BRNRS
MCID: BRN045
MIFTS: 52

Brunner Syndrome (BRNRS)

Categories: Genetic diseases, Mental diseases, Metabolic diseases, Neuronal diseases, Rare diseases

Aliases & Classifications for Brunner Syndrome

MalaCards integrated aliases for Brunner Syndrome:

Name: Brunner Syndrome 57 12 73 20 43 58 72 36 29 13 6 44 15 70
Monoamine Oxidase a Deficiency 12 73 20 43 58
Antisocial Behavior 57 54 70
Brnrs 57 72
Antisocial Behavior, Susceptibility to 6
X-Linked Monoamine Oxidase Deficiency 43
Susceptibility to Antisocial Behavior 72
Deficiency of Monoamine Oxidase a 43
Anti-Social Behavior 17
Syndrome, Brunner 39

Characteristics:

Orphanet epidemiological data:

58
monoamine oxidase a deficiency
Inheritance: X-linked recessive; Age of onset: Childhood;

OMIM®:

57 (Updated 20-May-2021)
Miscellaneous:
variable manifestations
female carriers may be mildly affected
some patients may show symptoms of serotonin syndrome
phenotype may be exacerbated by ingestion of foods high in tyramine
phenotype may be exacerbated by maltreatment in childhood

Inheritance:
x-linked recessive


HPO:

31
brunner syndrome:
Inheritance x-linked recessive inheritance


Classifications:

Orphanet: 58  
Rare neurological diseases
Inborn errors of metabolism


External Ids:

Disease Ontology 12 DOID:0060693
OMIM® 57 300615
KEGG 36 H00548
ICD10 32 E70.8
ICD10 via Orphanet 33 E70.8
UMLS via Orphanet 71 C0796275
Orphanet 58 ORPHA3057
MedGen 41 C0796275
UMLS 70 C0233523 C0796275

Summaries for Brunner Syndrome

MedlinePlus Genetics : 43 Monoamine oxidase A deficiency is a rare disorder that occurs almost exclusively in males. It is characterized by mild intellectual disability and behavioral problems beginning in early childhood.Most boys with monoamine oxidase A deficiency are less able to control their impulses than their peers, causing aggressive or violent outbursts. In addition, affected individuals may have features of other behavioral disorders, including autism spectrum disorder and attention-deficit/hyperactivity disorder (ADHD). These features can include obsessive behaviors, difficulty forming friendships, and problems focusing attention. Sleep problems, such as trouble falling asleep or night terrors, can also occur in monoamine oxidase A deficiency.Some people with monoamine oxidase A deficiency have episodes of skin flushing, sweating, headaches, or diarrhea. Similar episodes can occur in female family members of males with monoamine oxidase A deficiency, although females do not experience other signs or symptoms of the condition.In some cases, certain foods, such as cheese, appear to worsen symptoms of monoamine oxidase A deficiency.

MalaCards based summary : Brunner Syndrome, also known as monoamine oxidase a deficiency, is related to conduct disorder and substance abuse. An important gene associated with Brunner Syndrome is MAOA (Monoamine Oxidase A), and among its related pathways/superpathways are Histidine metabolism and Tyrosine metabolism. The drugs Omega 3 Fatty Acid and Ethanol have been mentioned in the context of this disorder. Affiliated tissues include cortex, prefrontal cortex and brain, and related phenotypes are behavioral abnormality and cognitive impairment

Disease Ontology : 12 An amino acid metabolic disorder characterized by recessive X-linked inhetiance, impaired monoamine metabolism, impulsive aggressiveness and mild mental retardation that has material basis in mutation in the MAOA gene on chromosome Xp11.

