MCID: BRS099
MIFTS: 63

Breast Ductal Carcinoma

Categories: Cancer diseases

Aliases & Classifications for Breast Ductal Carcinoma

MalaCards integrated aliases for Breast Ductal Carcinoma:

Name: Breast Ductal Carcinoma 12 15
Ductal Breast Carcinoma 55 6 72
Mammary Ductal Carcinoma 72
Carcinoma, Ductal 44
Ductal Carcinoma 72
Duct Carcinoma 12

Classifications:



External Ids:

Disease Ontology 12 DOID:3007
MeSH 44 D044584
SNOMED-CT 68 82711006
UMLS 72 C0021367 C1176475 C1527349

Summaries for Breast Ductal Carcinoma

Disease Ontology : 12 A breast carcinoma that derives from the lining of milk ducts.

MalaCards based summary : Breast Ductal Carcinoma, also known as ductal breast carcinoma, is related to bile duct cancer and breast cystic hypersecretory carcinoma. An important gene associated with Breast Ductal Carcinoma is RAD54L (RAD54 Like), and among its related pathways/superpathways are ERK Signaling and Nanog in Mammalian ESC Pluripotency. The drugs Vinorelbine and Pertuzumab have been mentioned in the context of this disorder. Affiliated tissues include breast, lymph node and testes, and related phenotypes are Decreased viability in esophageal squamous lineage and Decreased cell migration

Related Diseases for Breast Ductal Carcinoma

Diseases related to Breast Ductal Carcinoma via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 429)
# Related Disease Score Top Affiliating Genes
1 bile duct cancer 33.4 TP53 MET EGFR CCND1
2 breast cystic hypersecretory carcinoma 33.3 ERBB2 CDH1
3 intrahepatic cholangiocarcinoma 33.3 TP53 EGFR CTNNB1 CDH1
4 cholangiocarcinoma 31.4 TP53 TFF1 MET KRT8 ERBB2 EGFR
5 papillary adenocarcinoma 31.2 TP53 PGR ERBB2 CDH1
6 tubular adenocarcinoma 31.1 PGR ESR1 ERBB2 CDH1
7 pleomorphic adenoma 31.0 TP53 ERBB2 AR
8 cystadenocarcinoma 31.0 TP53 PGR ERBB2
9 in situ carcinoma 31.0 TP53 PGR ESR1 ERBB2 EGFR CDH1
10 pleomorphic adenoma carcinoma 30.9 TP53 ERBB2
11 adenocarcinoma 30.8 TP53 ERBB2 EGFR CTNNB1 CDH1 CCND1
12 comedo carcinoma 30.7 ESR1 ERBB2
13 renal cell carcinoma, papillary, 1 30.7 TP53 MET ERBB2
14 papillary carcinoma 30.7 PGR MET ERBB2 CDH1
15 transitional cell carcinoma 30.7 TP53 KRT8 ERBB2 EGFR CDH1
16 carcinosarcoma 30.6 TP53 PGR ERBB2 CTNNB1
17 adenoid cystic carcinoma 30.5 TP53 PGR ERBB2 CTNNB1 CDH1 CCND1
18 sporadic breast cancer 30.4 TP53 PGR ESR1 ERBB2 BRCA1
19 gallbladder cancer 30.3 TP53 NME1 ERBB2 EGFR CDH1
20 oral cancer 30.2 TP53 EGFR CDH1 CCND1
21 differentiated thyroid carcinoma 30.1 TP53 MET EGFR
22 breast adenocarcinoma 30.0 TP53 ESR1 ERBB2 EGFR CTSD
23 bladder urothelial carcinoma 30.0 TP53 ERBB2 CTNNB1 CDH1 CCND1
24 apocrine adenocarcinoma 29.9 PGR ESR1 ERBB2 AR
25 bladder cancer 29.9 ZFAS1 TP53 ERBB2 EGFR CDH1 CCND1
26 mammary paget's disease 29.8 PGR KRT8 ESR1 ERBB2 EGFR
27 breast fibroadenoma 29.8 PGR NME1 KRT8 ESR1 ERBB2
28 estrogen-receptor positive breast cancer 29.8 TP53 PGR ESR1 ERBB2 EGFR CCND1
29 nasopharyngeal carcinoma 29.8 TP53 NME1 EGFR CDH1 CCND1
30 lobular neoplasia 29.7 ESR1 ERBB2 CTNNB1 CDH1 BRCA1
31 adenosquamous carcinoma 29.7 TP53 KRT8 EGFR AR
32 sweat gland cancer 29.7 TP53 PGR KRT8 ESR1 ERBB2
33 renal cell carcinoma, nonpapillary 29.7 MET KRT8 EGFR CDH1
34 gastrointestinal system disease 29.6 TP53 ERBB2 EGFR CTNNB1 CDH1 CCND1
35 esophageal cancer 29.5 TP53 ERBB2 EGFR CTNNB1 CDH1 CCND1
36 pancreatic cancer 29.4 TP53 MET ERBB2 EGFR CTNNB1 CDH1
37 squamous cell carcinoma 29.4 TP53 NME1 ERBB2 EGFR CTNNB1 CDH1
38 prostatic hypertrophy 29.4 PGR ESR1 EGFR AR
39 hepatocellular carcinoma 29.3 ZFAS1 TP53 MET EGFR CTNNB1 CDH1
40 gastrointestinal system cancer 29.3 TP53 MET ERBB2 EGFR CTNNB1 CDH1
41 ductal carcinoma in situ 29.3 TP53 PGR KRT8 ESR1 ERBB2 EGFR
42 breast carcinoma in situ 29.2 TP53 PGR MET ESR1 ERBB2 EGFR
43 female breast cancer 29.1 TP53 PGR ESR1 ERBB2 BRCA1 AR
44 breast disease 28.7 TP53 TFF1 PGR ESR1 ERBB2 CTSD
45 gastric cancer 27.7 ZFAS1 TP53 TFF1 NME1 MET ERBB2
46 colorectal cancer 27.4 ZFAS1 TP53 NME1 MET ERBB2 EGFR
47 endometrial cancer 27.2 TP53 PGR ESR1 ERBB2 EGFR CTSD
48 prostate cancer 26.2 ZFAS1 TP53 MET KRT8 ESR1 ERBB2
49 breast cancer 25.6 ZFAS1 TP53 TFF1 RAD54L PIP PGR
50 collecting duct carcinoma 12.7

Graphical network of the top 20 diseases related to Breast Ductal Carcinoma:



Diseases related to Breast Ductal Carcinoma

Symptoms & Phenotypes for Breast Ductal Carcinoma

GenomeRNAi Phenotypes related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Decreased viability in esophageal squamous lineage GR00235-A 9.65 BRCA1 CCND1 CDH1 CTNNB1 ERBB2 ESR1
2 Decreased cell migration GR00055-A-1 9.55 CDH3 CTNNB1 CTSD EGFR MET
3 Increased cell death HMECs cells GR00103-A-0 9.1 BRCA1 CTNNB1 EGFR PGR PIP TP53

MGI Mouse Phenotypes related to Breast Ductal Carcinoma:

