12.39 TP53 CTNNB1 CDH3 CDH1 CCND1
14
Show member pathways
12.32 ERBB2 EGFR CTNNB1 CDH1
15
Show member pathways
12.28 TP53 PGR ESR1 ERBB2 EGFR CTNNB1
16
Show member pathways
12.27 TFF1 ESR1 ERBB2 EGFR CCND1
17
Show member pathways
12.24 TP53 ERBB2 EGFR CTNNB1 CCND1
18
Show member pathways
12.23 PGR ESR1 CCND1 BRCA1
19 12.11 TP53 ESR1 ERBB2 EGFR CTNNB1 CCND1
20 12.09 TP53 EGFR CTNNB1 CDH1 CCND1
21 12.01 TFF1 CTNNB1 CDH3 CDH1
22 12 TP53 ESR1 CTNNB1 CCND1
23 11.95 TP53 ERBB2 CTNNB1 CCND1
24 11.92 TP53 EGFR CTNNB1 CCND1
25
Show member pathways
11.9 PGR ESR1 ERBB2 EGFR
26 11.82 EGFR CTNNB1 CCND1 BRCA1
27 11.79 CTNNB1 CDH1 CCND1
28 11.75 MKI67 KRT8 CTNNB1
29 11.75 TP53 ERBB2 BRCA1
30
Show member pathways
11.73 ESR1 EGFR CCND1
31 11.72 TP53 ERBB2 EGFR
32 11.71 ERBB2 EGFR CTNNB1
33 11.69 ESR1 EGFR CCND1
34 11.69 TP53 ERBB2 BRCA1
35 11.65 ERBB2 CCND1 BRCA1
36 11.65 ERBB2 EGFR CTNNB1 CDH1
37 11.62 CTNNB1 CCND1 BRCA1
38 11.56 TP53 EGFR CCND1
39 11.56 TP53 CCND1 BRCA1
40
Show member pathways
11.51 TFF1 ESR1 BRCA1
41 11.49 TP53 CCND1 BRCA1
42 11.48 NME1 CTNNB1 CDH1
43 11.46 TP53 ESR1 CTSD
44 11.43 EGFR CTNNB1 CDH1
45 11.43 CTNNB1 CDH3 CDH1
46 11.42 TP53 ERBB2 EGFR CDH1 CCND1
47 11.41 TP53 RAD54L ESR1 EGFR CTNNB1 CDH1
48 11.32 TP53 EGFR CTNNB1
49 11.3 TP53 KRT8 KRT19 ESR1
50 11.29 TP53 CCND1 BRCA1

GO Terms for Breast Ductal Carcinoma

Cellular components related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 nucleus GO:0005634 10.17 ZFAS1 TP53 RAD54L PIP PGR NME1
2 cell periphery GO:0071944 9.43 KRT8 KRT19 CTNNB1
3 protein-containing complex GO:0032991 9.43 TP53 RAD54L ESR1 EGFR CTNNB1 BRCA1
4 flotillin complex GO:0016600 9.16 CTNNB1 CDH1
5 catenin complex GO:0016342 8.8 CTNNB1 CDH3 CDH1

Biological processes related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

(show all 27)
# Name GO ID Score Top Affiliating Genes
1 regulation of transcription by RNA polymerase II GO:0006357 10.11 TP53 ESR1 ERBB2 EGFR CTNNB1 BRCA1
2 positive regulation of transcription, DNA-templated GO:0045893 9.97 TP53 ESR1 EGFR CTNNB1 CDH1 BRCA1
3 regulation of cell proliferation GO:0042127 9.91 TP53 EGFR CTNNB1 BRCA1
4 positive regulation of protein phosphorylation GO:0001934 9.86 VEGFD ERBB2 EGFR CCND1
5 negative regulation of gene expression GO:0010629 9.85 TP53 PGR NME1 ESR1 CTNNB1
6 cell-cell adhesion GO:0098609 9.81 EGFR CTNNB1 CDH3 CDH1
7 regulation of apoptotic process GO:0042981 9.8 TP53 NME1 ESR1 CTNNB1 BRCA1
8 positive regulation of gene expression GO:0010628 9.8 TP53 PIP ERBB2 CTNNB1 CDH3 BRCA1
9 cellular response to growth factor stimulus GO:0071363 9.79 ERBB2 EGFR CTNNB1
10 cellular response to drug GO:0035690 9.77 TP53 NME1 EGFR
11 double-strand break repair GO:0006302 9.77 TP53 RAD54L BRCA1
12 response to estradiol GO:0032355 9.67 ESR1 EGFR CTNNB1 CCND1
13 adherens junction organization GO:0034332 9.65 CTNNB1 CDH3 CDH1
14 positive regulation of production of miRNAs involved in gene silencing by miRNA GO:1903800 9.63 TP53 EGFR
15 positive regulation of RNA polymerase II transcriptional preinitiation complex assembly GO:0045899 9.62 TP53 ESR1
16 negative regulation of production of miRNAs involved in gene silencing by miRNA GO:1903799 9.62 TP53 ESR1
17 entry of bacterium into host cell GO:0035635 9.58 CTNNB1 CDH1
18 mitotic G1 DNA damage checkpoint GO:0031571 9.58 TP53 CCND1
19 DNA strand renaturation GO:0000733 9.57 TP53 RAD54L
20 positive regulation of epithelial cell proliferation GO:0050679 9.56 NME1 ERBB2 EGFR CCND1
21 negative regulation of ERBB signaling pathway GO:1901185 9.55 ERBB2 EGFR
22 cell differentiation involved in embryonic placenta development GO:0060706 9.54 KRT8 KRT19
23 hair cycle process GO:0022405 9.52 CTNNB1 CDH3
24 response to estrogen GO:0043627 9.46 KRT19 ESR1 CCND1 BRCA1
25 response to UV-A GO:0070141 9.43 EGFR CCND1
26 response to drug GO:0042493 9.17 TP53 RAD54L NME1 CTNNB1 CDH3 CDH1
27 cellular response to indole-3-methanol GO:0071681 9.13 CTNNB1 CDH1 BRCA1

Molecular functions related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 protein binding GO:0005515 10.32 VEGFD TP53 TFF1 RAD54L PIP PGR
2 protein kinase binding GO:0019901 9.8 TP53 ESR1 EGFR CTNNB1 CCND1
3 identical protein binding GO:0042802 9.65 VEGFD TP53 PIP PGR NME1 ESR1
4 ATPase binding GO:0051117 9.63 PGR ESR1 EGFR
5 beta-catenin binding GO:0008013 9.61 ESR1 CTNNB1 CDH1
6 protein phosphatase binding GO:0019903 9.46 TP53 ERBB2 EGFR CTNNB1
7 repressing transcription factor binding GO:0070491 9.43 PGR ESR1 CTNNB1
8 nitric-oxide synthase regulator activity GO:0030235 9.32 ESR1 EGFR
9 enzyme binding GO:0019899 9.23 TP53 PGR NME1 ESR1 EGFR CTNNB1

Sources for Breast Ductal Carcinoma

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....