CJD
MCID: CRT072
MIFTS: 69

Creutzfeldt-Jakob Disease (CJD)

Categories: Eye diseases, Genetic diseases, Infectious diseases, Mental diseases, Neuronal diseases, Rare diseases

Aliases & Classifications for Creutzfeldt-Jakob Disease

MalaCards integrated aliases for Creutzfeldt-Jakob Disease:

Name: Creutzfeldt-Jakob Disease 56 12 74 52 53 73 13 54 42 15 39 71 32
Variant Creutzfeldt-Jakob Disease 12 52 3 15 17
Cjd 56 12 52 73
Bovine Spongiform Encephalopathy 12 3 15
Jakob-Creutzfeldt Disease 12 29 6
Creutzfeldt-Jakob Disease, Familial 56 71
Encephalopathy, Bovine Spongiform 43 71
Creutzfeldt Jakob Disease 12 52
Creutzfeldt-Jacob Disease 12 52
Creutzfeldt Jacob Disease 52 17
Vcjd 52 3
Creutzfeldt-Jakob Disease, Variant, Resistance to 56
New Variant Creutzfeldt-Jakob Disease 71
Inherited Creutzfeldt-Jakob Disease 58
Creutzfeldt-Jakob Disease, Sporadic 71
Creutzfeldt-Jakob Disease, Variant 56
Subacute Spongiform Encephalopathy 12
Sporadic Creutzfeldt-Jakob Disease 58
Acquired Creutzfeldt-Jakob Disease 58
Familial Creutzfeldt-Jakob Disease 54
Variant Creutzfeldt-Jacob Disease 52
Encephalopathy Bovine Spongiform 54
Transmissible Virus Dementia 12
Creutzfeldt Jacob Syndrome 12
Creutzfeldt-Jakob Syndrome 43
New Variant of Cjd 52
Inherited Cjd 58
Sporadic Cjd 58
Acquired Cjd 71
Variant Cjd 52
Nv-Cjd 52

Characteristics:

Orphanet epidemiological data:

58
sporadic creutzfeldt-jakob disease
Inheritance: Not applicable; Prevalence: 1-9/1000000 (Europe),1-9/1000000 (Canada),1-9/1000000 (United States); Age of onset: Adult,Elderly; Age of death: adult,elderly;
inherited creutzfeldt-jakob disease
Inheritance: Autosomal dominant; Age of onset: Adult,Elderly; Age of death: adult,elderly;
acquired creutzfeldt-jakob disease
Inheritance: Not applicable; Age of onset: Adult,Elderly; Age of death: adult,elderly;

OMIM:

56
Inheritance:
autosomal dominant

Miscellaneous:
most cases are sporadic
mean age at onset for sporadic cjd is 60 years (range, 50 to 70 years)
mean age at onset for variant cjd is 29 years (before age 45 years)
rapid progression
mean survival 5 months
three forms of cjd: acquired (including variant), sporadic, and inherited
incidence of all forms of cjd is 0.5 to 1.5 per million per year
15% cases are familial
patients with variant cjd are homozygous for met129 polymorphism


HPO:

31
creutzfeldt-jakob disease:
Inheritance autosomal dominant inheritance
Onset and clinical course rapidly progressive


Classifications:

Orphanet: 58  
Rare neurological diseases


Summaries for Creutzfeldt-Jakob Disease

NINDS : 53 Creutzfeldt-Jakob disease (CJD) is a rare, degenerative, fatal brain disorder. Onset of symptoms typically occurs at about age 60. There are three major categories of CJD:  sporadic (the most common form, in which people do not have any known risk factors for the disease); hereditary (in which the person has a family member with the disease and tests positive for a genetic mutation associated with CJD), and acquired (in which the disease is transmitted by exposure to brain and nervous system tissue, usually through certain medical procedures). A form called variant CJD can be acquired by eating meat from cattle affected by a disease similar to CJD, called bovine spongiform encephalopathy (commonly called “mad cow” disease). CJD cannot be transmitted through the air or through touching or most other forms of casual contact. Initial symptoms of CJD include problems with muscle coordination, personality changes including progressive and impaired thinking and judgment, vision problems that may lead to blindness, and involuntary muscle jerks called myoclonus. People eventually lose the ability to move and speak, and enter a coma. Tests that help in the diagnosis of CJD include electroencephalography (which records the brain's electrical pattern), detection of certain proteins in the fluid that surrounds the brain and spinal cord, and magnetic resonance imaging. The only way to confirm a diagnosis of CJD is by brain biopsy or autopsy. A brain biopsy is discouraged unless it is need to rule out a treatable disorder.  CJD belongs to a family of diseases known as prion diseases--derived from "protein" and "infectious."