46 (show all 24)
# Description MGI Source Accession Score Top Affiliating Genes
1 cellular MP:0005384 10.46 AR BRCA1 CCND1 CDH1 CTNNB1 CTSD
2 endocrine/exocrine gland MP:0005379 10.46 AR BRCA1 CCND1 CDH1 CDH3 CTNNB1
3 digestive/alimentary MP:0005381 10.44 AR BRCA1 CCND1 CDH1 CTNNB1 CTSD
4 cardiovascular system MP:0005385 10.43 AR BRCA1 CCND1 CDH1 CTNNB1 EGFR
5 homeostasis/metabolism MP:0005376 10.43 AR BRCA1 CCND1 CDH1 CTNNB1 CTSD
6 growth/size/body region MP:0005378 10.42 AR BRCA1 CCND1 CDH1 CTNNB1 CTSD
7 immune system MP:0005387 10.39 AR BRCA1 CCND1 CDH1 CTNNB1 CTSD
8 mortality/aging MP:0010768 10.37 AR BRCA1 CCND1 CDH1 CTNNB1 CTSD
9 hematopoietic system MP:0005397 10.35 AR BRCA1 CCND1 CTNNB1 CTSD EGFR
10 integument MP:0010771 10.35 AR BRCA1 CCND1 CDH1 CDH3 CTNNB1
11 embryo MP:0005380 10.33 AR BRCA1 CDH1 CTNNB1 EGFR ERBB2
12 neoplasm MP:0002006 10.27 AR BRCA1 CCND1 CDH1 CTNNB1 EGFR
13 limbs/digits/tail MP:0005371 10.18 AR BRCA1 CTNNB1 EGFR ERBB2 ESR1
14 nervous system MP:0003631 10.17 AR BRCA1 CCND1 CTNNB1 CTSD EGFR
15 craniofacial MP:0005382 10.15 AR CCND1 CTNNB1 EGFR ERBB2 MET
16 normal MP:0002873 10.15 AR BRCA1 CCND1 CDH1 CTNNB1 EGFR
17 muscle MP:0005369 10.13 AR BRCA1 CTNNB1 EGFR ERBB2 ESR1
18 liver/biliary system MP:0005370 10.11 AR CTNNB1 EGFR ESR1 KRT8 MET
19 no phenotypic analysis MP:0003012 9.95 CDH1 CTNNB1 EGFR ESR1 MET PGR
20 reproductive system MP:0005389 9.93 AR BRCA1 CCND1 CDH1 CTNNB1 EGFR
21 renal/urinary system MP:0005367 9.8 AR BRCA1 CTNNB1 EGFR ESR1 MET
22 pigmentation MP:0001186 9.72 AR BRCA1 CTNNB1 EGFR TP53
23 respiratory system MP:0005388 9.56 BRCA1 CCND1 CTNNB1 EGFR ERBB2 ESR1
24 skeleton MP:0005390 9.28 AR BRCA1 CCND1 CTNNB1 EGFR ERBB2

Drugs & Therapeutics for Breast Ductal Carcinoma

Drugs for Breast Ductal Carcinoma (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 290)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Vinorelbine Approved, Investigational Phase 3 71486-22-1 60780 44424639
2
Pertuzumab Approved Phase 3 145040-37-5, 380610-27-5 2540
3
Lapatinib Approved, Investigational Phase 2, Phase 3 388082-78-8, 231277-92-2 208908 9941095
4
mometasone furoate Approved, Investigational, Vet_approved Phase 3 83919-23-7
5
Medroxyprogesterone acetate Approved, Investigational Phase 3 71-58-9
6
Octreotide Approved, Investigational Phase 3 83150-76-9 383414 6400441
7
Oxybutynin Approved, Investigational Phase 3 5633-20-5 4634
8
Gemcitabine Approved Phase 2, Phase 3 95058-81-4 60750
9
Cisplatin Approved Phase 2, Phase 3 15663-27-1 84093 441203 2767
10
Metformin Approved Phase 3 657-24-9 4091 14219
11
Sodium citrate Approved, Investigational Phase 3 68-04-2
12
Fulvestrant Approved, Investigational Phase 3 129453-61-8 104741 17756771
13
Tamoxifen Approved Phase 3 10540-29-1 2733526
14
Trastuzumab Approved, Investigational Phase 3 180288-69-1 9903
15
Progesterone Approved, Vet_approved Phase 3 57-83-0 5994
16
Docetaxel Approved, Investigational Phase 3 114977-28-5 148124
17
Triamcinolone Approved, Vet_approved Phase 3 124-94-7 31307
18
Paclitaxel Approved, Vet_approved Phase 3 33069-62-4 36314
19
Cyclophosphamide Approved, Investigational Phase 3 50-18-0, 6055-19-2 2907
20
Doxorubicin Approved, Investigational Phase 3 23214-92-8 31703
21
Carboplatin Approved Phase 3 41575-94-4 10339178 498142 38904
22
Epirubicin Approved Phase 3 56420-45-2 41867
23
Atezolizumab Approved, Investigational Phase 3 1380723-44-3
24
Hyaluronic acid Approved, Vet_approved Phase 3 9004-61-9 53477741
25
Exemestane Approved, Investigational Phase 3 107868-30-4 60198
26
Goserelin Approved Phase 2, Phase 3 65807-02-5, 1233494-97-7 47725 5311128
27
Leuprolide Approved, Investigational Phase 2, Phase 3 53714-56-0 3911 657181
28
Daunorubicin Approved Phase 3 20830-81-3 30323
29
Letrozole Approved, Investigational Phase 3 112809-51-5 3902
30
Toremifene Approved, Investigational Phase 3 89778-26-7 3005573
31
Citric acid Approved, Nutraceutical, Vet_approved Phase 3 77-92-9 311
32
Emodepside Investigational, Vet_approved Phase 3 155030-63-0
33 Atamestane Investigational Phase 3 96301-34-7
34 Peripheral Nervous System Agents Phase 3
35 Anti-Allergic Agents Phase 3
36 Contraceptive Agents, Male Phase 3
37
Medroxyprogesterone Phase 3 520-85-4 10631
38 Hematinics Phase 3
39 Neurotransmitter Agents Phase 3
40 Gastrointestinal Agents Phase 3
41 Autonomic Agents Phase 3
42 Parasympatholytics Phase 3
43 Cholinergic Agents Phase 3
44 Muscarinic Antagonists Phase 3
45 Mandelic Acids Phase 3
46 Renal Agents Phase 3
47 Cholinergic Antagonists Phase 3
48 Anti-Infective Agents, Urinary Phase 3
49 Ferric Compounds Phase 3
50 Antiviral Agents Phase 2, Phase 3

Interventional clinical trials:

(show top 50) (show all 390)
# Name Status NCT ID Phase Drugs
1 A Clinical Evaluation Of Adipose Derived Regenerative Cells In The Treatment Of Patients With BrEast Deformities Post Segmental Breast ResecTion (Lumpectomy) With Or Without Radiation ThErapy. A Phase IV Post Market Study. Completed NCT00616135 Phase 4
2 Phase IV Trial to Evaluate Breast Brachytherapy Using the Mammosite-Ml® Radiation Therapy Delivery System as the Sole Method of Radiation Therapy or as a Boost for Early Stage Breast Cancer and Ductal Carcinoma In Situ of the Breast Completed NCT01448447 Phase 4
3 Electronic Xoft Intersociety Brachytherapy Trial Completed NCT00742222 Phase 4
4 A Randomized Phase III Study to Investigate the Efficacy and Safety of Docetaxel + Capecitabine vs. Vinorelbine + Capecitabine Followed by Capecitabine Alone as 1st Therapy on Locally Advanced and Metastatic Breast Cancer Patients. Unknown status NCT01126138 Phase 3 Vinorelbine plus Capecitabine for 6 cycles, followed by Capecitabine;Docetaxel plus Capecitabine for 6 cycles, followed by Capecitabine
5 A Randomized Phase III Trial Comparing Nanoparticle-based Paclitaxel With Solvent-based Paclitaxel as Part of Neoadjuvant Chemotherapy for Patients With Early Breast Cancer (GeparSepto) Unknown status NCT01583426 Phase 3 nab-Paclitaxel;Paclitaxel
6 Randomized Phase Ⅲ Trial Comparing Dose-dense Epirubicin and Cyclophosphamide Followed by Paclitaxel With Paclitaxel Plus Carboplatin as Adjuvant Therapy for Triple-negative Breast Cancer. Unknown status NCT01378533 Phase 3 epirubicin, cyclophosphamide, paclitaxel, carboplatin, G-CSF
7 A Clinical Trial Comparing Anastrozole With Tamoxifen in Postmenopausal Patients With Ductal Carcinoma in Situ (DCIS) Undergoing Lumpectomy With Radiation Therapy Completed NCT00053898 Phase 3 anastrozole;tamoxifen citrate
8 Genetic Counseling for Newly Diagnosed Breast Cancer Patients Completed NCT00262899 Phase 3
9 Phase III Randomized Double-Blind Study of Mometasone Furoate Versus Placebo in the Prevention of Radiation Dermatitis in Breast Cancer Patients Receiving Radiation Therapy Completed NCT00438659 Phase 3 mometasone furoate
10 A Randomized Comparison Of Medroxyprogesterone Acetate (MA) And Observation For Prevention Of Endometrial Pathology In Postmenopausal Breast Cancer Patients Treated With Tamoxifen, Phase III Completed NCT00002920 Phase 3 medroxyprogesterone;tamoxifen citrate
11 Evaluation of the Diagnostic Performance of MRI±Biopsy to Optimize Resection of Ductal Carcinoma In Situ (DCIS) Breast Cancer Completed NCT01112254 Phase 3
12 Conservative Surgery With or Without Axillary Lymphnode Removal in Treating Women With T1N0 Breast Cancer Completed NCT01508546 Phase 3
13 Evaluation of a New Intraoperative Gamma Camera for the Sentinel Lymph Node Procedure in Breast Cancer Completed NCT00757302 Phase 3
14 Phase III Study of Atamestane Plus Toremifene Versus Letrozole in Advanced Breast Cancer Completed NCT00044291 Phase 3 atamestane;toremifene;letrozole;aromatase inhibition
15 A Phase III Study to Evaluate Letrozole as Adjuvant Endocrine Therapy for Postmenopausal Women With Receptor (ER and/or PgR) Positive Tumors Completed NCT00004205 Phase 3 letrozole;tamoxifen citrate
16 A Clinical Trial to Evaluate the Benefit of Adding Octreotide (SMS 201-995 PA LAR) to Tamoxifen Alone or to Tamoxifen and Chemotherapy in Patients With Axillary Node-Negative, Estrogen-Receptor-Positive, Primary Invasive Breast Cancer Completed NCT00002967 Phase 3 cyclophosphamide;doxorubicin hydrochloride;octreotide pamoate;tamoxifen citrate
17 Prospective Trial Comparing the Use of Conventional Electric Scalpel and Harmonic Scalpel in Mastectomy Completed NCT01391988 Phase 3
18 Phase III Study in the Conservative Management of Breast Carcinoma by Tumorectomy and Radiotherapy: Assessment of the Role of a Booster Dose of Radiotherapy (Joint Study of the European Organisation for Research and Treatment of Cancer Radiotherapy Cooperative Group and Breast Cancer Cooperative Group) Completed NCT02295033 Phase 3
19 A Phase III, Double-Blind, Controlled Trial of Oxybutynin in the Management of Hot Flashes Completed NCT02961790 Phase 3 Oxybutynin Chloride
20 A Randomized Phase II Trial Investigating the Addition of Carboplatin to Neoadjuvant Therapy for Triple-negative and HER2-positive Early Breast Cancer Completed NCT01426880 Phase 2, Phase 3 Carboplatin;background treatment
21 A Randomized Phase III Trial Comparing Two Dose-dense, Dose-intensified Approaches (ETC and PM(Cb)) for Neoadjuvant Treatment of Patients With High-risk Early Breast Cancer (GeparOcto) Completed NCT02125344 Phase 3 non-pegylated liposomal doxorubicin;Carboplatin;Paclitaxel;Epirubicin;Cyclophosphamide;Pertuzumab;Trastuzumab;Ferric carboxymaltose
22 A Phase III Randomized Double Blind Study of Letrozole Versus Placebo in Women With Primary Breast Cancer Completing Five or More Years of Adjuvant Tamoxifen Completed NCT00003140 Phase 3 letrozole
23 Phase 3 Study of Weekly Paclitaxel in Combination With Cisplatin as Adjuvant Chemotherapy for Early Stage Human Epidermal Growth Factor Receptor-2 (HER2) Negative Breast Cancer in High-risk Women Recruiting NCT03201861 Phase 3 Paclitaxel, Cisplatin;EC to docetaxel or paclitaxel
24 Radiotherapy Versus Low-Dose Tamoxifen Following Breast Conserving Surgery for Low-Risk and Estrogen Receptor-Positive Ductal Carcinoma in Situ of Breast: an International Open-label Randomized Non-inferiority Trial Recruiting NCT04046159 Phase 3 Low-dose tamoxifen
25 RT CHARM: Phase III Randomized Trial of Hypofractionated Post Mastectomy Radiation With Breast Reconstruction Recruiting NCT03414970 Phase 3
26 The Efficacy of Levamisole Hcl in Advanced Intrahepatic Cholangiocarcinoma . A Multicenter, Open, Randomized, Prospective Study Recruiting NCT03940378 Phase 3 Levamisole Hydrochloride;Anlotinib Hydrochloride Capsules
27 A Randomized Phase III Trial of Comparing Combination Administration of Paclitaxel and Cisplatin Versus CEF as Adjuvant Chemotherapy in Breast Cancer Patients With Pathological Partial Response and Complete Response to Neoadjuvant Chemotherapy Recruiting NCT02879513 Phase 3 Paclitaxel;Cisplatin;Epirubicin;Cyclophosphamide;5-fluoruracil
28 Management of Low Risk Ductal Carcinoma in Situ (Low-risk DCIS): a Randomized, Multicentre, Non-inferiority Trial, Between Standard Therapy Approach Versus Active Surveillance Recruiting NCT02492607 Phase 3
29 Testing for Atypia in Random Periareolar Fine Needle Aspiration (RPFNA) Cytology After 12 Months Metformin (1, 1-Dimethylbiguanide Hydrochloride) Chemoprevention Versus Placebo Control in Premenopausal Women Recruiting NCT01905046 Phase 3 metformin hydrochloride
30 A Phase III Randomized Trial of Gemcitabine, Cisplatin, and Nab-Paclitaxel Versus Gemcitabine and Cisplatin in Newly Diagnosed, Advanced Biliary Tract Cancers Recruiting NCT03768414 Phase 3 Cisplatin;Gemcitabine Hydrochloride;Nab-paclitaxel
31 Efficacy and Safety Study of TA(E)C-GP Versus A(E)C-T for the High Risk Triple-negative Breast Cancer Patients Predicted by the Messenger RNA (mRNA)-Long Non-coding RNA (lncRNA) Signature and Validation of the Signature's Efficacy Recruiting NCT02641847 Phase 2, Phase 3 docetaxel;doxorubicin or epirubicin;cyclophosphamide;gemcitabine;cisplatin
32 A Phase III Clinical Trial Comparing Trastuzumab Given Concurrently With Radiation Therapy and Radiation Therapy Alone for Women With HER2-Positive Ductal Carcinoma In Situ Resected by Lumpectomy Active, not recruiting NCT00769379 Phase 3
33 Phase III Trial of Tamoxifen Alone vs. Tamoxifen Plus Radiation Therapy for Good Risk Duct Carcinoma In-Situ (DCIS) of the Female Breast Active, not recruiting NCT00003857 Phase 3 tamoxifen citrate
34 A Randomised Phase III Study of Radiation Doses and Fractionation Schedules in Non-low Risk Ductal Carcinoma In Situ (DCIS) of the Breast Active, not recruiting NCT00470236 Phase 3
35 A Multicentric Phase III Trial Evaluating the Impact of a Radiation Boost (16Gy) After Breast Conserving Surgery and a Whole Breast Irradiation (50Gy) for DCIS Active, not recruiting NCT00907868 Phase 3
36 International Breast Cancer Intervention Study II (IBIS-II) (DCIS) Active, not recruiting NCT00072462 Phase 3 tamoxifen citrate;Anastrozole
37 Neo-Adjuvant Study With the PDL1-directed Antibody in Triple Negative Locally Advanced Breast Cancer Undergoing Treatment With Nab-paclitaxel and Carboplatin Active, not recruiting NCT02620280 Phase 3 Carboplatin;Abraxane;MPDL3280A;Anthra
38 A Phase 3, Randomized, Double-Blind, Placebo-Controlled, Multicenter Study of PEGylated Recombinant Human Hyaluronidase (PEGPH20) in Combination With Nab-Paclitaxel Plus Gemcitabine Compared With Placebo Plus Nab-Paclitaxel and Gemcitabine in Subjects With Hyaluronan-High Stage IV Previously Untreated Pancreatic Ductal Adenocarcinoma Active, not recruiting NCT02715804 Phase 3 Placebo;nab-Paclitaxel;Gemcitabine
39 Alternate Approaches for Clinical Stage II or III Estrogen Receptor Positive Breast Cancer Neoadjuvant Treatment (ALTERNATE) in Postmenopausal Women: A Phase III Study Active, not recruiting NCT01953588 Phase 3 fulvestrant;anastrozole
40 A Phase III, Randomized Clinical Trial of Standard Adjuvant Endocrine Therapy +/- Chemotherapy in Patients With 1-3 Positive Nodes, Hormone Receptor-Positive and HER2-Negative Breast Cancer With Recurrence Score (RS) of 25 or Less. RxPONDER: A Clinical Trial Rx for Positive Node, Endocrine Responsive Breast Cancer Active, not recruiting NCT01272037 Phase 3 Anastrozole;Exemestane;Letrozole;Systemic Chemotherapy;Tamoxifen Citrate
41 Interstitial Brachytherapy Alone Versus External Beam Radiation Therapy After Breast Conserving Surgery for Low-risk Invasive Carcinoma and Low-risk Ductal Carcinoma in Situ (DCIS) of the Female Breast Active, not recruiting NCT00402519 Phase 3
42 A Prospective, Randomized, Open-label Comparison of Preoperative Weekly Paclitaxel and Cisplatin With or Without Endocrine Therapy in Patients With Operable Hormone Receptor Positive and Triple Negative Locally Advanced Breast Cancer Active, not recruiting NCT02221999 Phase 2, Phase 3 Paclitaxel;Cisplatin;Gonadotropin-releasing hormone agonist;Letrozole
43 A Phase III Trial of Accelerated Whole Breast Irradiation With Hypofractionation Plus Concurrent Boost Versus Standard Whole Breast Irradiation Plus Sequential Boost for Early-Stage Breast Cancer Active, not recruiting NCT01349322 Phase 3
44 International Breast Cancer Intervention Study Active, not recruiting NCT00078832 Phase 3 anastrozole;placebo
45 MINDACT (Microarray In Node-Negative and 1 to 3 Positive Lymph Node Disease May Avoid Chemotherapy): A Prospective, Randomized Study Comparing the 70-Gene Signature With the Common Clinical-Pathological Criteria in Selecting Patients for Adjuvant Chemotherapy in Breast Cancer With 0 to 3 Positive Nodes Active, not recruiting NCT00433589 Phase 3 anthracycline-based;docetaxel and capecitabine
46 A Phase III Clinical Trial Comparing the Combination of Docetaxel Plus Cyclophosphamide to Anthracycline-Based Chemotherapy Regimens for Women With Node-Positive or High-Risk Node-Negative, HER2-Negative Breast Cancer Active, not recruiting NCT01547741 Phase 3 Doxorubicin;Cyclophosphamide;Docetaxel;Paclitaxel
47 International Breast Cancer Intervention Study: A Multicentre Trial of Tamoxifen to Prevent Breast Cancer Active, not recruiting NCT00002644 Phase 3 Tamoxifen Citrate 20Mg Tab
48 A Randomized Phase III Trial of Adjuvant Therapy Comparing Chemotherapy Alone (Six Cycles of Docetaxel Plus Cyclophosphamide or Four Cycles of Doxorubicin Plus Cyclophosphamide Followed by Weekly Paclitaxel) to Chemotherapy Plus Trastuzumab in Women With Node-Positive or High-Risk Node-Negative HER2-Low Invasive Breast Cancer Active, not recruiting NCT01275677 Phase 3 Cyclophosphamide;Docetaxel;Doxorubicin;Doxorubicin Hydrochloride;Paclitaxel
49 Evaluation of the LightPath® Imaging System and the PET Tracer 68Ga-RM2 in Wide Local Excision (WLE) for Breast Cancer Not yet recruiting NCT03731026 Phase 3 68Ga-RM2
50 Open Label Treatment and Survival Continuation Study of Atamestane Plus Toremifene Versus Letrozole in Advanced Breast Cancer Terminated NCT00267553 Phase 3 Atamestane;toremifene;letrozole