GARD : 20 Monoamine oxidase A deficiency is a rare condition that is characterized by mild intellectual disability and behavioral difficulties (including aggressive and sometimes violent behaviors and autistic features ). Affected people may also experience night terrors, tremor, stereotypical hand movements, and/or occasional body twitches. Signs and symptoms generally develop in childhood and the condition is seen almost exclusively in males. Monoamine oxidase A deficiency is caused by changes ( mutations ) in the MAOA gene and is inherited in an X-linked recessive manner. Treatment is based on the signs and symptoms present in each person. Some recent studies suggest that cautious treatment with certain medications (called selective serotonin reuptake inhibitors) and dietary modifications can improve symptoms.

OMIM® : 57 Brunner syndrome is a recessive X-linked disorder characterized by impulsive aggressiveness and mild mental retardation associated with MAOA deficiency (Brunner et al., 1993). (300615) (Updated 20-May-2021)

KEGG : 36 Brunner syndrome is a form of X-linked non-dysmorphic mild mental retardation. It is caused by a monoamine oxidase A (MAOA) deficiency, which leads to an excess of monoamines in the brain, such as serotonin, dopamine, and epinephrine.

UniProtKB/Swiss-Prot : 72 Brunner syndrome: A form of X-linked non-dysmorphic mild mental retardation. Male patients are affected by borderline mental retardation and exhibit abnormal behavior, including disturbed regulation of impulsive aggression. Obligate female carriers have normal intelligence and behavior.

Wikipedia : 73 Brunner syndrome is a rare genetic disorder associated with a mutation in the MAOA gene. It is... more...

Related Diseases for Brunner Syndrome

Diseases related to Brunner Syndrome via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 114)
# Related Disease Score Top Affiliating Genes
1 conduct disorder 31.1 TPH1 SLC6A4 MAOA COMT
2 substance abuse 31.0 SLC6A4 MAOA COMT
3 oppositional defiant disorder 30.9 SLC6A4 MAOA COMT
4 antisocial personality disorder 30.5 TTF2 SLC6A4 MAOB MAOA COMT
5 personality disorder 30.4 TPH1 SLC6A4 MAOB MAOA HTR3A COMT
6 attention deficit-hyperactivity disorder 30.4 TPH1 SLC6A4 MAOB MAOA COMT
7 substance dependence 30.4 TPH1 SLC6A4 MAOA COMT
8 post-traumatic stress disorder 30.4 SLC6A4 MAOB MAOA COMT
9 alcohol use disorder 30.3 SLC6A4 HTR3A COMT AKR1A1
10 tic disorder 30.1 SLC6A4 MAOA COMT
11 alexithymia 30.1 SLC6A4 COMT
12 mental depression 30.0 TPH1 SLC6A4 MAOA COMT
13 narcissistic personality disorder 30.0 TTF2 MAOA
14 social phobia 30.0 SLC6A4 MAOA HTR3A COMT
15 depression 30.0 TPH1 SLC6A4 MAOA HTR3A
16 cocaine abuse 29.9 SLC6A4 MAOB HTR3A
17 alcohol dependence 29.8 TPH1 SLC6A4 MAOB MAOA HTR3A COMT
18 borderline personality disorder 29.7 TPH1 SLC6A4 MAOA HTR3A COMT
19 bipolar disorder 29.6 TPH1 SLC6A4 MAOA HTR3A COMT
20 diarrhea 29.6 TPH1 SLC6A4 HTR3A
21 major depressive disorder 29.4 TPH1 SLC6A4 MAOB MAOA HTR3A COMT
22 mood disorder 29.2 TPH1 SLC6A4 MAOB MAOA HTR3A COMT
23 psychotic disorder 29.2 TPH1 SLC6A4 MAOB MAOA HTR3A COMT
24 anxiety 29.2 TPH1 SLC6A4 MAOB MAOA HTR3A COMT
25 autism spectrum disorder 29.0 SLC6A8 SLC6A4 MAOB MAOA COMT
26 disease of mental health 28.0 TPH1 TAAR1 SLC6A8 SLC6A4 MAOB MAOA
27 ectrodactyly cardiopathy dysmorphism 11.0
28 resting heart rate, variation in 10.3
29 avoidant personality disorder 10.3
30 flying phobia 10.2 MAOA COMT
31 paraphilia disorder 10.2 SLC6A4 MAOA
32 schizotypal personality disorder 10.2
33 47,xyy 10.2
34 somatization disorder 10.2 SLC6A4 COMT
35 barbiturate dependence 10.2 TPH1 SLC6A4
36 barbiturate abuse 10.2 MAOB MAOA
37 cyclothymic disorder 10.2 SLC6A4 COMT
38 obsessive-compulsive personality disorder 10.2 SLC6A4 COMT
39 bestiality 10.2 MAOA COMT
40 substance-induced psychosis 10.2 SLC6A4 COMT
41 body dysmorphic disorder 10.2 SLC6A4 MAOA
42 melancholia 10.2 SLC6A4 MAOA
43 hypertryptophanemia 10.2 TPH1 SLC6A4
44 premature ejaculation 10.2 SLC6A4 COMT
45 pure autonomic failure 10.2 MAOB MAOA
46 glossitis 10.1 SLC6A4 COMT
47 kleptomania 10.1 SLC6A4 MAOA COMT
48 intermittent explosive disorder 10.1 SLC6A4 MAOA COMT
49 multiple personality disorder 10.1 TAAR1 MAOA
50 neurotic disorder 10.1 SLC6A4 MAOA COMT