MalaCards based summary : Creutzfeldt-Jakob Disease, also known as variant creutzfeldt-jakob disease, is related to normal pressure hydrocephalus and dementia, and has symptoms including seizures, tremor and myoclonus. An important gene associated with Creutzfeldt-Jakob Disease is PRNP (Prion Protein), and among its related pathways/superpathways are Neuroscience and Copper homeostasis. The drugs Epinephrine and Formaldehyde have been mentioned in the context of this disorder. Affiliated tissues include brain, testes and spinal cord, and related phenotypes are dementia and hyperintensity of cerebral white matter on mri

NIH Rare Diseases : 52 Creutzfeldt-Jakob disease (CJD) is a rare fatal brain disorder that usually occurs later in life and runs a rapid course. In the early stages of the disease, patients may have failing memory, behavior changes, impaired coordination, and vision problems. As CJD progresses, mental deterioration becomes severe, and they can have uncontrolled movements, blindness, weakness, and go into a coma. This condition often leads to death within a few weeks or months after symptoms begin. About 90 percent of patients do not survive for more than one year. In the United States, about 300 people are diagnosed with this condition each year. It occurs in approximately one in every one million people worldwide. CJD can be very difficult to diagnose because it is similar to other forms of dementia . The only way to confirm the diagnosis is to test a small sample of brain tissue , which can be done by brain biopsy or autopsy. CJD is caused by the build up of abnormal prion proteins in the brain. For most patients, the reason for the abnormal prions is unknown (sporadic CJD). About 5 to 10 percent of cases are due to an inherited genetic mutation associated with CJD (familial CJD). This condition can also be acquired through contact with infected brain tissue (iatrogenic CJD) or consuming infected beef (variant CJD ). There is no specific treatment for CJD, so the goal is to make a person as comfortable as possible.

OMIM : 56 The human prion diseases occur in inherited, acquired, and sporadic forms. Approximately 15% are inherited and associated with coding mutations in the PRNP gene. Acquired prion diseases include iatrogenic CJD, kuru (245300), variant CJD (vCJD) in humans, scrapie in sheep, and bovine spongiform encephalopathy (BSE) in cattle. Variant CJD is believed to be acquired from cattle infected with BSE. However, the majority of human cases of prion disease occur as sporadic CJD (sCJD) (Collinge et al., 1996; Parchi et al., 2000; Hill et al., 2003). Johnson and Gibbs (1998) provided a comprehensive review of Creutzfeldt-Jakob disease and related transmissible spongiform encephalopathies. Tyler (2003) described the characteristics of sporadic CJD as encapsulated by C. Miller Fisher in 1960. (123400)

MedlinePlus : 42 Creutzfeldt-Jakob disease (CJD) is a rare, degenerative brain disorder. Symptoms usually start around age 60. Memory problems, behavior changes, vision problems, and poor muscle coordination progress quickly to dementia, coma, and death. Most patients die within a year. The three main categories of CJD are Sporadic CJD, which occurs for no known reason Hereditary CJD, which runs in families Acquired CJD, which occurs from contact with infected tissue, usually during a medical procedure Cattle can get a disease related to CJD called bovine spongiform encephalopathy (BSE) or "mad cow disease." There is concern that people can get a variant of CJD from eating beef from an infected animal, but there is no direct proof to support this. NIH: National Institute of Neurological Disorders and Stroke

CDC : 3 BSE (bovine spongiform encephalopathy) is a progressive neurological disorder of cattle that results from infection by an unusual transmissible agent called a prion. The nature of the transmissible agent is not well understood. Currently, the most accepted theory is that the agent is a modified form of a normal protein known as prion protein. For reasons that are not yet understood, the normal prion protein changes into a pathogenic (harmful) form that then damages the central nervous system of cattle.

UniProtKB/Swiss-Prot : 73 Creutzfeldt-Jakob disease: Occurs primarily as a sporadic disorder (1 per million), while 10-15% are familial. Accidental transmission of CJD to humans appears to be iatrogenic (contaminated human growth hormone (HGH), corneal transplantation, electroencephalographic electrode implantation, etc.). Epidemiologic studies have failed to implicate the ingestion of infected animal meat in the pathogenesis of CJD in human. The triad of microscopic features that characterize the prion diseases consists of (1) spongiform degeneration of neurons, (2) severe astrocytic gliosis that often appears to be out of proportion to the degree of nerve cell loss, and (3) amyloid plaque formation. CJD is characterized by progressive dementia and myoclonic seizures, affecting adults in mid- life. Some patients present sleep disorders, abnormalities of high cortical function, cerebellar and corticospinal disturbances. The disease ends in death after a 3-12 months illness.

Wikipedia : 74 Creutzfeldt-Jakob disease (CJD), also known as classic Creutzfeldt-Jakob disease, is a fatal... more...

