Ciliary Dyskinesia, Primary, 30 (CILD30)

Categories: Ear diseases, Fetal diseases, Genetic diseases, Rare diseases, Reproductive diseases, Respiratory diseases

Aliases & Classifications for Ciliary Dyskinesia, Primary, 30

MalaCards integrated aliases for Ciliary Dyskinesia, Primary, 30:

Name: Ciliary Dyskinesia, Primary, 30 58 76 30 6 74
Cild30 58 12 76
Ciliary Dyskinesia, Primary, 30, with or Without Situs Inversus 58
Primary Ciliary Dyskinesia 30 with or Without Situs Inversus 76
Primary Ciliary Dyskinesia 30 Without Situs Inversus 12
Dyskinesia, Ciliary, Primary, Type 30 41
Primary Ciliary Dyskinesia 30 12



autosomal recessive

onset in early infancy


ciliary dyskinesia, primary, 30:
Inheritance autosomal recessive inheritance


Summaries for Ciliary Dyskinesia, Primary, 30

UniProtKB/Swiss-Prot : 76 Ciliary dyskinesia, primary, 30: A disorder characterized by abnormalities of motile cilia. Respiratory infections leading to chronic inflammation and bronchiectasis are recurrent, due to defects in the respiratory cilia. Patients may exhibit randomization of left-right body asymmetry and situs inversus, due to dysfunction of monocilia at the embryonic node. Primary ciliary dyskinesia associated with situs inversus is referred to as Kartagener syndrome.

MalaCards based summary : Ciliary Dyskinesia, Primary, 30, also known as cild30, is related to polycystic liver disease, and has symptoms including coughing An important gene associated with Ciliary Dyskinesia, Primary, 30 is CCDC151 (Coiled-Coil Domain Containing 151). Affiliated tissues include liver, and related phenotypes are recurrent respiratory infections and recurrent otitis media

Disease Ontology : 12 A primary ciliary dyskinesia that is characterized by autosomal recessive inheritance with outer dynein arm defect, recurrent upper and lower airway disease, bronchiectasis, nasal blockages, polyps, otitis media, and variable occurence of laterality defects and has material basis in homozygous mutation in the CCDC151 gene on chromosome 19p13.

Description from OMIM: 616037

Related Diseases for Ciliary Dyskinesia, Primary, 30

Diseases in the Primary Ciliary Dyskinesia family:

Ciliary Dyskinesia, Primary, 1 Ciliary Dyskinesia, Primary, 2
Ciliary Dyskinesia, Primary, 3 Ciliary Dyskinesia, Primary, 4
Ciliary Dyskinesia, Primary, 5 Ciliary Dyskinesia, Primary, 6
Ciliary Dyskinesia, Primary, 7 Ciliary Dyskinesia, Primary, 8
Ciliary Dyskinesia, Primary, 9 Ciliary Dyskinesia, Primary, 10
Ciliary Dyskinesia, Primary, 11 Ciliary Dyskinesia, Primary, 12
Ciliary Dyskinesia, Primary, 13 Ciliary Dyskinesia, Primary, 14
Ciliary Dyskinesia, Primary, 15 Ciliary Dyskinesia, Primary, 16
Ciliary Dyskinesia, Primary, 17 Ciliary Dyskinesia, Primary, 18
Ciliary Dyskinesia, Primary, 19 Ciliary Dyskinesia, Primary, 20
Ciliary Dyskinesia, Primary, 21 Ciliary Dyskinesia, Primary, 22
Ciliary Dyskinesia, Primary, 23 Ciliary Dyskinesia, Primary, 24
Ciliary Dyskinesia, Primary, 25 Ciliary Dyskinesia, Primary, 26
Ciliary Dyskinesia, Primary, 27 Ciliary Dyskinesia, Primary, 28
Ciliary Dyskinesia, Primary, 29 Ciliary Dyskinesia, Primary, 30
Ciliary Dyskinesia, Primary, 32 Ciliary Dyskinesia, Primary, 33
Ciliary Dyskinesia, Primary, 34 Ciliary Dyskinesia, Primary, 35
Ciliary Dyskinesia, Primary, 37 Ciliary Dyskinesia, Primary, 38
Ciliary Dyskinesia, Primary, 39 Ciliary Dyskinesia, Primary, 40
Ciliary Dyskinesia, Due to Transposition of Ciliary Microtubules

Diseases related to Ciliary Dyskinesia, Primary, 30 via text searches within MalaCards or GeneCards Suite gene sharing:

# Related Disease Score Top Affiliating Genes
1 polycystic liver disease 9.4 CCDC151 PRKCSH

Symptoms & Phenotypes for Ciliary Dyskinesia, Primary, 30

Human phenotypes related to Ciliary Dyskinesia, Primary, 30:

33 (show all 12)
# Description HPO Frequency HPO Source Accession
1 recurrent respiratory infections 33 HP:0002205
2 recurrent otitis media 33 HP:0000403
3 asthma 33 HP:0002099
4 cough 33 HP:0012735
5 nasal polyposis 33 HP:0100582
6 situs inversus totalis 33 HP:0001696
7 bronchiectasis 33 HP:0002110
8 ciliary dyskinesia 33 HP:0012265
9 nasal obstruction 33 HP:0001742
10 chronic bronchitis 33 HP:0004469
11 respiratory insufficiency due to defective ciliary clearance 33 HP:0200073
12 absent outer dynein arms 33 HP:0012256

Symptoms via clinical synopsis from OMIM:

respiratory infections, recurrent
respiratory insufficiency, neonatal
respiratory insufficiency due to defective ciliary clearance

Head And Neck Nose:
nasal polyps
nasal blockage

Laboratory Abnormalities:
decreased nasal nitric oxide
lack of ciliary motility
electron microscopy of patient respiratory cells shows absent outer dynein arms in the axoneme

situs inversus (in about 50% of patients)

Respiratory Airways:
chronic bronchitis

Head And Neck Ears:
otitis media, recurrent

Cardiovascular Heart:
dextrocardia (in some patients)

Clinical features from OMIM:


UMLS symptoms related to Ciliary Dyskinesia, Primary, 30:


Drugs & Therapeutics for Ciliary Dyskinesia, Primary, 30

Search Clinical Trials , NIH Clinical Center for Ciliary Dyskinesia, Primary, 30

Genetic Tests for Ciliary Dyskinesia, Primary, 30

Genetic tests related to Ciliary Dyskinesia, Primary, 30:

# Genetic test Affiliating Genes
1 Ciliary Dyskinesia, Primary, 30 30 CCDC151

Anatomical Context for Ciliary Dyskinesia, Primary, 30

MalaCards organs/tissues related to Ciliary Dyskinesia, Primary, 30:


Publications for Ciliary Dyskinesia, Primary, 30

Articles related to Ciliary Dyskinesia, Primary, 30:

# Title Authors Year
CCDC151 mutations cause primary ciliary dyskinesia by disruption of the outer dynein arm docking complex formation. ( 25192045 )
Nonsense mutation in coiled-coil domain containing 151 gene (CCDC151) causes primary ciliary dyskinesia. ( 25224326 )

Variations for Ciliary Dyskinesia, Primary, 30

ClinVar genetic disease variations for Ciliary Dyskinesia, Primary, 30:

6 (show top 50) (show all 90)
# Gene Variation Type Significance SNP ID Assembly Location
1 CCDC151 NM_145045.4(CCDC151): c.925G> T (p.Glu309Ter) single nucleotide variant Pathogenic rs587777779 GRCh38 Chromosome 19, 11426182: 11426182
2 CCDC151 NM_145045.4(CCDC151): c.925G> T (p.Glu309Ter) single nucleotide variant Pathogenic rs587777779 GRCh37 Chromosome 19, 11537002: 11537002
3 CCDC151 NM_145045.4(CCDC151): c.1256C> A (p.Ser419Ter) single nucleotide variant Pathogenic rs587777780 GRCh37 Chromosome 19, 11533390: 11533390
4 CCDC151 NM_145045.4(CCDC151): c.1256C> A (p.Ser419Ter) single nucleotide variant Pathogenic rs587777780 GRCh38 Chromosome 19, 11422722: 11422722
5 CCDC151 NM_145045.4(CCDC151): c.173T> C (p.Phe58Ser) single nucleotide variant Benign rs61741137 GRCh37 Chromosome 19, 11545665: 11545665
6 CCDC151 NM_145045.4(CCDC151): c.173T> C (p.Phe58Ser) single nucleotide variant Benign rs61741137 GRCh38 Chromosome 19, 11434844: 11434844
7 CCDC151 NM_145045.4(CCDC151): c.914A> G (p.Lys305Arg) single nucleotide variant Uncertain significance rs762033637 GRCh38 Chromosome 19, 11426193: 11426193
8 CCDC151 NM_145045.4(CCDC151): c.914A> G (p.Lys305Arg) single nucleotide variant Uncertain significance rs762033637 GRCh37 Chromosome 19, 11537013: 11537013
9 CCDC151 NM_145045.4(CCDC151): c.216T> A (p.Ala72=) single nucleotide variant Likely benign rs372211022 GRCh37 Chromosome 19, 11545622: 11545622
10 CCDC151 NM_145045.4(CCDC151): c.216T> A (p.Ala72=) single nucleotide variant Likely benign rs372211022 GRCh38 Chromosome 19, 11434801: 11434801
11 CCDC151 NM_145045.4(CCDC151): c.614C> T (p.Thr205Ile) single nucleotide variant Benign rs35061520 GRCh38 Chromosome 19, 11426783: 11426783
12 CCDC151 NM_145045.4(CCDC151): c.614C> T (p.Thr205Ile) single nucleotide variant Benign rs35061520 GRCh37 Chromosome 19, 11537603: 11537603
13 CCDC151 NM_145045.4(CCDC151): c.1705G> T (p.Val569Leu) single nucleotide variant Benign rs544310246 GRCh38 Chromosome 19, 11420918: 11420918
14 CCDC151 NM_145045.4(CCDC151): c.1705G> T (p.Val569Leu) single nucleotide variant Benign rs544310246 GRCh37 Chromosome 19, 11531586: 11531586
15 CCDC151 NM_145045.4(CCDC151): c.901A> G (p.Ile301Val) single nucleotide variant Uncertain significance rs750661034 GRCh38 Chromosome 19, 11426206: 11426206
16 CCDC151 NM_145045.4(CCDC151): c.901A> G (p.Ile301Val) single nucleotide variant Uncertain significance rs750661034 GRCh37 Chromosome 19, 11537026: 11537026
17 CCDC151 NM_145045.4(CCDC151): c.729C> T (p.Asn243=) single nucleotide variant Benign rs11879596 GRCh38 Chromosome 19, 11426557: 11426557
18 CCDC151 NM_145045.4(CCDC151): c.729C> T (p.Asn243=) single nucleotide variant Benign rs11879596 GRCh37 Chromosome 19, 11537377: 11537377
19 CCDC151 NM_145045.4(CCDC151): c.148C> T (p.Pro50Ser) single nucleotide variant Benign rs143295007 GRCh37 Chromosome 19, 11545690: 11545690
20 CCDC151 NM_145045.4(CCDC151): c.148C> T (p.Pro50Ser) single nucleotide variant Benign rs143295007 GRCh38 Chromosome 19, 11434869: 11434869
21 CCDC151 NM_145045.4(CCDC151): c.711_713dupAAT (p.Leu237_Met238insIle) duplication Uncertain significance rs1060501309 GRCh38 Chromosome 19, 11426684: 11426686
22 CCDC151 NM_145045.4(CCDC151): c.921C> T (p.Arg307=) single nucleotide variant Benign rs61739937 GRCh38 Chromosome 19, 11426186: 11426186
23 CCDC151 NM_145045.4(CCDC151): c.711_713dupAAT (p.Leu237_Met238insIle) duplication Uncertain significance rs1060501309 GRCh37 Chromosome 19, 11537504: 11537506
24 CCDC151 NM_145045.4(CCDC151): c.52G> A (p.Asp18Asn) single nucleotide variant Uncertain significance rs578106295 GRCh38 Chromosome 19, 11434965: 11434965
25 CCDC151 NM_145045.4(CCDC151): c.52G> A (p.Asp18Asn) single nucleotide variant Uncertain significance rs578106295 GRCh37 Chromosome 19, 11545786: 11545786
26 CCDC151 NM_145045.4(CCDC151): c.1501G> A (p.Gly501Ser) single nucleotide variant Benign rs77133587 GRCh37 Chromosome 19, 11532434: 11532434
27 CCDC151 NM_145045.4(CCDC151): c.1501G> A (p.Gly501Ser) single nucleotide variant Benign rs77133587 GRCh38 Chromosome 19, 11421766: 11421766
