CMT2V
MCID: CHR548
MIFTS: 21

Charcot-Marie-Tooth Disease, Axonal, Type 2v (CMT2V)

Categories: Genetic diseases, Metabolic diseases, Neuronal diseases, Rare diseases, Skin diseases

Aliases & Classifications for Charcot-Marie-Tooth Disease, Axonal, Type 2v

MalaCards integrated aliases for Charcot-Marie-Tooth Disease, Axonal, Type 2v:

Name: Charcot-Marie-Tooth Disease, Axonal, Type 2v 58 76 41
Cmt2v 58 12 60 76
Charcot-Marie-Tooth Disease, Axonal, Autosomal Dominant, Type 2v 58 76
Autosomal Dominant Charcot-Marie-Tooth Disease Type 2v 12 60
Charcot-Marie-Tooth Disease, Axonal Type 2v 30 6
Charcot-Marie-Tooth Neuropathy, Type 2v 58 76
Autosomal Dominant Charcot-Marie-Tooth Disease Type 2 Due to Naglu Mutation 60
Autosomal Dominant Axonal Charcot-Marie-Tooth Disease Type 2v 12
Hereditary Adult-Onset Painful Axonal Polyneuropathy 60
Charcot-Marie-Tooth Disease Axonal Type 2v 12
Charcot-Marie-Tooth Neuropathy Type 2v 12
Charcot-Marie-Tooth Disease 2v 76

Characteristics:

Orphanet epidemiological data:

60
autosomal dominant charcot-marie-tooth disease type 2v
Inheritance: Autosomal dominant; Prevalence: <1/1000000 (Worldwide); Age of onset: Adolescent,Adult,Elderly;

OMIM:

58
Inheritance:
autosomal dominant

Miscellaneous:
progressive disorder
mean age at onset 41 years (range 18 to 61)
one family of french-canadian origin has been reported (last curated july 2015)


HPO:

33
charcot-marie-tooth disease, axonal, type 2v:
Onset and clinical course progressive
Inheritance autosomal dominant inheritance


Classifications:

Orphanet: 60  
Rare neurological diseases


External Ids:

Disease Ontology 12 DOID:0110178
OMIM 58 616491
MeSH 45 D002607
ICD10 via Orphanet 35 G60.0
Orphanet 60 ORPHA447964

Summaries for Charcot-Marie-Tooth Disease, Axonal, Type 2v

UniProtKB/Swiss-Prot : 76 Charcot-Marie-Tooth disease 2V: An axonal form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathies (designated CMT1 when they are dominantly inherited) and primary peripheral axonal neuropathies (CMT2). Neuropathies of the CMT2 group are characterized by signs of axonal degeneration in the absence of obvious myelin alterations, normal or slightly reduced nerve conduction velocities, and progressive distal muscle weakness and atrophy. CMT2V is an autosomal dominant sensory neuropathy with late onset. The main clinical feature is recurrent leg pain that progresses to constant painful paraesthesias in the feet and later the hands. As it evolves, some patients develop a mild sensory ataxia.

MalaCards based summary : Charcot-Marie-Tooth Disease, Axonal, Type 2v, is also known as cmt2v. An important gene associated with Charcot-Marie-Tooth Disease, Axonal, Type 2v is NAGLU (N-Acetyl-Alpha-Glucosaminidase). Related phenotypes are sensory ataxia and paresthesia

Disease Ontology : 12 A Charcot-Marie-Tooth disease type 2 that has material basis in heterozygous mutation in the NAGLU gene on chromosome 17q21.