Related Diseases for Creutzfeldt-Jakob Disease

Diseases related to Creutzfeldt-Jakob Disease via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 457)
# Related Disease Score Top Affiliating Genes
1 normal pressure hydrocephalus 33.4 SERPINA3 MAPT GFAP APP APOE
2 dementia 33.2 SNCA SERPINA3 PRNP MAPT GFAP CST3
3 kuru 32.7 STMN2 SPRN PRNP PRND MSMB MAPT
4 akinetic mutism 32.6 S100B PRNP MAPT ENO2
5 gerstmann-straussler disease 32.5 SPRN SNCA PRNT PRNP PRND MSMB
6 chronic wasting disease 32.3 SPRN RPSA PRNP PRND MSMB GFAP
7 prion disease 32.2 SPRN SNCA SERPINA3 RPSA PRNP PRND
8 aphasia 32.1 SNCA PRNP MAPT APP APOE
9 genetic prion diseases 31.9 PRNP HLA-DQB1 APOE
10 aceruloplasminemia 31.8 SNCA SERPINA3 PRNP MAPT GFAP APP
11 cerebrovascular disease 31.7 SERPINA3 MAPT APP APOE
12 vascular dementia 31.7 SERPINA3 PRNP MAPT CST3 APP APOE
13 supranuclear palsy, progressive, 1 31.6 SNCA SERPINA3 PRNP MAPT APP APOE
14 agraphia 31.6 PRNP MAPT
15 leukoencephalopathy, hereditary diffuse, with spheroids 31.6 SNCA PRNP MAPT GFAP APP
16 peripheral nervous system disease 31.5 SERPINA3 GFAP APP AIF1
17 frontotemporal dementia 31.5 SNCA PRNP MAPT GFAP APP APOE
18 persistent vegetative state 31.5 ENO2 APOE
19 amnestic disorder 31.5 S100B APP APOE
20 binswanger's disease 31.4 MAPT GFAP APP APOE
21 head injury 31.4 S100B ENO2 APOE
22 cerebral amyloid angiopathy, cst3-related 31.3 SERPINA3 PRNP MAPT CST3 BACE1 APP
23 nominal aphasia 31.3 MAPT APOE
24 encephalomalacia 31.2 S100B GFAP AIF1
25 neuritis 31.2 MAPT GFAP APOE
26 senile plaque formation 31.2 APP APOE
27 posterior cortical atrophy 31.2 MAPT APOE
28 multiple system atrophy 1 31.2 SNCA SERPINA3 PRNP MAPT GFAP
29 gerstmann syndrome 31.2 PRNP MAPT APOE
30 neurilemmoma 31.2 SERPINA3 S100B GFAP ENO2
31 visual agnosia 31.1 MAPT APOE
32 alzheimer disease 31.1 STMN2 SNCA SERPINA3 S100B PRNP PRND
33 hydrocephalus 31.1 SERPINA3 S100B MAPT GFAP ENO2 APP
34 alexia 31.1 MAPT APOE
35 stroke, ischemic 31.1 SERPINA3 MAPT ENO2 CST3 BACE1 APOE
36 autosomal dominant cerebellar ataxia 31.1 SNCA SERPINA3 PRNP MAPT APP
37 meningothelial meningioma 31.0 SERPINA3 ENO2
38 amyotrophic lateral sclerosis 1 31.0 SNCA SERPINA3 PRNP PRND MAPT GFAP
39 traumatic brain injury 31.0 S100B GFAP ENO2 APOE
40 inclusion body myositis 31.0 SERPINA3 MAPT BACE1 APP APOE
41 cardiac arrest 31.0 S100B ENO2 APP APOE
42 nervous system disease 31.0 SNCA SERPINA3 PRNP MAPT APP APOE
43 amyloidosis 31.0 SNCA SERPINA3 PRNP MAPT CST3 BACE1
44 arteriolosclerosis 31.0 SERPINA3 MAPT APP APOE
45 myositis 31.0 SNCA SERPINA3 MAPT BACE1 APP
46 benign ependymoma 31.0 S100B GFAP ENO2
47 scrapie 30.9 SPRN SERPINA3 RPSA PRNP PRND MSMB
48 fatal familial insomnia 30.9 SPRN SERPINA3 PRNP PRND MSMB MAPT
49 cerebellar medulloblastoma 30.9 GFAP ENO2
50 neuroblastoma 30.9 SNCA PRNP MAPT GFAP ENO2 BACE1

Comorbidity relations with Creutzfeldt-Jakob Disease via Phenotypic Disease Network (PDN):


Acute Cystitis

Graphical network of the top 20 diseases related to Creutzfeldt-Jakob Disease:



Diseases related to Creutzfeldt-Jakob Disease

Symptoms & Phenotypes for Creutzfeldt-Jakob Disease

Human phenotypes related to Creutzfeldt-Jakob Disease:

58 31 (show top 50) (show all 74)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 dementia 58 31 hallmark (90%) Very frequent (99-80%),Frequent (79-30%) HP:0000726
2 hyperintensity of cerebral white matter on mri 58 31 hallmark (90%) Very frequent (99-80%) HP:0030890
3 neuronal loss in central nervous system 58 31 hallmark (90%) Very frequent (99-80%),Frequent (79-30%) HP:0002529
4 cerebral cortex with spongiform changes 58 31 hallmark (90%) Very frequent (99-80%) HP:0006790
5 akinetic mutism 58 31 hallmark (90%) Very frequent (99-80%),Frequent (79-30%) HP:0012672
6 seizures 58 31 frequent (33%) Frequent (79-30%) HP:0001250
7 emotional lability 58 31 frequent (33%) Frequent (79-30%) HP:0000712
8 depressivity 58 31 frequent (33%) Frequent (79-30%) HP:0000716
9 ataxia 58 31 frequent (33%) Frequent (79-30%) HP:0001251
10 tremor 58 31 frequent (33%) Frequent (79-30%) HP:0001337
11 muscle weakness 58 31 frequent (33%) Frequent (79-30%) HP:0001324
12 myoclonus 58 31 frequent (33%) Frequent (79-30%),Frequent (79-30%) HP:0001336
13 respiratory failure requiring assisted ventilation 58 31 frequent (33%) Frequent (79-30%) HP:0004887
14 irritability 58 31 frequent (33%) Frequent (79-30%) HP:0000737
15 slurred speech 58 31 frequent (33%) Frequent (79-30%) HP:0001350
16 memory impairment 58 31 frequent (33%) Frequent (79-30%) HP:0002354
17 anxiety 58 31 frequent (33%) Frequent (79-30%) HP:0000739
18 gait ataxia 58 31 frequent (33%) Frequent (79-30%) HP:0002066
19 babinski sign 58 31 occasional (7.5%) Occasional (29-5%),Frequent (79-30%) HP:0003487
20 stroke-like episode 58 31 frequent (33%) Frequent (79-30%) HP:0002401
21 confusion 58 31 frequent (33%) Frequent (79-30%),Frequent (79-30%) HP:0001289
22 recurrent aspiration pneumonia 58 31 frequent (33%) Frequent (79-30%) HP:0002100
23 visual hallucinations 58 31 frequent (33%) Frequent (79-30%) HP:0002367
24 hypsarrhythmia 58 31 frequent (33%) Frequent (79-30%) HP:0002521
25 recurrent infections 58 31 frequent (33%) Frequent (79-30%) HP:0002719
26 sepsis 58 31 frequent (33%) Frequent (79-30%) HP:0100806
27 short attention span 58 31 frequent (33%) Frequent (79-30%) HP:0000736
28 clumsiness 58 31 frequent (33%) Frequent (79-30%) HP:0002312
29 insomnia 58 31 frequent (33%) Frequent (79-30%) HP:0100785
30 progressive cerebellar ataxia 58 31 frequent (33%) Frequent (79-30%) HP:0002073
31 bradykinesia 58 31 frequent (33%) Frequent (79-30%) HP:0002067
32 astrocytosis 58 31 frequent (33%) Frequent (79-30%),Frequent (79-30%) HP:0002446
33 central nervous system degeneration 58 31 frequent (33%) Frequent (79-30%) HP:0007009
34 hypersomnia 58 31 frequent (33%) Frequent (79-30%) HP:0100786
35 cerebral atrophy 58 31 frequent (33%) Frequent (79-30%) HP:0002059
36 gliosis 58 31 frequent (33%) Frequent (79-30%) HP:0002171
37 increased csf protein 58 31 occasional (7.5%) Frequent (79-30%),Occasional (29-5%) HP:0002922
38 apathy 58 31 frequent (33%) Frequent (79-30%) HP:0000741
39 personality changes 58 31 frequent (33%) Frequent (79-30%) HP:0000751
40 supranuclear gaze palsy 58 31 frequent (33%) Frequent (79-30%) HP:0000605
41 spastic dysarthria 58 31 frequent (33%) Frequent (79-30%) HP:0002464
42 loss of facial expression 58 31 frequent (33%) Frequent (79-30%) HP:0005327
43 global brain atrophy 58 31 frequent (33%) Frequent (79-30%) HP:0002283
44 focal t2 hyperintense basal ganglia lesion 58 31 frequent (33%) Frequent (79-30%) HP:0007183
45 spastic hemiparesis 58 31 frequent (33%) Frequent (79-30%) HP:0011099
46 progressive extrapyramidal muscular rigidity 58 31 frequent (33%) Frequent (79-30%) HP:0007158
47 poor visual behavior for age 58 31 frequent (33%) Frequent (79-30%) HP:0025152
48 diffuse spongiform leukoencephalopathy 58 31 frequent (33%) Frequent (79-30%) HP:0006943
49 progressive forgetfulness 58 31 frequent (33%) Frequent (79-30%) HP:0007017
50 eeg with persistent abnormal rhythmic activity 58 31 frequent (33%) Frequent (79-30%) HP:0010846

Symptoms via clinical synopsis from OMIM:

56
Neurologic Behavioral Psychiatric Manifestations:
hallucinations
irritability
anxiety
apathy
personality changes
more
Head And Neck Face:
loss of facial expression

Neurologic Central Nervous System:
myoclonus
gait ataxia
aphasia
dementia
confusion
more
Laboratory Abnormalities:
normal cerebrospinal fluid
occasionally mild elevation of csf protein

Clinical features from OMIM:

123400

UMLS symptoms related to Creutzfeldt-Jakob Disease:


seizures, tremor, myoclonus, gait ataxia, back pain, pain, headache, syncope, hemiparesis, personality changes, chronic pain, sciatica, vertigo/dizziness, sleeplessness, memory loss

MGI Mouse Phenotypes related to Creutzfeldt-Jakob Disease:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 behavior/neurological MP:0005386 10.18 APOE APP BACE1 ENO2 GFAP HLA-DQB1
2 cardiovascular system MP:0005385 10.07 AIF1 APOE APP CST3 GFAP HLA-DQB1
3 cellular MP:0005384 10.06 APOE APP BACE1 EIF2AK2 ENO2 GFAP
4 immune system MP:0005387 10 AIF1 APOE APP EIF2AK2 GFAP HLA-DQB1
5 nervous system MP:0003631 9.77 AIF1 APOE APP BACE1 CST3 ENO2
6 muscle MP:0005369 9.76 APOE APP BACE1 CST3 GFAP HLA-DQB1
7 taste/olfaction MP:0005394 8.92 APOE ENO2 MAPT SNCA