Search NIH Clinical Center for Breast Ductal Carcinoma

Cochrane evidence based reviews: carcinoma, ductal

Genetic Tests for Breast Ductal Carcinoma

Anatomical Context for Breast Ductal Carcinoma

MalaCards organs/tissues related to Breast Ductal Carcinoma:

41
Breast, Lymph Node, Testes, Pancreas, Skin, Salivary Gland, Bone

Publications for Breast Ductal Carcinoma

Articles related to Breast Ductal Carcinoma:

(show top 50) (show all 1733)
# Title Authors PMID Year
1
Mutations in the RAD54 recombination gene in primary cancers. 71
10362365 1999
2
Concomitant expression of epithelial-mesenchymal transition biomarkers in breast ductal carcinoma: association with progression. 9 38
20043090 2010
3
E-cadherin expression in estrogen receptor-positive and negative breast carcinomas of postmenopausal women. 9 38
20349789 2010
4
[Relationship of ezrin protein expression to the carcinogenesis and prognosis of infitrating breast ductal carcinoma]. 9 38
18788632 2008
5
[Clinicopathologic significance of chromosome 17 polysomy in breast cancer]. 9 38
18681318 2008
6
P63 and cytokeratin8/18 expression in breast, atypical ductal hyperplasia, ductal carcinoma in situ and invasive duct carcinoma. 9 38
19190693 2007
7
A mutation in the 5' untranslated region of the BRCA1 gene in sporadic breast cancer causes downregulation of translation efficiency. 9 38
17697535 2007
8
Promoter hypermethylation of TMS1, BRCA1, ERalpha and PRB in serum and tumor DNA of invasive ductal breast carcinoma patients. 9 38
17599361 2007
9
Correlation of HER-2/neu protein overexpression with other prognostic and predictive factors in invasive ductal breast cancer. 9 38
17708365 2007
10
Identification of a basal-like subtype of breast ductal carcinoma in situ. 9 38
17234468 2007
11
An expression signature of syndecan-1 (CD138), E-cadherin and c-met is associated with factors of angiogenesis and lymphangiogenesis in ductal breast carcinoma in situ. 9 38
17244359 2007
12
Expression of nm23, MMP-2, TIMP-2 in breast neoplasm in Zhengzhou Center Hospital, China. 9 38
17642161 2007
13
CD44 expression and axillary lymph node metastasis in infiltrating ductal carcinoma of the breast. 9 38
18376796 2006
14
E-cadherin immunohistochemical expression as a prognostic factor in infiltrating ductal carcinoma of the breast: a systematic review and meta-analysis. 9 38
16791476 2006
15
Smad4-expression is decreased in breast cancer tissues: a retrospective study. 9 38
16438724 2006
16
Expression of hypoxia-inducible factor (HIF-1alpha), VEGF-C and VEGF-D in non-invasive and invasive breast ductal carcinomas. 9 38
16080559 2005
17
Localisation of COX-2 protein is different in breast ductal carcinoma and adjacent non-tumour ductal epithelium. 9 38
16131446 2005
18
Transient transfection of epidermal growth factor receptor gene into MCF7 breast ductal carcinoma cell line. 9 38
15584089 2005
19
PPARgamma expression in breast cancer: clinical value and correlation with ERbeta. 9 38
15656884 2005
20
Correlation of KIT and EGFR overexpression with invasive ductal breast carcinoma of the solid-tubular subtype, nuclear grade 3, and mesenchymal or myoepithelial differentiation. 9 38
15649255 2005
21
The prognostic value of p53 and c-erbB-2 expression, proliferative activity and angiogenesis in node-negative breast carcinoma. 9 38
15850004 2005
22
Real-time quantitative PCR of microdissected paraffin-embedded breast carcinoma: an alternative method for HER-2/neu analysis. 9 38
14736826 2004
23
Immunohistochemical status of p53, MDM2, bcl2, bax, and ER in invasive ductal breast carcinoma in Tunisian patients. 9 38
15033823 2003
24
Hypoxia promotes a dedifferentiated phenotype in ductal breast carcinoma in situ. 9 38
12670886 2003
25
The epithelial-specific ETS transcription factor ESX/ESE-1/Elf-3 modulates breast cancer-associated gene expression. 9 38
12713734 2003
26
Detection of RASSF1A aberrant promoter hypermethylation in sputum from chronic smokers and ductal carcinoma in situ from breast cancer patients. 9 38
12527916 2003
27
Cell proliferation, nuclear ploidy, and EGFr and HER2/neu tyrosine kinase oncoproteins in infiltrating ductal breast carcinoma. 9 38
12419588 2002
28
The angiogenic and lymphangiogenic factor vascular endothelial growth factor-D exhibits a paracrine mode of action in cancer. 9 38
12148568 2002
29
p63 expression in normal, hyperplastic and malignant breast tissues. 9 38
12185332 2002
30
p53 gene alteration and protein expression in Iranian women with infiltrative ductal breast carcinoma. 9 38
11410327 2001
31
pS2 expression in infiltrating ductal carcinoma of the breast correlates with oestrogen receptor positivity but not with histological grade and lymph node status. 9 38
11523925 2001
32
The prognostic significance of P-cadherin in infiltrating ductal breast carcinoma. 9 38
11454996 2001
33
Expression of p21Waf1, p27Kip1 and cyclin D1 proteins in breast ductal carcinoma in situ: Relation with clinicopathologic characteristics and with p53 expression and estrogen receptor status. 9 38
11169147 2001
34
Salivary duct carcinoma--a highly aggressive salivary gland tumor with HER-2/neu oncoprotein overexpression. 9 38
11569926 2001
35
Cytokeratin 8 immunostaining pattern and E-cadherin expression distinguish lobular from ductal breast carcinoma. 9 38
10941333 2000
36
Bcl-2 with loss of apoptosis allows accumulation of genetic alterations: a pathway to metastatic progression in human breast cancer. 9 38
10754491 2000
37
Cyclin D1 overexpression in a model of human breast premalignancy: preferential stimulation of anchorage-independent but not anchorage-dependent growth is associated with increased cdk2 activity. 9 38
10752677 2000
38
Expression of glycodelin in human breast and breast cancer. 9 38
10597188 1999
39
A comparison of the pattern of cathepsin-D expression in fibroadenoma, fibrocystic disease, preinvasive and invasive ductal breast carcinoma. 9 38
10503271 1999
40
[Immunohistochemical tumor markers in infiltrating ductal breast carcinoma]. 9 38
10030093 1998
41
p53 protein expression in benign and malignant breast lesions. 9 38
9684577 1998
42
CD44 isoform expression follows two alternative splicing pathways in breast tissue. 9 38
9665479 1998
43
Prospective studies of p53 and c-erbB-2 expression in relation to clinicopathological parameters of human ductal breast cancer in the second stage of clinical advancement. 9 38
9568187 1998
44
[Mammary carcinoma in a patient with hyperprolactinemia]. 9 38
9586418 1997
45
Thrombospondin-1 and -2 messenger RNA expression in normal, benign, and neoplastic human breast tissues: correlation with prognostic factors, tumor angiogenesis, and fibroblastic desmoplasia. 9 38
9012463 1997
46
The intermediate filaments and prognostically oriented morphological classification in ductal breast carcinoma. 9 38
9605010 1997
47
Chromosome 1 aneusomy with 1p36 under-representation is related to histologic grade, DNA aneuploidy, high c-erb B-2 and loss of bcl-2 expression in ductal breast carcinoma. 9 38
8900371 1996
48
Reciprocal expression of Bcl-2 and p53 in breast ductal carcinoma. 9 38
8917421 1996
49
Histological grade in invasive ductal carcinoma of breast correlates with the proliferative activity evaluated by BrdU: an immunohistochemical study including correlations with p53, c-erbB-2 and estrogen receptor status. 9 38
8869993 1996
50
Relationship between c-erbB-2 oncoprotein, epidermal growth factor receptor, and estrogen receptor expression in patients with ductal breast carcinoma. Association with tumor phenotypes. 9 38
8744803 1996

