CMT2V
MCID: CHR548
MIFTS: 22

Charcot-Marie-Tooth Disease, Axonal, Type 2v (CMT2V)

Categories: Genetic diseases, Metabolic diseases, Neuronal diseases, Rare diseases, Skin diseases

Aliases & Classifications for Charcot-Marie-Tooth Disease, Axonal, Type 2v

MalaCards integrated aliases for Charcot-Marie-Tooth Disease, Axonal, Type 2v:

Name: Charcot-Marie-Tooth Disease, Axonal, Type 2v 57 75 40
Cmt2v 57 12 59 75
Charcot-Marie-Tooth Disease, Axonal, Autosomal Dominant, Type 2v 57 75
Autosomal Dominant Charcot-Marie-Tooth Disease Type 2v 12 59
Charcot-Marie-Tooth Disease, Axonal Type 2v 29 6
Charcot-Marie-Tooth Neuropathy, Type 2v 57 75
Autosomal Dominant Charcot-Marie-Tooth Disease Type 2 Due to Naglu Mutation 59
Autosomal Dominant Axonal Charcot-Marie-Tooth Disease Type 2v 12
Hereditary Adult-Onset Painful Axonal Polyneuropathy 59
Charcot-Marie-Tooth Disease Axonal Type 2v 12
Charcot-Marie-Tooth Neuropathy Type 2v 12
Charcot-Marie-Tooth Disease 2v 75

Characteristics:

Orphanet epidemiological data:

59
autosomal dominant charcot-marie-tooth disease type 2v
Inheritance: Autosomal dominant; Prevalence: <1/1000000 (Worldwide); Age of onset: Adolescent,Adult,Elderly;

OMIM:

57
Inheritance:
autosomal dominant

Miscellaneous:
progressive disorder
mean age at onset 41 years (range 18 to 61)
one family of french-canadian origin has been reported (last curated july 2015)


HPO:

32
charcot-marie-tooth disease, axonal, type 2v:
Onset and clinical course progressive
Inheritance autosomal dominant inheritance


Classifications:

Orphanet: 59  
Rare neurological diseases


External Ids:

OMIM 57 616491
Disease Ontology 12 DOID:0110178
Orphanet 59 ORPHA447964
ICD10 via Orphanet 34 G60.0
MeSH 44 D002607

Summaries for Charcot-Marie-Tooth Disease, Axonal, Type 2v

UniProtKB/Swiss-Prot : 75 Charcot-Marie-Tooth disease 2V: An axonal form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathies (designated CMT1 when they are dominantly inherited) and primary peripheral axonal neuropathies (CMT2). Neuropathies of the CMT2 group are characterized by signs of axonal degeneration in the absence of obvious myelin alterations, normal or slightly reduced nerve conduction velocities, and progressive distal muscle weakness and atrophy. CMT2V is an autosomal dominant sensory neuropathy with late onset. The main clinical feature is recurrent leg pain that progresses to constant painful paraesthesias in the feet and later the hands. As it evolves, some patients develop a mild sensory ataxia.

MalaCards based summary : Charcot-Marie-Tooth Disease, Axonal, Type 2v, is also known as cmt2v. An important gene associated with Charcot-Marie-Tooth Disease, Axonal, Type 2v is NAGLU (N-Acetyl-Alpha-Glucosaminidase). Affiliated tissues include skin, and related phenotypes are paresthesia and hyporeflexia

Disease Ontology : 12 A Charcot-Marie-Tooth disease type 2 that has material basis in heterozygous mutation in the NAGLU gene on chromosome 17q21.

