Home
User Guide
What's in a MalaCard Search Guide Our Sources
Analysis Tools
GeneCards GeneAnalytics GeneAlaCart PathCards VarElect TGex
News and Views Disease Lists/Categories
About
About MalaCards Our Publications Weizmann Institute LifeMap Discovery® Terms of Use MalaCards Team
MCID: DYS002
MIFTS: 42

Dysplastic Nevus Syndrome

Categories: Cancer diseases, Endocrine diseases, Genetic diseases, Rare diseases, Skin diseases
Genes Variations Tissues Related diseases Publications Drugs
Sources

Aliases & Classifications for Dysplastic Nevus Syndrome

About this section

MalaCards integrated aliases for Dysplastic Nevus Syndrome:

Name: Dysplastic Nevus Syndrome 12 75 55 44 15 72
Melanoma-Pancreatic Cancer Syndrome 53 59 72
Familial Atypical Multiple Mole Melanoma-Pancreatic Carcinoma Syndrome 53 59
Familial Atypical Multiple Mole Melanoma Syndrome 53 59
Familial Atypical Multiple Mole-Melanoma 12 72
Familial Atypical Mole Melanoma Syndrome 53 72
Familial Dysplastic Nevus Syndrome 53 59
Familial Atypical Mole Syndrome 53 59
Familial Clark Nevus Syndrome 53 59
B-K Mole Syndrome 53 59
Famm-Pc Syndrome 53 59
Fammm Syndrome 53 59
Familial Atypical Multiple Mole Melanoma-Pancreatic Carcinoma 53
Familial Atypical Multiple Mole Melanoma 55
Dysplastic Nevus 17
Famm Syndrome 12

Characteristics:

Orphanet epidemiological data:

59
familial atypical multiple mole melanoma syndrome
Inheritance: Autosomal dominant; Age of onset: Adolescent,Adult,Childhood; Age of death: adult;

Classifications:

MalaCards categories:
Global: Rare diseases Genetic diseases Cancer diseases
Anatomical: Skin diseases Endocrine diseases
See all MalaCards categories (disease lists)
ICD10: 34
Orphanet: 59  
Rare skin diseases


External Ids:

Disease Ontology 12 DOID:10041
MeSH 44 D004416
ICD10 via Orphanet 34 D22.9
UMLS via Orphanet 73 C0013403 C0205747 C1838547 more
Orphanet 59 ORPHA404560
UMLS 72 C0013403 C0205747 C1838547 more
Sources

Summaries for Dysplastic Nevus Syndrome

About this section
NIH Rare Diseases : 53 Familial atypical multiple mole melanoma syndrome (FAMMM syndrome) is an inherited condition characterized by the presence of multiple moles. Atypical moles, also called dysplastic nevi, are benign but are associated with an increased risk of melanoma. They can occur sporadically (with no other cases in a family), but are a symptom of FAMMM when multiple family members are affected. FAMMM syndrome may also increase the risk of pancreatic cancer in addition to melanoma. FAMMM syndrome is marked by: one or more 1st or 2nd degree relatives (parent, sibling, child, grandparent, grandchild, aunt, or uncle) with malignant melanoma; many moles, some of which are atypical (asymmetrical, raised, or different shades of color) and often of different sizes; and moles that have specific features when examined under a microscope. FAMMM syndrome may be caused by mutations in the CDKN2A gene (in about 40% of cases) or CDK4 gene (in very rare cases). However, in about 60% of cases, the cause is unknown. Inheritance is autosomal dominant. Treatment for FAMMM syndrome typically involves surgery. Family members of people with this condition should have surveillance at periodic intervals for melanoma.

MalaCards based summary : Dysplastic Nevus Syndrome, also known as melanoma-pancreatic cancer syndrome, is related to melanoma-pancreatic cancer syndrome and obsolete: melanoma-pancreatic cancer syndrome. An important gene associated with Dysplastic Nevus Syndrome is CDKN2A (Cyclin Dependent Kinase Inhibitor 2A). The drugs Tretinoin and Fenretinide have been mentioned in the context of this disorder. Affiliated tissues include skin, pancreas and testes.