Graphical network of the top 20 diseases related to Brunner Syndrome:



Diseases related to Brunner Syndrome

Symptoms & Phenotypes for Brunner Syndrome

Human phenotypes related to Brunner Syndrome:

58 31 (show all 13)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 behavioral abnormality 58 31 hallmark (90%) Very frequent (99-80%) HP:0000708
2 cognitive impairment 58 31 hallmark (90%) Very frequent (99-80%) HP:0100543
3 motor delay 31 occasional (7.5%) HP:0001270
4 diarrhea 31 very rare (1%) HP:0002014
5 flushing 31 very rare (1%) HP:0031284
6 intellectual disability 31 HP:0001249
7 self-injurious behavior 31 HP:0100716
8 autism 31 HP:0000717
9 headache 31 HP:0002315
10 aggressive behavior 31 HP:0000718
11 low frustration tolerance 31 HP:0000744
12 impulsivity 31 HP:0100710
13 kinetic tremor 31 HP:0030186

Symptoms via clinical synopsis from OMIM®:

57 (Updated 20-May-2021)
Neurologic Behavioral Psychiatric Manifestations:
autism
impulsivity
temper tantrums
obsessive tendencies
attention-deficit hyperactivity disorder
more
Abdomen Gastrointestinal:
diarrhea, episodic (in some patients)

Laboratory Abnormalities:
decreased monoamine oxidase a activity
increased serotonin
increased urinary levels of maoa substrates (endogenous bioamines)
decreased serum levels of maoa products
increased urinary metanephrines
more
Neurologic Central Nervous System:
headache, episodic
learning disabilities
essential tremor
delayed motor development (in some patients)
intellectual disability, mild to severe
more
Skin Nails Hair Skin:
flushing, episodic (in some patients)

Clinical features from OMIM®:

300615 (Updated 20-May-2021)

MGI Mouse Phenotypes related to Brunner Syndrome:

46
# Description MGI Source Accession Score Top Affiliating Genes
1 behavior/neurological MP:0005386 9.81 COMT HTR3A MAOA MAOB SLC6A4 SLC6A8
2 homeostasis/metabolism MP:0005376 9.65 AKR1A1 COMT HTR3A MAOA MAOB SLC6A4
3 nervous system MP:0003631 9.23 COMT HTR3A MAOA MAOB SLC6A4 SLC6A8

Drugs & Therapeutics for Brunner Syndrome

Drugs for Brunner Syndrome (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):