Description from OMIM: 616491

Related Diseases for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Symptoms & Phenotypes for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Human phenotypes related to Charcot-Marie-Tooth Disease, Axonal, Type 2v:

33
# Description HPO Frequency HPO Source Accession
1 sensory ataxia 33 occasional (7.5%) HP:0010871
2 paresthesia 33 HP:0003401
3 hyporeflexia 33 HP:0001265
4 distal sensory impairment 33 HP:0002936

Symptoms via clinical synopsis from OMIM:

58
Neurologic Peripheral Nervous System:
peripheral neuropathy
hyporeflexia
distal sensory impairment
pain in the lower extremities
paresthesia in the upper extremities may occur later
more
Neurologic Central Nervous System:
sleep disturbances due to leg pain
sensory ataxia (in some patients)

Clinical features from OMIM:

616491

Drugs & Therapeutics for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Search Clinical Trials , NIH Clinical Center for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Genetic Tests for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Genetic tests related to Charcot-Marie-Tooth Disease, Axonal, Type 2v:

# Genetic test Affiliating Genes
1 Charcot-Marie-Tooth Disease, Axonal Type 2v 30 NAGLU

Anatomical Context for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Publications for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Variations for Charcot-Marie-Tooth Disease, Axonal, Type 2v

UniProtKB/Swiss-Prot genetic disease variations for Charcot-Marie-Tooth Disease, Axonal, Type 2v:

76
# Symbol AA change Variation ID SNP ID
1 NAGLU p.Ile403Thr VAR_074607 rs796052122

ClinVar genetic disease variations for Charcot-Marie-Tooth Disease, Axonal, Type 2v:

6 (show all 26)
# Gene Variation Type Significance SNP ID Assembly Location
1 NAGLU NM_000263.3(NAGLU): c.1208T> C (p.Ile403Thr) single nucleotide variant Pathogenic rs796052122 GRCh37 Chromosome 17, 40695232: 40695232
2 NAGLU NM_000263.3(NAGLU): c.1208T> C (p.Ile403Thr) single nucleotide variant Pathogenic rs796052122 GRCh38 Chromosome 17, 42543214: 42543214
3 NAGLU NM_000263.3(NAGLU): c.1788C> T (p.Gly596=) single nucleotide variant Benign rs115166595 GRCh37 Chromosome 17, 40695812: 40695812
4 NAGLU NM_000263.3(NAGLU): c.1788C> T (p.Gly596=) single nucleotide variant Benign rs115166595 GRCh38 Chromosome 17, 42543794: 42543794
5 NAGLU NM_000263.3(NAGLU): c.1860C> T (p.Ser620=) single nucleotide variant Conflicting interpretations of pathogenicity rs151013014 GRCh38 Chromosome 17, 42543866: 42543866
6 NAGLU NM_000263.3(NAGLU): c.1860C> T (p.Ser620=) single nucleotide variant Conflicting interpretations of pathogenicity rs151013014 GRCh37 Chromosome 17, 40695884: 40695884
7 NAGLU NM_000263.3(NAGLU): c.419A> G (p.Tyr140Cys) single nucleotide variant Pathogenic rs753520553 GRCh38 Chromosome 17, 42537433: 42537433
8 NAGLU NM_000263.3(NAGLU): c.419A> G (p.Tyr140Cys) single nucleotide variant Pathogenic rs753520553 GRCh37 Chromosome 17, 40689451: 40689451
9 NAGLU NM_000263.3(NAGLU): c.1983G> A (p.Lys661=) single nucleotide variant Benign rs181021573 GRCh37 Chromosome 17, 40696007: 40696007
10 NAGLU NM_000263.3(NAGLU): c.1983G> A (p.Lys661=) single nucleotide variant Benign rs181021573 GRCh38 Chromosome 17, 42543989: 42543989
11 NAGLU NM_000263.3(NAGLU): c.1487T> C (p.Leu496Pro) single nucleotide variant Uncertain significance rs569519789 GRCh37 Chromosome 17, 40695511: 40695511
12 NAGLU NM_000263.3(NAGLU): c.1487T> C (p.Leu496Pro) single nucleotide variant Uncertain significance rs569519789 GRCh38 Chromosome 17, 42543493: 42543493
13 NAGLU NM_000263.3(NAGLU): c.1834A> G (p.Ser612Gly) single nucleotide variant Pathogenic rs148881970 GRCh37 Chromosome 17, 40695858: 40695858
14 NAGLU NM_000263.3(NAGLU): c.1834A> G (p.Ser612Gly) single nucleotide variant Pathogenic rs148881970 GRCh38 Chromosome 17, 42543840: 42543840
15 NAGLU NM_000263.3(NAGLU): c.15_20dup (p.Ala7_Ala8insValAla) duplication Likely benign rs1024697806 GRCh38 Chromosome 17, 42536287: 42536292
16 NAGLU NM_000263.3(NAGLU): c.15_20dup (p.Ala7_Ala8insValAla) duplication Likely benign rs1024697806 GRCh37 Chromosome 17, 40688305: 40688310
17 NAGLU NM_000263.3(NAGLU): c.1304A> G (p.Asn435Ser) single nucleotide variant Uncertain significance rs764815033 GRCh37 Chromosome 17, 40695328: 40695328
18 NAGLU NM_000263.3(NAGLU): c.1304A> G (p.Asn435Ser) single nucleotide variant Uncertain significance rs764815033 GRCh38 Chromosome 17, 42543310: 42543310
19 NAGLU NM_000263.3(NAGLU): c.214_237delGCGGCGCGCGTGCGGGTGCGCGGC (p.Ala72_Gly79del) deletion Uncertain significance GRCh38 Chromosome 17, 42536486: 42536509
20 NAGLU NM_000263.3(NAGLU): c.214_237delGCGGCGCGCGTGCGGGTGCGCGGC (p.Ala72_Gly79del) deletion Uncertain significance GRCh37 Chromosome 17, 40688504: 40688527
21 NAGLU NM_000263.3(NAGLU): c.569A> G (p.Asn190Ser) single nucleotide variant Uncertain significance GRCh37 Chromosome 17, 40690394: 40690394
22 NAGLU NM_000263.3(NAGLU): c.569A> G (p.Asn190Ser) single nucleotide variant Uncertain significance GRCh38 Chromosome 17, 42538376: 42538376
23 NAGLU NM_000263.3(NAGLU): c.1090G> T (p.Ala364Ser) single nucleotide variant Uncertain significance GRCh38 Chromosome 17, 42543096: 42543096
24 NAGLU NM_000263.3(NAGLU): c.1090G> T (p.Ala364Ser) single nucleotide variant Uncertain significance GRCh37 Chromosome 17, 40695114: 40695114
25 NAGLU NM_000263.3(NAGLU): c.1973A> G (p.Tyr658Cys) single nucleotide variant Uncertain significance GRCh38 Chromosome 17, 42543979: 42543979
26 NAGLU NM_000263.3(NAGLU): c.1973A> G (p.Tyr658Cys) single nucleotide variant Uncertain significance GRCh37 Chromosome 17, 40695997: 40695997

Expression for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Search GEO for disease gene expression data for Charcot-Marie-Tooth Disease, Axonal, Type 2v.

Pathways for Charcot-Marie-Tooth Disease, Axonal, Type 2v

GO Terms for Charcot-Marie-Tooth Disease, Axonal, Type 2v

Sources for Charcot-Marie-Tooth Disease, Axonal, Type 2v

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
20 FMA
29 GO
30 GTR
31 HGMD
32 HMDB
33 HPO
34 ICD10
35 ICD10 via Orphanet
36 ICD9CM
37 IUPHAR
38 KEGG
39 LifeMap
41 LOVD
43 MedGen
45 MeSH
46 MESH via Orphanet
47 MGI
50 NCI
51 NCIt
52 NDF-RT
55 NINDS
56 Novoseek
58 OMIM
59 OMIM via Orphanet
63 PubMed
65 QIAGEN
70 SNOMED-CT via HPO
71 SNOMED-CT via Orphanet
72 TGDB
73 Tocris
74 UMLS
75 UMLS via Orphanet
Content
Loading form....