Variations for Breast Ductal Carcinoma

ClinVar genetic disease variations for Breast Ductal Carcinoma:

6 (show top 50) (show all 258)
# Gene Variation Type Significance SNP ID GRCh37 Pos GRCh38 Pos
1 RAD54L NM_003579.4(RAD54L): c.973G> A (p.Gly325Arg) single nucleotide variant Pathogenic rs121908690 1:46733212-46733212 1:46267540-46267540
2 SYT6 NM_001270805.1(SYT6): c.1216G> A (p.Ala406Thr) single nucleotide variant Uncertain significance rs142164979 1:114640393-114640393 1:114097771-114097771
3 ZDBF2 NM_020923.3(ZDBF2): c.5795G> A (p.Arg1932His) single nucleotide variant Uncertain significance rs763186071 2:207175047-207175047 2:206310323-206310323
4 YEATS2 NM_018023.5(YEATS2): c.3131C> T (p.Pro1044Leu) single nucleotide variant Uncertain significance rs376025260 3:183515744-183515744 3:183797956-183797956
5 PHF24 NM_001304333.3(PHF24): c.242G> A (p.Arg81Gln) single nucleotide variant Uncertain significance rs374394658 9:34971537-34971537 9:34971540-34971540
6 CCDC180 NM_020893.4(CCDC180): c.1975C> G (p.Pro659Ala) single nucleotide variant Uncertain significance rs869025225 9:100092618-100092618 9:97330336-97330336
7 CNNM1 NM_020348.3(CNNM1): c.957G> C (p.Glu319Asp) single nucleotide variant Uncertain significance rs869025226 10:101090101-101090101 10:99330344-99330344
8 MICAL2 NM_014632.4(MICAL2): c.3131A> G (p.Asp1044Gly) single nucleotide variant Uncertain significance rs869025227 11:12278507-12278507 11:12256960-12256960
9 KDM4E NM_001161630.1(KDM4E): c.1493A> G (p.Asn498Ser) single nucleotide variant Uncertain significance rs869025228 11:94760214-94760214 11:95027050-95027050
10 TSPAN8 NM_004616.3(TSPAN8): c.528T> A (p.Asp176Glu) single nucleotide variant Uncertain significance rs869025229 12:71526521-71526521 12:71132741-71132741
11 CORO6 NM_032854.3(CORO6): c.1348G> A (p.Val450Met) single nucleotide variant Uncertain significance rs772136445 17:27942821-27942821 17:29615803-29615803
12 NOTCH3 NM_000435.3(NOTCH3): c.5161T> A (p.Trp1721Arg) single nucleotide variant Uncertain significance rs869025230 19:15280935-15280935 19:15170124-15170124
13 CPAMD8 NM_015692.5(CPAMD8): c.4015G> A (p.Ala1339Thr) single nucleotide variant Uncertain significance rs869025231 19:17017774-17017774 19:16906964-16906964
14 ZNF420 NM_001329517.1(ZNF420): c.149A> G (p.Asn50Ser) single nucleotide variant Uncertain significance rs771433810 19:37618255-37618255 19:37127353-37127353
15 ZNF473 NM_015428.4(ZNF473): c.2359A> T (p.Arg787Ter) single nucleotide variant Uncertain significance rs869025232 19:50550059-50550059 19:50046802-50046802
16 KRTAP10-3 NM_198696.3(KRTAP10-3): c.7A> G (p.Thr3Ala) single nucleotide variant Uncertain significance rs452472 21:45978592-45978592 21:44558709-44558709
17 CCDC71L NM_175884.6(CCDC71L): c.478A> C (p.Ser160Arg) single nucleotide variant Uncertain significance rs869025233 7:106300865-106300865 7:106660419-106660419
18 HTRA2 NM_013247.4(HTRA2): c.695T> A (p.Leu232Gln) single nucleotide variant Uncertain significance rs869025234 2:74757932-74757932 2:74530805-74530805
19 LRAT NM_004744.5(LRAT): c.78T> A (p.Ser26Arg) single nucleotide variant Uncertain significance rs869025235 4:155665556-155665556 4:154744404-154744404
20 CREB3 NM_006368.5(CREB3): c.823T> G (p.Tyr275Asp) single nucleotide variant Uncertain significance rs869025236 9:35736430-35736430 9:35736433-35736433
21 ALOX5 NM_000698.5(ALOX5): c.490T> G (p.Leu164Val) single nucleotide variant Uncertain significance rs869025237 10:45907697-45907697 10:45412249-45412249
22 KNDC1 NM_152643.8(KNDC1): c.2914G> T (p.Glu972Ter) single nucleotide variant Uncertain significance rs869025238 10:135013889-135013889 10:133200385-133200385
23 PML NM_033238.3(PML): c.2264G> C (p.Arg755Pro) single nucleotide variant Uncertain significance rs780746013 15:74336964-74336964 15:74044623-74044623
24 ARHGAP35 NM_004491.5(ARHGAP35): c.1959_1960delinsAA (p.Pro654Thr) indel Uncertain significance rs869312173 19:47423891-47423892 19:46920634-46920635
25 RRP1 NM_003683.6(RRP1): c.340C> T (p.Arg114Cys) single nucleotide variant Uncertain significance rs763767114 21:45213265-45213265 21:43793384-43793384
26 FUBP1 NM_003902.4(FUBP1): c.1611G> A (p.Trp537Ter) single nucleotide variant Uncertain significance rs869025239 1:78422351-78422351 1:77956666-77956666
27 RNF212 NM_001366919.1(RNF212): c.314T> C (p.Leu105Ser) single nucleotide variant Uncertain significance rs869025240 4:1079732-1079732 4:1085944-1085944
28 CPXM2 NM_198148.3(CPXM2): c.497G> A (p.Gly166Glu) single nucleotide variant Uncertain significance rs869025241 10:125622146-125622146 10:123862630-123862630
29 CACNA1C NM_000719.7(CACNA1C): c.5143C> T (p.Arg1715Trp) single nucleotide variant Uncertain significance rs373996684 12:2788661-2788661 12:2679495-2679495
30 ABCC9 NM_005691.3(ABCC9): c.2663G> T (p.Gly888Val) single nucleotide variant Uncertain significance rs869025242 12:22005137-22005137 12:21852203-21852203
31 NTS NM_006183.5(NTS): c.185G> A (p.Cys62Tyr) single nucleotide variant Uncertain significance rs869025243 12:86272172-86272172 12:85878394-85878394
32 CACNA1H NM_021098.3(CACNA1H): c.1624G> A (p.Glu542Lys) single nucleotide variant Uncertain significance rs761025927 16:1252074-1252074 16:1202074-1202074
33 AMFR NM_001144.6(AMFR): c.1786C> T (p.Arg596Cys) single nucleotide variant Uncertain significance rs869025244 16:56396967-56396967 16:56363055-56363055
34 SPEN NM_015001.3(SPEN): c.6999_7014del (p.Gln2333fs) deletion Uncertain significance rs869312174 1:16259732-16259747 1:15933237-15933252
35 AKAP1 NM_003488.4(AKAP1): c.946_966GGCTTGGATAGAAATGAGGAG[1] (p.316_322GLDRNEE[1]) short repeat Uncertain significance rs746089021 17:55183751-55183771 17:57106390-57106410
36 SLITRK6 NM_032229.3(SLITRK6): c.1915dup (p.Tyr639fs) duplication Uncertain significance rs869312872 13:86368729-86368729 13:85794594-85794594
37 RP1 NM_006269.2(RP1): c.5001del (p.Arg1668fs) deletion Uncertain significance rs869320622 8:55541442-55541442 8:54628882-54628882
38 subset of 318 genes:CAMTA1 ; CASZ1 ; GNB1 ; SDHB ; SPEN complex Uncertain significance 1:909238-24706269 :0-0
39 IBA57 ; OBSCN complex Uncertain significance 1:228353651-228547901 :0-0
40 ZNF717 complex Uncertain significance 3:75786278-75790822 :0-0
41 DSPP complex Uncertain significance 4:88537268-88537420 :0-0
42 HLA-A ; PPP1R11 ; RNF39 ; TRIM31 ; ZNRD1 chr6: 29910378..30075843 complex variant complex Uncertain significance 6:29910378-30075843 :0-0
43 CCHCR1 ; CDSN ; HLA-B ; HLA-C ; POU5F1 ; PSORS1C1 ; PSORS1C2 ; TCF19 complex Uncertain significance 6:31085200-31324647 :0-0
44 BTNL2 ; HLA-DQA1 ; HLA-DQB1 ; HLA-DRA ; HLA-DRB1 ; HLA-DRB5 ; NOTCH4 ; TSBP1 complex Uncertain significance 6:32188383-32629802 :0-0
45 KRBA1 ; ZNF467 ; ZNF746 ; ZNF777 complex Uncertain significance 7:149152906-149518148 :0-0
46 IFNA10 ; IFNA4 ; IFNA7 complex Uncertain significance 9:21187121-21207037 :0-0
47 covers 19 genes, none of which curated to show dosage sensitivity complex Uncertain significance 11:870446-1857751 :0-0
48 covers 21 genes, none of which curated to show dosage sensitivity chr14: 104643721..105932775 complex variant complex Uncertain significance 14:104643721-105932775 :0-0
49 subset of 326 genes:ANKRD11 ; CDH1 ; CTCF ; FOXC2 ; FOXF1 complex Uncertain significance 16:56368689-90141355 :0-0
50 subset of 43 genes:PMP22 complex Uncertain significance 17:9586165-16325968 :0-0