# Name Status Phase Clinical Trials Cas Number PubChem Id
1 Omega 3 Fatty Acid Phase 2, Phase 3
2
Ethanol Approved 64-17-5 702
3
Morphine Approved, Investigational 57-27-2 5288826

Interventional clinical trials:


# Name Status NCT ID Phase Drugs
1 Omega-3 Supplements to Reduce Antisocial Behaviour in Young Offenders: A Randomized Controlled Trial Completed NCT03627312 Phase 2, Phase 3
2 Intergenerational Transmission of Antisocial Behavior Unknown status NCT00060788
3 The Effect of Transcranial Direct Current Stimulation of the Prefrontal Cortex on Antisocial and Aggressive Behavior Completed NCT02427672
4 Age-17 Follow-up of Home Visiting Intervention Completed NCT00708695
5 Impact of a Program to Prevent the Risk of Antisocial Behavior and Attacks of Patients or Attendant on Healthcare Workers in an Ophthalmic Emergency Unit. Completed NCT02015884
6 The Effect of Transcranial Direct Current Stimulation of the Prefrontal Cortex on Antisocial Behavior Recruiting NCT04204759
7 Intervention Feasibility Study - Fatherhood After Prison: Healthy Children and Families Recruiting NCT04525703
8 Effectiveness Trial of Treatment to Reduce Serious Antisocial Behavior in Emerging Adults With Mental Illness Recruiting NCT02922335
9 Treatment of Justice-Involved Emerging Adults With Substance Use Disorders Recruiting NCT03035877
10 The Effect of Repeated Transcranial Direct Current Stimulation of the Prefrontal Cortex on Antisocial and Aggressive Behavior Active, not recruiting NCT02674516

Search NIH Clinical Center for Brunner Syndrome

Cochrane evidence based reviews: brunner syndrome

Genetic Tests for Brunner Syndrome

Genetic tests related to Brunner Syndrome:

# Genetic test Affiliating Genes
1 Brunner Syndrome 29 MAOA

Anatomical Context for Brunner Syndrome

MalaCards organs/tissues related to Brunner Syndrome:

40
Cortex, Prefrontal Cortex, Brain, Heart

Publications for Brunner Syndrome

Articles related to Brunner Syndrome:

(show top 50) (show all 60)
# Title Authors PMID Year
1
New insights into Brunner syndrome and potential for targeted therapy. 61 6 57
25807999 2016
2
20 ans après: a second mutation in MAOA identified by targeted high-throughput sequencing in a family with altered behavior and cognition. 61 57 6
24169519 2014
3
The VNTR 2 repeat in MAOA and delinquent behavior in adolescence and young adulthood: associations and MAOA promoter activity. 57 6
18212819 2008
4
Neural mechanisms of genetic risk for impulsivity and violence in humans. 57 6
16569698 2006
5
Role of genotype in the cycle of violence in maltreated children. 57 6
12161658 2002
6
Monoamine oxidase deficiency: a cause of flushing and attention-deficit/ hyperactivity disorder? 6 57
11700166 2001
7
Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A. 57 6
8211186 1993
8
Autism severity is associated with child and maternal MAOA genotypes. 6
20573161 2011
9
Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation. 6
19168625 2009
10
Monoamine oxidase-a genetic variations influence brain activity associated with inhibitory control: new insight into the neural correlates of impulsivity. 6
16202396 2006
11
Association of autism severity with a monoamine oxidase A functional polymorphism. 6
12919132 2003
12
A functional polymorphism in the monoamine oxidase A gene promoter. 6
9799080 1998
13
Specification of the phenotype required for men with monoamine oxidase type A deficiency. 57
7649563 1995
14
X-linked borderline mental retardation with prominent behavioral disturbance: phenotype, genetic localization, and evidence for disturbed monoamine metabolism. 57
8503438 1993
15
Brain MR patterns in inherited disorders of monoamine neurotransmitters: An analysis of 70 patients. 61
33443316 2021
16
In silico method for identification of novel copper and iron metabolism proteins in various neurodegenerative disorders. 61
30831127 2019
17
From aggression to autism: new perspectives on the behavioral sequelae of monoamine oxidase deficiency. 61
29748850 2018
18
The aggression and behavioral abnormalities associated with monoamine oxidase A deficiency are rescued by acute inhibition of serotonin reuptake. 61
24882701 2014
19
Variation in the catechol-O-methyltransferase Val 158 Met polymorphism associated with conduct disorder and ADHD symptoms, among adolescent male delinquents. 54
19997043 2010
20
Early life stress, MAOA, and gene-environment interactions predict behavioral disinhibition in children. 54
19804559 2010
21
[Development of serotonergic neurons of dorsal raphe nuclei in mice with knockout of monoamine oxidase A and 5-HT1A and 5-HT1B autoreceptor]. 61
19705758 2009
22
Effects of MAOA-genotype, alcohol consumption, and aging on violent behavior. 54
19120058 2009
23
MAOA genotype, maltreatment, and aggressive behavior: the changing impact of genotype at varying levels of trauma. 54
18996506 2009
24
[The development of antisocial behavior: psychobiological and environmental factors and gene-environment interactions]. 54
19226487 2009
25
Brain monoamine oxidase A activity predicts trait aggression. 54
18463263 2008
26
Novel monoamine oxidase A knock out mice with human-like spontaneous mutation. 61
18418249 2008
27
Interaction between a functional MAOA locus and childhood sexual abuse predicts alcoholism and antisocial personality disorder in adult women. 54
17592478 2008
28
Genetic variation in MAOA modulates ventromedial prefrontal circuitry mediating individual differences in human personality. 54
17519928 2008
29
No evidence for interaction between MAOA and childhood adversity for antisocial behavior. 54
18023041 2008
30
A replicated molecular genetic basis for subtyping antisocial behavior in children with attention-deficit/hyperactivity disorder. 54
18250258 2008
31
A non-additive interaction of a functional MAO-A VNTR and testosterone predicts antisocial behavior. 54
17429405 2008
32
Psychiatric manifestations revealing inborn errors of metabolism in adolescents and adults. 61
17694356 2007
33
Adolescent conduct disorder and interpersonal callousness as predictors of psychopathy in young adults. 54
17658978 2007
34
Early trauma and increased risk for physical aggression during adulthood: the moderating role of MAOA genotype. 54
17534436 2007
35
Meta-analysis of gene-environment interactions in developmental psychopathology. 54
17931432 2007
36
Genetic and environmental influences on the development of alcoholism: resilience vs. risk. 54
17347351 2006
37
COMT Val108/158Met gene variant, birth weight, and conduct disorder in children with ADHD. 54
17075359 2006
38
The association of DNA sequence variation at the MAOA genetic locus with quantitative behavioural traits in normal males. 61
16896926 2006
39
MAOA, maltreatment, and gene-environment interaction predicting children's mental health: new evidence and a meta-analysis. 54
16801953 2006
40
Childhood maltreatment, subsequent antisocial behavior, and the role of monoamine oxidase A genotype. 54
17008143 2006
41
MAOA and the "cycle of violence:" childhood abuse and neglect, MAOA genotype, and risk for violent and antisocial behavior. 54
16814261 2006
42
Interaction between MAO-A genotype and maltreatment in the risk for conduct disorder: failure to confirm in adolescent patients. 54
16741202 2006
43
Structural variation of the monoamine oxidase A gene promoter repeat polymorphism in nonhuman primates. 54
16436187 2006
44
Alcohol dependence and gene x environment interaction in emotion regulation: Is serotonin the link? 54
16288736 2005
45
Serotonin transporter promoter polymorphism genotype is associated with temperament, personality traits and illegal drugs use among adolescents. 54
15666036 2005
46
Monoamine oxidase A (MAOA) and antisocial behaviors in the presence of childhood and adolescent maltreatment. 54
15806601 2005
47
Gender differences in psychopathy in a Swedish offender sample. 54
16333809 2005
48
Monoamine oxidase A-deficiency and noradrenergic respiratory regulations in neonatal mice. 61
12672546 2003
49
Analysis of monoamine oxidase A (MAOA) promoter polymorphism in Finnish male alcoholics. 54
11927135 2002
50
Mild learning difficulties and offending behaviour--is there a link with monoamine oxidase A deficiency? 61
11702062 2001