Drugs & Therapeutics for Creutzfeldt-Jakob Disease

Drugs for Creutzfeldt-Jakob Disease (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show all 45)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Epinephrine Approved, Vet_approved Phase 4 51-43-4 5816
2
Formaldehyde Approved, Vet_approved Phase 4 50-00-0 712
3
Racepinephrine Approved Phase 4 329-65-7 838
4 Pharmaceutical Solutions Phase 4
5 Epinephryl borate Phase 4
6 Vasoconstrictor Agents Phase 4
7
rituximab Approved Phase 2 174722-31-7 10201696
8
Coal tar Approved Phase 2 8007-45-2
9
Quinacrine Investigational Phase 2 83-89-6 237
10 Antineoplastic Agents, Immunological Phase 2
11 Antirheumatic Agents Phase 2
12 Antiparasitic Agents Phase 2
13 Antimalarials Phase 2
14 Antiprotozoal Agents Phase 2
15 Anthelmintics Phase 2
16 Liver Extracts Phase 1, Phase 2
17 Insulin, Globin Zinc Phase 1, Phase 2
18 insulin Phase 1, Phase 2
19 Anti-Infective Agents Phase 2
20 Immunologic Factors Phase 2
21 Cathartics Phase 2
22 interferons Phase 2
23 Poly I-C Phase 2
24 Gastrointestinal Agents Phase 2
25 Poly ICLC Phase 2
26 Laxatives Phase 2
27 Antiviral Agents Phase 2
28 Interferon Inducers Phase 2
29 Carboxymethylcellulose Sodium Phase 2
30
Methylprednisolone Approved, Vet_approved Phase 1 83-43-2 6741
31
Prednisolone phosphate Approved, Vet_approved Phase 1 302-25-0
32 Prednisolone acetate Approved, Vet_approved Phase 1 52-21-1
33
Methylprednisolone hemisuccinate Approved Phase 1 2921-57-5
34
Prednisolone Approved, Vet_approved Phase 1 50-24-8 5755
35
Prednisolone hemisuccinate Experimental Phase 1 2920-86-7
36 Anesthetics Phase 1
37 Thymoglobulin Phase 1
38 Methylprednisolone Acetate Phase 1
39 Antilymphocyte Serum Phase 1
40 Cyclosporins Phase 1
41
Thrombin Approved, Investigational
42 Hematinics
43 Epoetin alfa 113427-24-0
44 Immunoglobulins
45 Antibodies

Interventional clinical trials:

(show all 21)
# Name Status NCT ID Phase Drugs
1 The Ambu® Laryngeal Mask as an Intubation Conduit For Patients Undergoing Routine General Anesthesia Completed NCT00272194 Phase 4
2 Coagulopathy During Surgery for the Repair of Extent 4 Thoraco-Abdominal Aortic Aneurysms - Feasibility Study of the Use of Fibrinogen Concentrate by Infusion in Place of Fresh Frozen Plasma. Completed NCT00994045 Phase 4
3 Study of Nasal Brushing Collected OLFActory MUcosa Samples in the Diagnosis of Human Encephalopathies Recruiting NCT02951559 Phase 4
4 Comparative Study of Two Corneal Graft Storage Media: New Animal Compound Free Medium Versus Reference Medium Completed NCT01694914 Phase 3
5 The Combined Efficacy of Evicel and Tranexamic Acid on Total Knee Arthroplasty During the Early Perioperative Period Withdrawn NCT02553122 Phase 3 Evicel
6 A Study to Assess the Safety, Efficacy and Tolerability of Rituximab (Mabthera) in Combination With Plasma Exchange (PEX) in Patients With Acute Thrombotic Thrombocytopenic Purpura (TTP) Unknown status NCT00937131 Phase 2 Rituximab
7 Randomised Placebo Controlled Trial of Faecal Microbiota Transplantation in Irritable Bowel Syndrome Unknown status NCT02423421 Phase 2
8 Novel Therapeutics For Prion Diseases: A Randomized, Double-blinded, Placebo-controlled Study of the Efficacy of Quinacrine in the Treatment of Sporadic Creutzfeldt-Jakob Disease Completed NCT00183092 Phase 2 Quinacrine;Placebo
9 Bovine Colostrum for Patients With Non Alcoholic Fatty Liver Disease Completed NCT01016418 Phase 1, Phase 2
10 A Phase II Trial of Poly-ICLC in the Management of Recurrent Pediatric Low Grade Gliomas Active, not recruiting NCT01188096 Phase 2 Poly ICLC
11 Phase I Serum-Free Cultured Thymus Transplantation in DiGeorge Anomaly, IND9836 Terminated NCT00849888 Phase 1
12 Assessment of the Impact of Notification of Blood Donors Testing Positive for Microbiology Markers: What is the Psychological Impact of Notification and Does the Method of Notification Influence the Outcome? Unknown status NCT01050881
13 PRION-1: Quinacrine for Human Prion Disease. A Partially Randomized Patient Preference Trial to Evaluate the Activity and Safety of Quinacrine in Human Prion Disease Completed NCT00104663 Quinacrine
14 A Prospective, Immunogenicity Surveillance Registry (PRIMS) to Estimate the Incidence of Erythropoietin Antibody-Mediated Pure Red Cell Aplasia Among Subjects With Chronic Renal Failure and Subcutaneous Exposure to Recombinant Erythropoietin Products Completed NCT00391287
15 CardioCel Tri-leaflet Repair Study; a Prospective, Non-randomised, Single Arm, Multi-centre Clinical Investigation Completed NCT02629328
16 Vascular Post Market Review Completed NCT02681341
17 Enhanced CJD Surveillance in the Older Population Recruiting NCT02629640
18 Comparison of the Self-invented Intracavitary ECG Wire With the Commercial System - Certodyn® Recruiting NCT03697291
19 Genetic Characterization of Movement Disorders and Dementias Recruiting NCT02014246
20 The Role of the Coagulation Pathway at the Synapse in Prion Diseases Not yet recruiting NCT02480725
21 Efficacy and Safety of Fecal Microbiota Transplantation for Severe Clostridium Difficile Associated Colitis Terminated NCT01959048 fecal microbiota transplantation