Wikipedia : 75 Dysplastic nevus syndrome is a cutaneous condition described in certain families, and characterized by... more...

Sources

Related Diseases for Dysplastic Nevus Syndrome

About this section

Diseases related to Dysplastic Nevus Syndrome via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 96)
# Related Disease Score Top Affiliating Genes
1 melanoma-pancreatic cancer syndrome 12.9
2 obsolete: melanoma-pancreatic cancer syndrome 12.5
3 melanoma, cutaneous malignant 1 12.0
4 melanoma 10.7
5 skin melanoma 10.6
6 erythrokeratoderma ''en cocardes'' 10.4
7 pancreatic ductal adenocarcinoma 10.4
8 ocular melanoma 10.4
9 xeroderma pigmentosum, variant type 10.2
10 lentigines 10.2
11 neurofibromatosis, type iv, of riccardi 10.2
12 bladder cancer 10.1
13 breast cancer 10.1
14 beckwith-wiedemann syndrome 10.1
15 esophageal cancer 10.1
16 birt-hogg-dube syndrome 10.1
17 retinoblastoma 10.1
18 incontinentia pigmenti 10.1
19 wilms tumor 5 10.1
20 rhabdoid tumor predisposition syndrome 1 10.1
21 leukemia 10.1
22 neuroendocrine tumor 10.1
23 testicular cancer 10.1
24 rhabdomyosarcoma 10.1
25 rhabdoid cancer 10.1
26 familial retinoblastoma 10.1
27 pancreatic neuroendocrine tumor 10.1
28 pancreatic cancer 10.1
29 basal cell nevus syndrome 10.1
30 albinism 10.1
31 tetraploidy 10.1
32 hemangiopericytoma, malignant 10.1
33 malignant choroid melanoma 10.1
34 keratosis 10.1
35 myeloid leukemia 10.1
36 spitz nevus 10.1
37 squamous cell carcinoma 10.1
38 neurofibroma 10.1
39 obsolete: squamous cell carcinoma of head and neck 10.1
40 salivary gland carcinoma 10.0 TNN CDKN2A
41 glycogen-rich clear cell breast carcinoma 10.0 CDKN2A BRCA2
42 breast giant fibroadenoma 10.0 CDKN2A BRCA2
43 pre-malignant neoplasm 10.0 CDKN2A BRCA2
44 ocular cancer 10.0 CDKN2A BRCA2
45 melanoma, cutaneous malignant 2 9.9
46 melanoma, malignant familial intraocular 9.9
47 melanoma, uveal 9.9
48 ataxia-telangiectasia 9.9
49 mycosis fungoides 9.9
50 polycythemia vera 9.9

Graphical network of the top 20 diseases related to Dysplastic Nevus Syndrome:



Diseases related to Dysplastic Nevus Syndrome
Sources

Symptoms & Phenotypes for Dysplastic Nevus Syndrome

About this section
Sources

Drugs & Therapeutics for Dysplastic Nevus Syndrome

About this section

Drugs for Dysplastic Nevus Syndrome (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show all 31)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Tretinoin Approved, Investigational, Nutraceutical Phase 2 302-79-4 5538 444795
2
Fenretinide Investigational Phase 2 65646-68-6
3
Betulinic acid Investigational Phase 1, Phase 2 472-15-1 64971
4 Keratolytic Agents Phase 2
5 Dermatologic Agents Phase 2
6 Hormones Phase 1, Phase 2
7 Hormone Antagonists Phase 1, Phase 2
8 Hormones, Hormone Substitutes, and Hormone Antagonists Phase 1, Phase 2
9 Analgesics Phase 1, Phase 2
10 Anti-Inflammatory Agents Phase 1, Phase 2
11 Analgesics, Non-Narcotic Phase 1, Phase 2
12 Prostaglandin Antagonists Phase 1, Phase 2
13 Antineoplastic Agents, Phytogenic Phase 1, Phase 2
14 Peripheral Nervous System Agents Phase 1, Phase 2
15 Anti-Inflammatory Agents, Non-Steroidal Phase 1, Phase 2
16 Anti-Infective Agents Phase 1, Phase 2
17 Antimalarials Phase 1, Phase 2
18 Anti-HIV Agents Phase 1, Phase 2
19 Anti-Retroviral Agents Phase 1, Phase 2
20 Antiparasitic Agents Phase 1, Phase 2
21 Antiprotozoal Agents Phase 1, Phase 2
22 Antiviral Agents Phase 1, Phase 2
23 Antirheumatic Agents Phase 1, Phase 2
24
Pancrelipase Approved, Investigational 53608-75-6
25
Secretin Approved 108153-74-8
26
Serine Approved, Nutraceutical 56-45-1 5951
27
Sulforaphane Investigational Early Phase 1 4478-93-7, 142825-10-3 5350
28 Sulforafan Early Phase 1
29 Protective Agents Early Phase 1
30 pancreatin
31 Gastrointestinal Agents

Interventional clinical trials:

(show all 17)
# Name Status NCT ID Phase Drugs
1 A Phase II Double-Blind Study of Topical Tretinoin With or Without Oral 4-HPR (Fenretinide) in Patients With the Dysplastic Nevus Syndrome Completed NCT00003601 Phase 2 fenretinide;tretinoin
2 Phase I/II Evaluation of Topical Application of 20% Betulinic Acid Ointment in the Treatment of Dysplastic Nevi With Moderate to Severe Dysplasia Suspended NCT00346502 Phase 1, Phase 2 20% betulinic acid ointment;BA
3 Identification of the Genetic Mutation Responsible for Segmental Dysplastic Nevi Unknown status NCT00955578
4 Using High Resolution Function Imaging To Detect Melanoma and Dysplastic Nevi Completed NCT01118832
5 Prospective Study of 2 mm Margins for the Biopsy of Dysplastic Nevi Completed NCT03094273
6 Potential Research Study Participant Registry Completed NCT00710489
7 A Pilot Study Evaluation of Sulforaphane in Atypical Nevi--Precursor Lesions: Assessment of STAT1 and STAT3 Risk Markers of Melanoma Completed NCT01568996 Early Phase 1 broccoli sprout extract - sulforaphane (BSE-SFN);broccoli sprout extract - sulforaphane (BSE-SFN);broccoli sprout extract - sulforaphane (BSE-SFN)
8 Observational Study to Analyze the Outcomes of Subjects Who - Based Upon Their Sufficiently Elevated Risk for the Development of Pancreatic Adenocarcinoma- Elect to Undergo Early Detection Testing Recruiting NCT02206360
9 The Cancer of the Pancreas Screening-5 CAPS5)Study Recruiting NCT02000089 Human synthetic secretin
10 Pancreas Disease and High Risk Registry Recruiting NCT02775461
11 An Online Intervention for Skin Self-Checks Among Individuals at Increased Risk for Melanoma Recruiting NCT03725449
12 A Prospective, Multi-center Investigational Study of IMMrayâ„¢ PanCan-d Diagnostic Assay for Early Detection of Pancreatic Ductal Adenocarcinoma in High-risk Populations Recruiting NCT03693378
13 Clinical, Laboratory, and Epidemiologic Characterization of Individuals and Families at High Risk of Melanoma Recruiting NCT00040352
14 Family Study of Melanoma in Italy Recruiting NCT00339222
15 Dermoscopy Evaluation of Pigmented Skin Lesions by a Neuronal Network Clinical Decision Support: an Open Prospective Non Interventional Study Recruiting NCT03362138
16 Skin Lesion Detection With Novel Total Body Digital Photography Smartphone Application Active, not recruiting NCT02740257
17 Pancreatic Cancer Screening of High-Risk Individuals in Arkansas Withdrawn NCT02309632