Description from OMIM: 616491

Related Diseases for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Symptoms & Phenotypes for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Symptoms via clinical synopsis from OMIM:

57
Neurologic Peripheral Nervous System:
peripheral neuropathy
hyporeflexia
distal sensory impairment
pain in the lower extremities
paresthesia in the upper extremities may occur later
more
Neurologic Central Nervous System:
sleep disturbances due to leg pain
sensory ataxia (in some patients)


Clinical features from OMIM:

616491

Human phenotypes related to Charcot-Marie-Tooth Disease, Axonal, Type 2v:

32
# Description HPO Frequency HPO Source Accession
1 paresthesia 32 HP:0003401
2 hyporeflexia 32 HP:0001265
3 sensory ataxia 32 occasional (7.5%) HP:0010871
4 distal sensory impairment 32 HP:0002936

Drugs & Therapeutics for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Search Clinical Trials , NIH Clinical Center for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Genetic Tests for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Genetic tests related to Charcot-Marie-Tooth Disease, Axonal, Type 2v:

# Genetic test Affiliating Genes
1 Charcot-Marie-Tooth Disease, Axonal Type 2v 29 NAGLU

Anatomical Context for Charcot-Marie-Tooth Disease, Axonal, Type 2v

MalaCards organs/tissues related to Charcot-Marie-Tooth Disease, Axonal, Type 2v:

41
Skin

Publications for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Variations for Charcot-Marie-Tooth Disease, Axonal, Type 2v

UniProtKB/Swiss-Prot genetic disease variations for Charcot-Marie-Tooth Disease, Axonal, Type 2v:

75
# Symbol AA change Variation ID SNP ID
1 NAGLU p.Ile403Thr VAR_074607 rs796052122

ClinVar genetic disease variations for Charcot-Marie-Tooth Disease, Axonal, Type 2v:

6 (show all 26)
# Gene Variation Type Significance SNP ID Assembly Location
1 NAGLU NM_000263.3(NAGLU): c.1208T> C (p.Ile403Thr) single nucleotide variant Pathogenic rs796052122 GRCh37 Chromosome 17, 40695232: 40695232
2 NAGLU NM_000263.3(NAGLU): c.1208T> C (p.Ile403Thr) single nucleotide variant Pathogenic rs796052122 GRCh38 Chromosome 17, 42543214: 42543214
3 NAGLU NM_000263.3(NAGLU): c.1788C> T (p.Gly596=) single nucleotide variant Benign rs115166595 GRCh37 Chromosome 17, 40695812: 40695812
4 NAGLU NM_000263.3(NAGLU): c.1788C> T (p.Gly596=) single nucleotide variant Benign rs115166595 GRCh38 Chromosome 17, 42543794: 42543794
5 NAGLU NM_000263.3(NAGLU): c.1860C> T (p.Ser620=) single nucleotide variant Conflicting interpretations of pathogenicity rs151013014 GRCh38 Chromosome 17, 42543866: 42543866
6 NAGLU NM_000263.3(NAGLU): c.1860C> T (p.Ser620=) single nucleotide variant Conflicting interpretations of pathogenicity rs151013014 GRCh37 Chromosome 17, 40695884: 40695884
7 NAGLU NM_000263.3(NAGLU): c.419A> G (p.Tyr140Cys) single nucleotide variant Pathogenic rs753520553 GRCh38 Chromosome 17, 42537433: 42537433
8 NAGLU NM_000263.3(NAGLU): c.419A> G (p.Tyr140Cys) single nucleotide variant Pathogenic rs753520553 GRCh37 Chromosome 17, 40689451: 40689451
9 NAGLU NM_000263.3(NAGLU): c.1983G> A (p.Lys661=) single nucleotide variant Benign rs181021573 GRCh37 Chromosome 17, 40696007: 40696007
10 NAGLU NM_000263.3(NAGLU): c.1983G> A (p.Lys661=) single nucleotide variant Benign rs181021573 GRCh38 Chromosome 17, 42543989: 42543989
11 NAGLU NM_000263.3(NAGLU): c.1487T> C (p.Leu496Pro) single nucleotide variant Uncertain significance rs569519789 GRCh38 Chromosome 17, 42543493: 42543493
12 NAGLU NM_000263.3(NAGLU): c.1487T> C (p.Leu496Pro) single nucleotide variant Uncertain significance rs569519789 GRCh37 Chromosome 17, 40695511: 40695511
13 NAGLU NM_000263.3(NAGLU): c.1834A> G (p.Ser612Gly) single nucleotide variant Pathogenic rs148881970 GRCh37 Chromosome 17, 40695858: 40695858
14 NAGLU NM_000263.3(NAGLU): c.1834A> G (p.Ser612Gly) single nucleotide variant Pathogenic rs148881970 GRCh38 Chromosome 17, 42543840: 42543840
15 NAGLU NM_000263.3(NAGLU): c.15_20dup (p.Ala7_Ala8insValAla) duplication Likely benign GRCh38 Chromosome 17, 42536287: 42536292
16 NAGLU NM_000263.3(NAGLU): c.15_20dup (p.Ala7_Ala8insValAla) duplication Likely benign GRCh37 Chromosome 17, 40688305: 40688310
17 NAGLU NM_000263.3(NAGLU): c.1304A> G (p.Asn435Ser) single nucleotide variant Uncertain significance rs764815033 GRCh37 Chromosome 17, 40695328: 40695328
18 NAGLU NM_000263.3(NAGLU): c.1304A> G (p.Asn435Ser) single nucleotide variant Uncertain significance rs764815033 GRCh38 Chromosome 17, 42543310: 42543310
19 NAGLU NM_000263.3(NAGLU): c.214_237delGCGGCGCGCGTGCGGGTGCGCGGC (p.Ala72_Gly79del) deletion Uncertain significance GRCh38 Chromosome 17, 42536486: 42536509
20 NAGLU NM_000263.3(NAGLU): c.214_237delGCGGCGCGCGTGCGGGTGCGCGGC (p.Ala72_Gly79del) deletion Uncertain significance GRCh37 Chromosome 17, 40688504: 40688527
21 NAGLU NM_000263.3(NAGLU): c.569A> G (p.Asn190Ser) single nucleotide variant Uncertain significance rs375458666 GRCh37 Chromosome 17, 40690394: 40690394
22 NAGLU NM_000263.3(NAGLU): c.569A> G (p.Asn190Ser) single nucleotide variant Uncertain significance rs375458666 GRCh38 Chromosome 17, 42538376: 42538376
23 NAGLU NM_000263.3(NAGLU): c.1090G> T (p.Ala364Ser) single nucleotide variant Uncertain significance GRCh37 Chromosome 17, 40695114: 40695114
24 NAGLU NM_000263.3(NAGLU): c.1090G> T (p.Ala364Ser) single nucleotide variant Uncertain significance GRCh38 Chromosome 17, 42543096: 42543096
25 NAGLU NM_000263.3(NAGLU): c.1973A> G (p.Tyr658Cys) single nucleotide variant Uncertain significance GRCh37 Chromosome 17, 40695997: 40695997
26 NAGLU NM_000263.3(NAGLU): c.1973A> G (p.Tyr658Cys) single nucleotide variant Uncertain significance GRCh38 Chromosome 17, 42543979: 42543979

Expression for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Search GEO for disease gene expression data for Charcot-Marie-Tooth Disease, Axonal, Type 2v.

Pathways for Charcot-Marie-Tooth Disease, Axonal, Type 2v

GO Terms for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Sources for Charcot-Marie-Tooth Disease, Axonal, Type 2v

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 ExPASy
19 FMA
28 GO
29 GTR
30 HGMD
31 HMDB
32 HPO
33 ICD10
34 ICD10 via Orphanet
35 ICD9CM
36 IUPHAR
37 KEGG
38 LifeMap
40 LOVD
42 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
54 NINDS
55 Novoseek
57 OMIM
58 OMIM via Orphanet
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 SNOMED-CT via Orphanet
71 TGDB
72 Tocris
73 UMLS
74 UMLS via Orphanet
Content
Loading form....