Search NIH Clinical Center for Creutzfeldt-Jakob Disease

Cochrane evidence based reviews: creutzfeldt-jakob syndrome

Genetic Tests for Creutzfeldt-Jakob Disease

Genetic tests related to Creutzfeldt-Jakob Disease:

# Genetic test Affiliating Genes
1 Jakob-Creutzfeldt Disease 29 HLA-DQB1 PRNP

Anatomical Context for Creutzfeldt-Jakob Disease

MalaCards organs/tissues related to Creutzfeldt-Jakob Disease:

40
Brain, Testes, Spinal Cord, Cortex, Pituitary, Cerebellum, Eye

Publications for Creutzfeldt-Jakob Disease

Articles related to Creutzfeldt-Jakob Disease:

(show top 50) (show all 5851)
# Title Authors PMID Year
1
Ascertainment bias causes false signal of anticipation in genetic prion disease. 61 56 6
25279981 2014
2
Mutant prion protein expression causes motor and memory deficits and abnormal sleep patterns in a transgenic mouse model. 61 56 6
19038218 2008
3
Familial Creutzfeldt-Jakob disease. Codon 200 prion disease in Libyan Jews. 61 56 6
9279329 1997
4
Mutation in codon 200 of scrapie amyloid protein gene in two clusters of Creutzfeldt-Jakob disease in Slovakia. 61 56 6
1975028 1990
5
An in-frame insertion in the prion protein gene in familial Creutzfeldt-Jakob disease. 61 56 6
2159587 1990
6
Mutations in familial Creutzfeldt-Jakob disease and Gerstmann-Sträussler-Scheinker's syndrome. 61 56 6
2572450 1989
7
Insertion in prion protein gene in familial Creutzfeldt-Jakob disease. 61 56 6
2563037 1989
8
Creutzfeldt-Jacob disease associated with the PRNP codon 200Lys mutation: an analysis of 45 families. 56 6
1684755 1991
9
Familial Creutzfeldt-Jakob disease with an R208H-129V haplotype and Kuru plaques. 54 61 6
16533975 2006
10
Creutzfeldt-Jakob disease associated with the R208H mutation in the prion protein gene. 54 61 6
15753435 2005
11
Creutzfeldt-Jakob disease with a novel extra-repeat insertional mutation in the PRNP gene. 54 61 6
14610142 2003
12
Mutation at codon 210 (V210I) of the prion protein gene in a North African patient with Creutzfeldt-Jakob disease. 54 61 6
10526198 1999
13
Mutation of the prion protein gene at codon 208 in familial Creutzfeldt-Jakob disease. 54 61 6
8909447 1996
14
Fatal insomnia in a case of familial Creutzfeldt-Jakob disease with the codon 200(Lys) mutation. 54 61 6
8618678 1996
15
Prion disease associated with a novel nine octapeptide repeat insertion in the PRNP gene. 54 61 6
8750875 1995
16
The risk of developing Creutzfeldt-Jakob disease in subjects with the PRNP gene codon 200 point mutation. 54 61 6
7936296 1994
17
Molecular genetic studies of Creutzfeldt-Jakob disease. 54 61 6
7999318 1994
18
Novel missense variants of prion protein in Creutzfeldt-Jakob disease or Gerstmann-Sträussler syndrome. 54 61 6
8461023 1993
19
Familial Creutzfeldt-Jakob disease in Chile is associated with the codon 200 mutation of the PRNP amyloid precursor gene on chromosome 20. 54 61 6
1469441 1992
20
Transmission of spongiform encephalopathy from a familial Creutzfeldt-Jakob disease patient of Jewish Libyan origin carrying the PRNP codon 200 mutation. 54 61 6
1351274 1992
21
Creutzfeldt-Jakob disease cosegregates with the codon 178Asn PRNP mutation in families of European origin. 54 61 6
1353341 1992
22
Phenotypic characteristics of familial Creutzfeldt-Jakob disease associated with the codon 178Asn PRNP mutation. 54 61 6
1353342 1992
23
Atypical Creutzfeldt-Jakob disease in an American family with an insert mutation in the PRNP amyloid precursor gene. 54 61 6
1736177 1992
24
Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene. 54 61 6
1683708 1991
25
Substitutions at residue 211 in the prion protein drive a switch between CJD and GSS syndrome, a new mechanism governing inherited neurodegenerative disorders. 61 6
22965875 2012
26
Prion propagation and toxicity in vivo occur in two distinct mechanistic phases. 61 56
21350487 2011
27
Thalamo-striatal diffusion reductions precede disease onset in prion mutation carriers. 61 56
19321460 2009
28
Updated clinical diagnostic criteria for sporadic Creutzfeldt-Jakob disease. 61 56
19773352 2009
29
Variant Creutzfeldt-Jakob disease in France and the United Kingdom: Evidence for the same agent strain. 61 56
19334063 2009
30
Association of a null allele of SPRN with variant Creutzfeldt-Jakob disease. 61 56
18805828 2008
31
Novel prion protein conformation and glycotype in Creutzfeldt-Jakob disease. 61 56
17420324 2007
32
Dissociation of pathological and molecular phenotype of variant Creutzfeldt-Jakob disease in transgenic human prion protein 129 heterozygous mice. 61 56
16809423 2006
33
MRI and EEG findings in Heidenhain variant of Creutzfeldt-Jakob disease. 61 56
16864833 2006
34
Sporadic Creutzfeldt-Jakob disease: clinical and diagnostic characteristics of the rare VV1 type. 61 56
16221949 2005
35
Phenotypic variability in familial prion diseases due to the D178N mutation. 61 6
16227536 2005
36
Isolated visual symptoms at onset in sporadic Creutzfeldt-Jakob disease: the clinical phenotype of the "Heidenhain variant". 61 56
16170128 2005
37
Interleukin 4 and interleukin 10 levels are elevated in the cerebrospinal fluid of patients with Creutzfeldt-Jakob disease. 61 56
16216944 2005
38
Cerebral gene expression profiles in sporadic Creutzfeldt-Jakob disease. 61 56
16049922 2005
39
Creutzfeldt-Jakob disease with a novel insertion and codon 219 Lys/Lys polymorphism in PRNP. 61 6
15557533 2004
40
Identification of a second bovine amyloidotic spongiform encephalopathy: molecular similarities with sporadic Creutzfeldt-Jakob disease. 61 56
14970340 2004
41
Clinical features of Creutzfeldt-Jakob disease with V180I mutation. 61 6
14872044 2004
42
The sympathetic nervous system is involved in variant Creutzfeldt-Jakob disease. 61 56
12937415 2003
43
Molecular classification of sporadic Creutzfeldt-Jakob disease. 61 56
12764055 2003
44
Genetic Prion Diseases 61 6
20301407 2003
45
Creutzfeldt-Jakob disease. 61 56
12594311 2003
46
Detection of pathologic prion protein in the olfactory epithelium in sporadic Creutzfeldt-Jakob disease. 61 56
12594315 2003
47
Prion protein accumulation in eyes of patients with sporadic and variant Creutzfeldt-Jakob disease. 61 56
12506094 2003
48
A patient with dementia with Lewy bodies and codon 232 mutation of PRNP. 61 6
12451207 2002
49
Insomnia associated with thalamic involvement in E200K Creutzfeldt-Jakob disease. 61 6
11839833 2002
50
A novel erythroid-specific marker of transmissible spongiform encephalopathies. 61 56
11231637 2001