Variations for Brunner Syndrome

ClinVar genetic disease variations for Brunner Syndrome:

6 (show all 21)
# Gene Name Type Significance ClinVarId dbSNP ID Position
1 MAOA NM_000240.3(MAOA):c.886C>T (p.Gln296Ter) SNV Pathogenic 9967 rs72554632 GRCh37: X:43591031-43591031
GRCh38: X:43731784-43731784
2 MAOA NM_000240.3(MAOA):c.797G>T (p.Cys266Phe) SNV Pathogenic 139432 rs587777457 GRCh37: X:43590942-43590942
GRCh38: X:43731695-43731695
3 MAOA NM_000240.3(MAOA):c.749_750insT (p.Ser251fs) Insertion Pathogenic 208352 rs796065311 GRCh37: X:43590591-43590592
GRCh38: X:43731344-43731345
4 MAOA NM_000240.3(MAOA):c.133C>T (p.Arg45Trp) SNV Pathogenic 208353 rs796065312 GRCh37: X:43542820-43542820
GRCh38: X:43683572-43683572
5 MAOA NM_000240.3(MAOA):c.730G>A (p.Val244Ile) SNV Likely pathogenic 431096 rs1135401773 GRCh37: X:43590572-43590572
GRCh38: X:43731325-43731325
6 MAOA NM_000240.3(MAOA):c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) Microsatellite risk factor 9968 GRCh37: X:43514349-43514378
GRCh38: X:43655101-43655130
7 MAOA NM_000240.3(MAOA):c.1248G>A (p.Met416Ile) SNV Uncertain significance 282807 rs772161607 GRCh37: X:43601280-43601280
GRCh38: X:43742033-43742033
8 MAOA NM_000240.4(MAOA):c.411+12G>A SNV Uncertain significance 1034122 GRCh37: X:43571235-43571235
GRCh38: X:43711988-43711988
9 MAOA NM_000240.4(MAOA):c.1440C>A (p.Asp480Glu) SNV Uncertain significance 1035352 GRCh37: X:43603616-43603616
GRCh38: X:43744369-43744369
10 MAOA NM_000240.4(MAOA):c.805G>A (p.Val269Ile) SNV Uncertain significance 1064570 GRCh37: X:43590950-43590950
GRCh38: X:43731703-43731703
11 MAOA NM_000240.3(MAOA):c.890G>A (p.Arg297Gln) SNV Uncertain significance 567389 rs780647851 GRCh37: X:43591035-43591035
GRCh38: X:43731788-43731788
12 MAOA NM_000240.3(MAOA):c.402G>A (p.Met134Ile) SNV Uncertain significance 571290 rs771740634 GRCh37: X:43571214-43571214
GRCh38: X:43711967-43711967
13 MAOA NM_000240.3(MAOA):c.3G>A (p.Met1Ile) SNV Uncertain significance 646105 rs1601921232 GRCh37: X:43515592-43515592
GRCh38: X:43656344-43656344
14 MAOA NM_000240.3(MAOA):c.260A>G (p.Glu87Gly) SNV Uncertain significance 650306 rs747229681 GRCh37: X:43552629-43552629
GRCh38: X:43693382-43693382
15 MAOA NM_000240.3(MAOA):c.74-6C>T SNV Likely benign 769174 rs1196492976 GRCh37: X:43542755-43542755
GRCh38: X:43683507-43683507
16 MAOA NM_000240.3(MAOA):c.702C>T (p.Leu234=) SNV Likely benign 722280 rs370853887 GRCh37: X:43590544-43590544
GRCh38: X:43731297-43731297
17 MAOA NM_000240.3(MAOA):c.1545G>T (p.Gly515=) SNV Likely benign 728527 rs1223537199 GRCh37: X:43603721-43603721
GRCh38: X:43744474-43744474
18 MAOA NM_000240.3(MAOA):c.816G>A (p.Ala272=) SNV Benign 732079 rs751223564 GRCh37: X:43590961-43590961
GRCh38: X:43731714-43731714
19 MAOA NM_000240.3(MAOA):c.168+11_168+15del Deletion Benign 718979 rs375984321 GRCh37: X:43542865-43542869
GRCh38: X:43683617-43683621
20 MAOA NM_000240.3(MAOA):c.515G>A (p.Arg172Gln) SNV Benign 435814 rs58524323 GRCh37: X:43587431-43587431
GRCh38: X:43728184-43728184
21 MAOA NM_000240.3(MAOA):c.825G>A (p.Pro275=) SNV Benign 198701 rs138703731 GRCh37: X:43590970-43590970
GRCh38: X:43731723-43731723