Cosmic variations for Breast Ductal Carcinoma:

9 (show top 50) (show all 5317)
# Cosmic Mut ID Gene Symbol COSMIC Disease Classification
(Primary site, Site subtype, Primary histology, Histology subtype)
Mutation CDS Mutation AA GRCh38 Location Conf
1 COSM51177 ZSWIM8 breast,NS,carcinoma,ductal carcinoma c.1563G>A p.K521K 10:73797261-73797261 12
2 COSM6974238 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.1084G>A p.E362K 23:15822877-15822877 12
3 COSM6953912 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.989A>G p.H330R 23:15822782-15822782 12
4 COSM6937481 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.1406C>T p.S469L 23:15823199-15823199 12
5 COSM6925955 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.267G>C p.K89N 23:15803751-15803751 12
6 COSM6963999 ZRSR2 breast,NS,carcinoma,ductal carcinoma c.1312G>T p.G438C 23:15823105-15823105 12
7 COSM32591 ZNHIT2 breast,NS,carcinoma,ductal carcinoma c.175G>C p.A59P 11:65117479-65117479 12
8 COSM50437 ZNF830 breast,NS,carcinoma,ductal carcinoma c.136A>G p.N46D 17:34961702-34961702 12
9 COSM33456 ZNF668 breast,NS,carcinoma,ductal carcinoma c.196G>A p.A66T 16:31064264-31064264 12
10 COSM33234 ZNF668 breast,NS,carcinoma,ductal carcinoma c.992C>G p.T331R 16:31061936-31061936 12
11 COSM33435 ZNF668 breast,NS,carcinoma,ductal carcinoma c.856G>A p.G286S 16:31062072-31062072 12
12 COSM33584 ZNF646 breast,NS,carcinoma,ductal carcinoma c.4010A>T p.N1337I 16:31080334-31080334 12
13 COSM32207 ZNF644 breast,NS,carcinoma,ductal carcinoma c.157G>C p.E53Q 1:90941197-90941197 12
14 COSM32635 ZNF569 breast,NS,carcinoma,ductal carcinoma c.85C>G p.Q29E 19:37426309-37426309 12
15 COSM32954 ZNF532 breast,NS,carcinoma,ductal carcinoma c.2465C>T p.S822L 18:58934551-58934551 12
16 COSM33530 ZNF438 breast,NS,carcinoma,ductal carcinoma c.1143G>C p.K381N 10:30849262-30849262 12
17 COSM32744 ZNF318 breast,NS,carcinoma,ductal carcinoma c.3820G>C p.G1274R 6:43340178-43340178 12
18 COSM32924 ZNF281 breast,NS,carcinoma,ductal carcinoma c.1580T>C p.I527T 1:200408126-200408126 12
19 COSM33029 ZNF277 breast,NS,carcinoma,ductal carcinoma c.994A>T p.I332L 7:112339870-112339870 12
20 COSM32751 ZNF277 breast,NS,carcinoma,ductal carcinoma c.1335G>C p.L445F 7:112342711-112342711 12
21 COSM32755 ZNF25 breast,NS,carcinoma,ductal carcinoma c.61G>A p.E21K 10:37957501-37957501 12
22 COSM33510 ZNF22 breast,NS,carcinoma,ductal carcinoma c.386A>T p.H129L 10:45003754-45003754 12
23 COSM32252 ZNF10 breast,NS,carcinoma,ductal carcinoma c.257-3C>G p.? 12:133155500-133155500 12
24 COSM50670 ZMIZ2 breast,NS,carcinoma,ductal carcinoma c.491C>G p.A164G 7:44757500-44757500 12
25 COSM32244 ZMIZ1 breast,NS,carcinoma,ductal carcinoma c.1651C>G p.L551V 10:79298565-79298565 12
26 COSM50422 ZKSCAN2 breast,NS,carcinoma,ductal carcinoma c.1258G>A p.E420K 16:25246938-25246938 12
27 COSM32555 ZIC3 breast,NS,carcinoma,ductal carcinoma c.649C>G p.P217A 23:137567340-137567340 12
28 COSM33562 ZFYVE26 breast,NS,carcinoma,ductal carcinoma c.3491C>A p.A1164E 14:67785091-67785091 12
29 COSM50767 ZFHX4 breast,NS,carcinoma,ductal carcinoma c.5524G>A p.V1842M 8:76852445-76852445 12
30 COSM50766 ZFHX4 breast,NS,carcinoma,ductal carcinoma c.9752C>G p.A3251G 8:76863466-76863466 12
31 COSM6934678 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.10111C>A p.L3371M 16:72788165-72788165 12
32 COSM3276869 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.4750C>T p.Q1584* 16:72797932-72797932 12
33 COSM6941446 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.9095A>C p.K3032T 16:72793587-72793587 12
34 COSM6845183 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.2143C>T p.R715* 16:72958003-72958003 12
35 COSM6933756 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.1444G>A p.E482K 16:72958702-72958702 12
36 COSM6946536 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.7667C>T p.A2556V 16:72795015-72795015 12
37 COSM6980784 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.8798C>G p.S2933C 16:72793884-72793884 12
38 COSM6942666 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.6871C>T p.Q2291* 16:72795811-72795811 12
39 COSM6940614 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.2714C>G p.A905G 16:72957432-72957432 12
40 COSM6933933 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.4468G>A p.E1490K 16:72798214-72798214 12
41 COSM6953107 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.611T>G p.F204C 16:72959535-72959535 12
42 COSM6954458 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.8043G>C p.K2681N 16:72794639-72794639 12
43 COSM4984432 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.3757C>T p.R1253C 16:72811684-72811684 12
44 COSM6946621 ZFHX3 breast,NS,carcinoma,ductal carcinoma c.7789C>A p.P2597T 16:72794893-72794893 12
45 COSM50608 ZFC3H1 breast,NS,carcinoma,ductal carcinoma c.2306C>A p.A769D 12:71634758-71634758 12
46 COSM32934 ZDHHC4 breast,NS,carcinoma,ductal carcinoma c.310C>T p.P104S 7:6582191-6582191 12
47 COSM33432 ZCCHC24 breast,NS,carcinoma,ductal carcinoma c.725G>C p.*242S 10:79386346-79386346 12
48 COSM32774 ZCCHC14 breast,NS,carcinoma,ductal carcinoma c.868C>G p.L290V 16:87417564-87417564 12
49 COSM50385 ZBTB39 breast,NS,carcinoma,ductal carcinoma c.295G>A p.V99I 12:57004623-57004623 12
50 COSM33515 ZBTB3 breast,NS,carcinoma,ductal carcinoma c.1271A>T p.H424L 11:62752544-62752544 12