Variations for Creutzfeldt-Jakob Disease

ClinVar genetic disease variations for Creutzfeldt-Jakob Disease:

6 ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 PRNP NM_000311.5(PRNP):c.598G>A (p.Glu200Lys)SNV Pathogenic 13398 rs28933385 20:4680464-4680464 20:4699818-4699818
2 PRNP NM_000311.5(PRNP):c.532G>A (p.Asp178Asn)SNV Pathogenic 39359 rs74315403 20:4680398-4680398 20:4699752-4699752
3 PRNP NM_000311.5(PRNP):c.628G>A (p.Val210Ile)SNV Pathogenic 13403 rs74315407 20:4680494-4680494 20:4699848-4699848
4 PRNP NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln)NT expansion Pathogenic 13394 rs193922906 20:4680026-4680049 20:4699379-4699380
5 PRNP NM_000311.5(PRNP):c.631G>C (p.Glu211Gln)SNV Pathogenic 88923 rs398122370 20:4680497-4680497 20:4699851-4699851
6 PRNP NM_000311.5(PRNP):c.538G>A (p.Val180Ile)SNV Pathogenic/Likely pathogenic 13405 rs74315408 20:4680404-4680404 20:4699758-4699758
7 PRNP NM_000311.5(PRNP):c.623G>A (p.Arg208His)SNV Conflicting interpretations of pathogenicity 13411 rs74315412 20:4680489-4680489 20:4699843-4699843
8 PRNP NM_000311.5(PRNP):c.695T>G (p.Met232Arg)SNV Uncertain significance 13406 rs74315409 20:4680561-4680561 20:4699915-4699915
9 PRNP NM_000311.5(PRNP):c.385A>G (p.Met129Val)SNV Benign 13397 rs1799990 20:4680251-4680251 20:4699605-4699605

UniProtKB/Swiss-Prot genetic disease variations for Creutzfeldt-Jakob Disease:

73
# Symbol AA change Variation ID SNP ID
1 PRNP p.Asp178Asn VAR_006469 rs74315403
2 PRNP p.Val180Ile VAR_006470 rs74315408
3 PRNP p.Glu200Lys VAR_006473 rs28933385
4 PRNP p.Arg208His VAR_006474 rs74315412
5 PRNP p.Val210Ile VAR_006475 rs74315407
6 PRNP p.Met232Arg VAR_006478 rs74315409
7 PRNP p.Glu196Lys VAR_008749
8 PRNP p.Glu211Gln VAR_008752 rs398122370

Expression for Creutzfeldt-Jakob Disease

Search GEO for disease gene expression data for Creutzfeldt-Jakob Disease.