28 CCDC151 NM_145045.4(CCDC151): c.1329G> A (p.Arg443=) single nucleotide variant Likely benign rs758094826 GRCh37 Chromosome 19, 11533244: 11533244
29 CCDC151 NM_145045.4(CCDC151): c.1329G> A (p.Arg443=) single nucleotide variant Likely benign rs758094826 GRCh38 Chromosome 19, 11422576: 11422576
30 CCDC151 NM_145045.4(CCDC151): c.1316A> G (p.Lys439Arg) single nucleotide variant Uncertain significance rs1060501320 GRCh37 Chromosome 19, 11533257: 11533257
31 CCDC151 NM_145045.4(CCDC151): c.1316A> G (p.Lys439Arg) single nucleotide variant Uncertain significance rs1060501320 GRCh38 Chromosome 19, 11422589: 11422589
32 CCDC151 NM_145045.4(CCDC151): c.1203G> A (p.Arg401=) single nucleotide variant Benign rs199934107 GRCh37 Chromosome 19, 11533443: 11533443
33 CCDC151 NM_145045.4(CCDC151): c.1203G> A (p.Arg401=) single nucleotide variant Benign rs199934107 GRCh38 Chromosome 19, 11422775: 11422775
34 CCDC151 NM_145045.4(CCDC151): c.922G> A (p.Ala308Thr) single nucleotide variant Uncertain significance rs201899388 GRCh37 Chromosome 19, 11537005: 11537005
35 CCDC151 NM_145045.4(CCDC151): c.922G> A (p.Ala308Thr) single nucleotide variant Uncertain significance rs201899388 GRCh38 Chromosome 19, 11426185: 11426185
36 CCDC151 NM_145045.4(CCDC151): c.921C> T (p.Arg307=) single nucleotide variant Benign rs61739937 GRCh37 Chromosome 19, 11537006: 11537006
37 CCDC151 NM_145045.4(CCDC151): c.145A> C (p.Thr49Pro) single nucleotide variant Benign rs61742088 GRCh37 Chromosome 19, 11545693: 11545693
38 CCDC151 NM_145045.4(CCDC151): c.145A> C (p.Thr49Pro) single nucleotide variant Benign rs61742088 GRCh38 Chromosome 19, 11434872: 11434872
39 CCDC151 NM_145045.4(CCDC151): c.767_787delTGAGGACCAAACATGAGCTGG (p.Val256_Leu262del) deletion Uncertain significance rs1064792932 GRCh37 Chromosome 19, 11537319: 11537339
40 CCDC151 NM_145045.4(CCDC151): c.767_787delTGAGGACCAAACATGAGCTGG (p.Val256_Leu262del) deletion Uncertain significance rs1064792932 GRCh38 Chromosome 19, 11426499: 11426519
41 CCDC151 NM_145045.4(CCDC151): c.184G> T (p.Ala62Ser) single nucleotide variant Uncertain significance rs996181868 GRCh37 Chromosome 19, 11545654: 11545654
42 CCDC151 NM_145045.4(CCDC151): c.184G> T (p.Ala62Ser) single nucleotide variant Uncertain significance rs996181868 GRCh38 Chromosome 19, 11434833: 11434833
43 CCDC151 NM_145045.4(CCDC151): c.8C> G (p.Ser3Cys) single nucleotide variant Uncertain significance rs756389981 GRCh37 Chromosome 19, 11545830: 11545830
44 CCDC151 NM_145045.4(CCDC151): c.8C> G (p.Ser3Cys) single nucleotide variant Uncertain significance rs756389981 GRCh38 Chromosome 19, 11435009: 11435009
45 CCDC151 NM_145045.4(CCDC151): c.1035G> C (p.Glu345Asp) single nucleotide variant Uncertain significance rs1053136709 GRCh37 Chromosome 19, 11534627: 11534627
46 CCDC151 NM_145045.4(CCDC151): c.1035G> C (p.Glu345Asp) single nucleotide variant Uncertain significance rs1053136709 GRCh38 Chromosome 19, 11423958: 11423958
47 CCDC151 NM_145045.4(CCDC151): c.907G> A (p.Glu303Lys) single nucleotide variant Uncertain significance rs1060501319 GRCh37 Chromosome 19, 11537020: 11537020
48 CCDC151 NM_145045.4(CCDC151): c.907G> A (p.Glu303Lys) single nucleotide variant Uncertain significance rs1060501319 GRCh38 Chromosome 19, 11426200: 11426200
49 CCDC151 NM_145045.4(CCDC151): c.424C> G (p.Leu142Val) single nucleotide variant Benign rs61739927 GRCh37 Chromosome 19, 11541539: 11541539
50 CCDC151 NM_145045.4(CCDC151): c.424C> G (p.Leu142Val) single nucleotide variant Benign rs61739927 GRCh38 Chromosome 19, 11430719: 11430719

Expression for Ciliary Dyskinesia, Primary, 30

Search GEO for disease gene expression data for Ciliary Dyskinesia, Primary, 30.

Pathways for Ciliary Dyskinesia, Primary, 30

GO Terms for Ciliary Dyskinesia, Primary, 30

Sources for Ciliary Dyskinesia, Primary, 30

9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
20 FMA
29 GO
30 GTR
33 HPO
34 ICD10
35 ICD10 via Orphanet
39 LifeMap
43 MedGen
45 MeSH
46 MESH via Orphanet
47 MGI
50 NCI
51 NCIt
56 Novoseek
59 OMIM via Orphanet
63 PubMed
71 SNOMED-CT via Orphanet
73 Tocris
75 UMLS via Orphanet
Loading form....