Expression for Brunner Syndrome

Search GEO for disease gene expression data for Brunner Syndrome.

Pathways for Brunner Syndrome

Pathways related to Brunner Syndrome according to KEGG:

36
# Name Kegg Source Accession
1 Histidine metabolism hsa00340
2 Tyrosine metabolism hsa00350
3 Tryptophan metabolism hsa00380
4 Dopaminergic synapse hsa04728

Pathways related to Brunner Syndrome according to GeneCards Suite gene sharing:

(show all 15)
# Super pathways Score Top Affiliating Genes
1 11.97 TPH1 SLC6A4 MAOA HTR3A
2
Show member pathways
11.63 TPH1 MAOB MAOA
3 11.61 TPH1 SLC6A4 MAOB MAOA HTR3A
4
Show member pathways
11.6 TPH1 MAOB MAOA AKR1A1
5
Show member pathways
11.56 MAOB MAOA COMT
6
Show member pathways
11.26 MAOB MAOA
7
Show member pathways
11.17 SLC6A4 MAOA
8
Show member pathways
11.04 MAOB MAOA
9
Show member pathways
11.02 SLC6A4 MAOA COMT
10
Show member pathways
10.92 TPH1 MAOA COMT
11 10.7 TPH1 SLC6A4 MAOA HTR3A
12
Show member pathways
10.67 MAOB MAOA COMT
13
Show member pathways
10.62 MAOB MAOA
14 10.58 MAOB MAOA COMT
15
Show member pathways
10.29 SLC6A4 MAOB MAOA COMT

GO Terms for Brunner Syndrome

Cellular components related to Brunner Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 integral component of postsynaptic membrane GO:0099055 8.62 SLC6A4 HTR3A

Biological processes related to Brunner Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 oxidation-reduction process GO:0055114 9.56 TPH1 MAOB MAOA AKR1A1
2 neurotransmitter transport GO:0006836 9.32 SLC6A8 SLC6A4
3 catecholamine metabolic process GO:0006584 9.16 MAOA COMT
4 neurotransmitter catabolic process GO:0042135 9.13 MAOB MAOA COMT
5 dopamine catabolic process GO:0042420 8.8 MAOB MAOA COMT

Molecular functions related to Brunner Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 oxidoreductase activity GO:0016491 9.46 TPH1 MAOB MAOA AKR1A1
2 serotonin binding GO:0051378 8.96 SLC6A4 HTR3A
3 primary amine oxidase activity GO:0008131 8.62 MAOB MAOA

Sources for Brunner Syndrome

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
20 GARD
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
53 NINDS
54 Novoseek
56 OMIM via Orphanet
57 OMIM® (Updated 20-May-2021)
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 Tocris
70 UMLS
71 UMLS via Orphanet
Content
Loading form....