Pathways for Creutzfeldt-Jakob Disease

Pathways related to Creutzfeldt-Jakob Disease according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1 11.86 SNCA S100B PRNP MAPT GFAP ENO2
2 11.19 PRNP MAPT BACE1 APP
3 10.91 MAPT BACE1 APP APOE
4 10.79 CST3 BACE1 APP
5 10.44 S100B APP

GO Terms for Creutzfeldt-Jakob Disease

Cellular components related to Creutzfeldt-Jakob Disease according to GeneCards Suite gene sharing:

(show all 13)
# Name GO ID Score Top Affiliating Genes
1 plasma membrane GO:0005886 10.22 SPRN SNCA RPSA PRNP PRND MAPT
2 extracellular space GO:0005615 10.1 SNCA SERPINA3 S100B MSMB ENO2 CST3
3 Golgi apparatus GO:0005794 10.05 STMN2 SNCA PRNP CST3 BACE1 APP
4 endoplasmic reticulum lumen GO:0005788 9.83 CST3 BACE1 APP APOE
5 perinuclear region of cytoplasm GO:0048471 9.8 STMN2 SNCA S100B EIF2AK2 APP AIF1
6 membrane raft GO:0045121 9.76 PRNP MAPT BACE1 APP
7 extracellular region GO:0005576 9.7 SPRN SNCA SERPINA3 S100B PRNT PRND
8 axon GO:0030424 9.65 STMN2 SNCA MAPT BACE1 APP
9 glial cell projection GO:0097386 9.48 MAPT GFAP
10 growth cone GO:0030426 9.46 STMN2 SNCA MAPT APP
11 astrocyte projection GO:0097449 9.43 GFAP APP
12 main axon GO:0044304 9.37 MAPT APP
13 neuronal cell body GO:0043025 9.17 STMN2 SNCA S100B MAPT ENO2 BACE1

Biological processes related to Creutzfeldt-Jakob Disease according to GeneCards Suite gene sharing:

(show all 28)
# Name GO ID Score Top Affiliating Genes
1 negative regulation of gene expression GO:0010629 9.92 MAPT APP APOE AIF1
2 negative regulation of endopeptidase activity GO:0010951 9.83 SERPINA3 PRNP CST3 APP
3 cellular protein metabolic process GO:0044267 9.83 SNCA CST3 BACE1 APP APOE
4 neuron projection development GO:0031175 9.78 STMN2 MAPT APP APOE
5 negative regulation of neuron projection development GO:0010977 9.75 STMN2 GFAP APOE
6 learning or memory GO:0007611 9.74 S100B PRNP APP
7 long-term synaptic potentiation GO:0060291 9.73 SNCA S100B GFAP
8 synapse organization GO:0050808 9.72 SNCA MAPT APP
9 cellular response to amyloid-beta GO:1904646 9.71 PRNP BACE1 APP
10 positive regulation of neuron death GO:1901216 9.67 SNCA PRNP MAPT
11 astrocyte activation GO:0048143 9.64 MAPT APP
12 positive regulation of T cell migration GO:2000406 9.63 APP AIF1
13 regulation of microtubule polymerization or depolymerization GO:0031110 9.63 STMN2 MAPT
14 cellular response to nerve growth factor stimulus GO:1990090 9.63 STMN2 MAPT APP
15 negative regulation of amyloid-beta formation GO:1902430 9.62 PRNP APOE
16 negative regulation of microtubule polymerization GO:0031115 9.61 STMN2 SNCA
17 amyloid fibril formation GO:1990000 9.61 MAPT APP
18 neuron projection maintenance GO:1990535 9.6 PRNP APP
19 modulation of age-related behavioral decline GO:0090647 9.59 PRNP APP
20 cellular response to manganese ion GO:0071287 9.58 BACE1 APP
21 response to lead ion GO:0010288 9.58 MAPT BACE1 APP
22 regulation of neuronal synaptic plasticity GO:0048168 9.54 SNCA S100B APOE
23 positive regulation of amyloid fibril formation GO:1905908 9.51 APP APOE
24 cellular copper ion homeostasis GO:0006878 9.5 PRNP PRND APP
25 negative regulation of long-term synaptic potentiation GO:1900272 9.43 PRNP APP APOE
26 supramolecular fiber organization GO:0097435 9.33 SNCA MAPT CST3
27 microglial cell activation GO:0001774 9.26 SNCA MAPT APP AIF1
28 cellular response to copper ion GO:0071280 8.92 SNCA PRNP BACE1 APP

Molecular functions related to Creutzfeldt-Jakob Disease according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 calcium-dependent protein binding GO:0048306 9.58 STMN2 S100B PRNP
2 tubulin binding GO:0015631 9.54 STMN2 PRNP MAPT
3 copper ion binding GO:0005507 9.5 SNCA PRNP PRND
4 lipoprotein particle binding GO:0071813 9.43 MAPT APOE
5 tau protein binding GO:0048156 9.33 SNCA S100B APOE
6 identical protein binding GO:0042802 9.28 SNCA S100B PRNP MAPT GFAP EIF2AK2
7 cuprous ion binding GO:1903136 9.26 SNCA PRNP
8 amyloid-beta binding GO:0001540 9.26 PRNP CST3 BACE1 APOE

Sources for Creutzfeldt-Jakob Disease

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....