Copy number variations for Breast Ductal Carcinoma from CNVD:

7 (show all 33)
# CNVD ID Chromosom Start End Type Gene Symbol CNVD Disease
1 50888 11 119630000 120260000 Deletion Ductal carcinoma
2 57116 11 63100000 76700000 Amplification CCND1 Ductal carcinoma
3 58629 11 68930000 70160000 Gain Ductal carcinoma
4 58724 11 69230000 69780000 Gain Ductal carcinoma
5 59882 11 78860000 79330000 Deletion Ductal carcinoma
6 60225 11 84000000 88080000 Deletion Ductal carcinoma
7 60766 11 91240000 95940000 Deletion Ductal carcinoma
8 66468 12 2966849 2986303 Copy number FOXM1 Ductal carcinoma
9 98103 16 15360000 17700000 Gain Ductal carcinoma
10 99317 16 25030000 27880000 Gain Ductal carcinoma
11 101507 16 40000 40090000 Gain Ductal carcinoma
12 107663 17 16530000 18020000 Deletion Ductal carcinoma
13 109740 17 28800000 35400000 Amplification ERBB2 Ductal carcinoma
14 116392 17 6500000 10700000 Copy number TP53 Ductal carcinoma
15 117043 17 70920000 72340000 Gain Ductal carcinoma
16 126771 19 20810000 63790000 Gain Ductal carcinoma
17 127047 19 23780000 51950000 Gain Ductal carcinoma
18 128079 19 39420000 40350000 Gain Ductal carcinoma
19 131070 19 52760000 63790000 Gain Ductal carcinoma
20 153161 20 34860000 62370000 Gain Ductal carcinoma
21 153748 20 41100000 62435964 Amplification BMP7 Ductal carcinoma
22 166731 3 107740000 107880000 Deletion Ductal carcinoma
23 166830 3 108620000 110660000 Deletion Ductal carcinoma
24 167069 3 112930000 115910000 Deletion Ductal carcinoma
25 179845 3 99790000 104540000 Deletion Ductal carcinoma
26 196641 5 170120000 170210000 Gain Ductal carcinoma
27 196700 5 170690000 172750000 Gain Ductal carcinoma
28 215548 6 77380000 82650000 Deletion Ductal carcinoma
29 231989 8 110000 5150000 Deletion Ductal carcinoma
30 233354 8 124380000 129070000 Gain Ductal carcinoma
31 234986 8 140450000 141700000 Gain Ductal carcinoma
32 238072 8 29700000 38500000 Amplification FGFR1 Ductal carcinoma
33 239766 8 41480000 42480000 Gain Ductal carcinoma

Expression for Breast Ductal Carcinoma

Search GEO for disease gene expression data for Breast Ductal Carcinoma.

Pathways for Breast Ductal Carcinoma

Pathways related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

(show top 50) (show all 62)
# Super pathways Score Top Affiliating Genes
1
Show member pathways
13.89 TP53 PIP MET ESR1 ERBB2 EGFR
2
Show member pathways
13.3 MET ESR1 ERBB2 EGFR CTNNB1 CDH3
3
Show member pathways
13 TP53 MET ERBB2 EGFR CTNNB1 CCND1
4
Show member pathways
12.87 TP53 ERBB2 EGFR CTNNB1 CDH1 CCND1
5
Show member pathways
12.73 TP53 MET ESR1 ERBB2 CTNNB1 CDH1
6
Show member pathways
12.62 TP53 MET ERBB2 EGFR CCND1
7 12.53 TP53 MET ESR1 ERBB2 EGFR CTNNB1
8 12.52 TP53 MET ERBB2 EGFR CCND1 BRCA1
9
Show member pathways
12.52 TP53 MET ESR1 ERBB2 EGFR CDH1
10 12.45 TP53 CTNNB1 CDH3 CDH1 CCND1
11
Show member pathways
12.45 TP53 MET ERBB2 EGFR CTNNB1
12
Show member pathways
12.42 MET ERBB2 EGFR CTNNB1 CDH1
13
Show member pathways
12.33 TFF1 ESR1 ERBB2 EGFR CCND1
14
Show member pathways
12.32 TP53 PGR MET ESR1 ERBB2 EGFR
15
Show member pathways
12.25 PGR ESR1 CCND1 BRCA1
16
Show member pathways
12.22 TP53 MET ERBB2 EGFR CCND1
17 12.2 TP53 EGFR CTNNB1 CDH1 CCND1
18 12.15 TP53 MET ERBB2 EGFR CCND1
19
Show member pathways
12.12 ERBB2 EGFR CTNNB1 CCND1 AR
20 12.11 TP53 MET EGFR CTSD
21 12.11 TP53 MET ESR1 ERBB2 EGFR CTNNB1
22 12.08 NME1 MET CTNNB1 CDH1
23 12.06 TFF1 CTNNB1 CDH3 CDH1
24 12.04 TP53 ESR1 CTNNB1 CCND1
25
Show member pathways
12.01 TP53 CTNNB1 CDH3 CDH1 CCND1
26 12.01 TP53 ERBB2 CTNNB1 CCND1
27 11.99 TP53 EGFR CTNNB1 CCND1
28
Show member pathways
11.97 PGR ESR1 ERBB2 EGFR
29
Show member pathways
11.89 MET EGFR CTNNB1 CDH1
30
Show member pathways
11.88 ESR1 ERBB2 EGFR
31
Show member pathways
11.86 PGR ESR1 AR
32 11.8 CTNNB1 CDH1 CCND1 AR
33 11.79 EGFR CTNNB1 CCND1 BRCA1 AR
34 11.76 MET CTNNB1 CDH1
35 11.76 TP53 ERBB2 BRCA1
36
Show member pathways
11.74 ESR1 EGFR CCND1
37 11.73 ERBB2 EGFR CTNNB1
38 11.73 TP53 MET ERBB2 EGFR
39 11.71 ESR1 EGFR CCND1
40 11.71 TP53 ERBB2 BRCA1
41 11.67 ERBB2 CCND1 BRCA1
42 11.67 TP53 ERBB2 EGFR CDH1 CCND1
43 11.62 CTNNB1 CCND1 BRCA1 AR
44 11.62 MET ERBB2 EGFR CTNNB1 CDH1
45 11.59 TP53 EGFR CCND1
46 11.59 TP53 CCND1 BRCA1
47 11.52 TP53 CCND1 BRCA1
48 11.52 NME1 CTNNB1 CDH1
49
Show member pathways
11.5 TFF1 ESR1 BRCA1 AR
50 11.49 TP53 ESR1 CTSD

GO Terms for Breast Ductal Carcinoma

Cellular components related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 cytoplasm GO:0005737 9.83 ZFAS1 TP53 PGR NME1 KRT8 FAP
2 basal plasma membrane GO:0009925 9.43 MET ERBB2 EGFR
3 catenin complex GO:0016342 9.33 CTNNB1 CDH3 CDH1
4 flotillin complex GO:0016600 9.32 CTNNB1 CDH1
5 protein-containing complex GO:0032991 9.17 TP53 RAD54L ESR1 EGFR CTNNB1 BRCA1
6 nucleus GO:0005634 10.21 ZFAS1 TP53 RAD54L PIP PGR NME1

Biological processes related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

(show all 44)
# Name GO ID Score Top Affiliating Genes
1 protein deubiquitination GO:0016579 9.99 TP53 ESR1 BRCA1 AR
2 cell differentiation GO:0030154 9.99 TP53 TFF1 NME1 EGFR CTNNB1
3 negative regulation of gene expression GO:0010629 9.98 PGR NME1 ESR1 CTNNB1
4 transcription initiation from RNA polymerase II promoter GO:0006367 9.91 PGR ESR1 CCND1 AR
5 positive regulation of protein kinase B signaling GO:0051897 9.91 MET ESR1 ERBB2 EGFR
6 regulation of apoptotic process GO:0042981 9.91 TP53 NME1 ESR1 CTNNB1 BRCA1
7 positive regulation of transcription, DNA-templated GO:0045893 9.91 TP53 ESR1 EGFR CTNNB1 CDH1 BRCA1
8 cell-cell adhesion GO:0098609 9.88 EGFR CTNNB1 CDH3 CDH1
9 liver development GO:0001889 9.85 MET EGFR CCND1
10 cellular response to drug GO:0035690 9.83 TP53 NME1 EGFR
11 response to estrogen GO:0043627 9.83 ESR1 CCND1 BRCA1
12 positive regulation of epithelial cell proliferation GO:0050679 9.81 NME1 ERBB2 EGFR
13 cellular response to growth factor stimulus GO:0071363 9.81 ERBB2 EGFR CTNNB1
14 response to drug GO:0042493 9.8 RAD54L NME1 CTNNB1 CDH3 CDH1 CCND1
15 steroid hormone mediated signaling pathway GO:0043401 9.79 PGR ESR1 AR
16 response to estradiol GO:0032355 9.78 ESR1 EGFR CTNNB1 CCND1
17 androgen receptor signaling pathway GO:0030521 9.77 CTNNB1 BRCA1 AR
18 adherens junction organization GO:0034332 9.76 CTNNB1 CDH3 CDH1
19 cell proliferation GO:0008283 9.73 TP53 EGFR CTNNB1 AR
20 cellular process GO:0009987 9.69 CTNNB1 AR
21 positive regulation of insulin-like growth factor receptor signaling pathway GO:0043568 9.69 CDH3 AR
22 DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator GO:0006978 9.69 TP53 BRCA1
23 positive regulation of RNA polymerase II transcriptional preinitiation complex assembly GO:0045899 9.67 TP53 ESR1
24 Leydig cell differentiation GO:0033327 9.67 CCND1 AR
25 positive regulation of production of miRNAs involved in gene silencing by miRNA GO:1903800 9.67 TP53 EGFR
26 positive regulation of cell cycle arrest GO:0071158 9.67 TP53 FAP BRCA1
27 DNA strand renaturation GO:0000733 9.66 TP53 RAD54L
28 positive regulation of execution phase of apoptosis GO:1900119 9.65 TP53 FAP
29 mitotic G1 DNA damage checkpoint GO:0031571 9.64 TP53 CCND1
30 negative regulation of ERBB signaling pathway GO:1901185 9.63 ERBB2 EGFR
31 hair cycle process GO:0022405 9.62 CTNNB1 CDH3
32 mammary gland alveolus development GO:0060749 9.58 ESR1 CCND1 AR
33 morphogenesis of an epithelial fold GO:0060571 9.57 EGFR AR
34 epithelial cell differentiation involved in prostate gland development GO:0060742 9.56 CTNNB1 AR
35 tertiary branching involved in mammary gland duct morphogenesis GO:0060748 9.55 PGR AR
36 response to UV-A GO:0070141 9.54 EGFR CCND1
37 positive regulation of epithelial cell proliferation involved in prostate gland development GO:0060769 9.52 CTNNB1 AR
38 positive regulation of gene expression GO:0010628 9.5 TP53 PIP ERBB2 CTNNB1 CDH3 BRCA1
39 positive regulation of MAPK cascade GO:0043410 9.43 ERBB2 CTNNB1 AR
40 positive regulation of transcription by RNA polymerase III GO:0045945 9.37 AR
41 entry of bacterium into host cell GO:0035635 9.33 MET CTNNB1 CDH1
42 cellular response to indole-3-methanol GO:0071681 8.8 CTNNB1 CDH1 BRCA1
43 positive regulation of transcription by RNA polymerase II GO:0045944 10.06 TP53 PGR MET ESR1 EGFR CTNNB1
44 negative regulation of cell proliferation GO:0008285 10.05 TP53 TFF1 NME1 CTNNB1 AR

Molecular functions related to Breast Ductal Carcinoma according to GeneCards Suite gene sharing:

(show all 16)
# Name GO ID Score Top Affiliating Genes
1 protein kinase binding GO:0019901 9.92 TP53 ESR1 EGFR CTNNB1 CCND1
2 chromatin binding GO:0003682 9.89 TP53 ESR1 EGFR CTNNB1 AR
3 protein dimerization activity GO:0046983 9.81 PIP FAP ERBB2 AR
4 identical protein binding GO:0042802 9.81 TP53 PGR NME1 MET ESR1 ERBB2
5 transcription factor binding GO:0008134 9.8 TP53 ESR1 CTNNB1 CCND1 AR
6 beta-catenin binding GO:0008013 9.73 ESR1 CDH1 AR
7 ATPase binding GO:0051117 9.72 PGR ESR1 AR
8 transmembrane receptor protein tyrosine kinase activity GO:0004714 9.65 MET ERBB2 EGFR
9 RNA polymerase II transcription factor binding GO:0001085 9.63 TP53 CTNNB1 AR
10 steroid hormone receptor activity GO:0003707 9.61 PGR ESR1 AR
11 nitric-oxide synthase regulator activity GO:0030235 9.54 ESR1 EGFR
12 nuclear receptor activity GO:0004879 9.54 PGR ESR1 AR
13 steroid binding GO:0005496 9.5 PGR ESR1 AR
14 protein phosphatase binding GO:0019903 9.35 TP53 MET ERBB2 EGFR CTNNB1
15 enzyme binding GO:0019899 9.28 TP53 PGR NME1 ESR1 EGFR CTNNB1
16 protein binding GO:0005515 10.21 TP53 TFF1 RAD54L PIP PGR NME1

Sources for Breast Ductal Carcinoma

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HGMD
31 HMDB
32 HPO
33 ICD10
34 ICD10 via Orphanet
35 ICD9CM
36 IUPHAR
37 KEGG
38 LifeMap
40 LOVD
42 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
54 NINDS
55 Novoseek
57 OMIM
58 OMIM via Orphanet
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 TGDB
71 Tocris
72 UMLS
73 UMLS via Orphanet
Content
Loading form....