Search NIH Clinical Center for Dysplastic Nevus Syndrome

Cochrane evidence based reviews: dysplastic nevus syndrome

Sources

Genetic Tests for Dysplastic Nevus Syndrome

About this section
Sources

Anatomical Context for Dysplastic Nevus Syndrome

About this section

MalaCards organs/tissues related to Dysplastic Nevus Syndrome:

41
Skin, Pancreas, Testes, Ovary, Lymph Node, Eye, Thymus
Sources

Publications for Dysplastic Nevus Syndrome

About this section

Articles related to Dysplastic Nevus Syndrome:

(show top 50) (show all 255)
# Title Authors PMID Year
1
Risk of developing pancreatic cancer in families with familial atypical multiple mole melanoma associated with a specific 19 deletion of p16 (p16-Leiden). 9 71
10956390 2000
2
A locus linked to p16 modifies melanoma risk in Dutch familial atypical multiple mole melanoma (FAMMM) syndrome families. 9 71
10400925 1999
3
Homozygotes for CDKN2 (p16) germline mutation in Dutch familial melanoma kindreds. 9 71
7670475 1995
4
ACG clinical guideline: Genetic testing and management of hereditary gastrointestinal cancer syndromes. 71
25645574 2015
5
Indication for CDKN2A-mutation analysis in familial pancreatic cancer families without melanomas. 71
22636603 2012
6
Predicting functional significance of cancer-associated p16(INK4a) mutations in CDKN2A. 71
20340136 2010
7
Hereditary p16-Leiden mutation in a patient with multiple head and neck tumors. 71
12549483 2003
8
High prevalence of the G101W germline mutation in the CDKN2A (P16(ink4a)) gene in 62 Italian malignant melanoma families. 71
11807902 2002
9
Sporadic multiple primary melanoma cases: CDKN2A germline mutations with a founder effect. 71
11579459 2001
10
A single genetic origin for the G101W CDKN2A mutation in 20 melanoma-prone families. 71
10869234 2000
11
Familial melanoma and pancreatic cancer. Ligurian Skin Tumor Study Group. 71
8552158 1996
12
Brief report: a familial syndrome of pancreatic cancer and melanoma with a mutation in the CDKN2 tumor-suppressor gene. 71
7666917 1995
13
Germline p16 mutations in familial melanoma. 71
7987387 1994
14
Frequent somatic mutation of the MTS1/CDK4I (multiple tumor suppressor/cyclin-dependent kinase 4 inhibitor) gene in esophageal squamous cell carcinoma. 71
8012957 1994
15
Familial atypical multiple mole melanoma (FAMMM) syndrome: history, genetics, and heterogeneity. 6
26892865 2016
16
Analysis of the p16 gene status of non-familial dysplastic nevus syndrome patients. 9 38
11820732 2001
17
Screening of germline mutations in the CDK4, CDKN2C and TP53 genes in familial melanoma: a clinic-based population study. 9 38
9724087 1998
18
Inherited susceptibility to several cancers but absence of linkage between dysplastic nevus syndrome and CDKN2A in a melanoma family with a mutation in the CDKN2A (P16INK4A) gene. 9 38
9439668 1997
19
Screening of germline mutations in the CDKN2A and CDKN2B genes in Swedish families with hereditary cutaneous melanoma. 9 38
9168184 1997
20
Skin Cancer: Precancers. 38
31188549 2019
21
Simultaneous long-lasting regression of multiple nevi and melanoma metastases after ipilimumab therapy. 38
31026247 2019
22
Innovations and Innovative Approaches or Pseudo-Innovations in the Context of General Globalization? It's Time to Wake Up! 38
29483969 2018
23
Genomic Characterization of Dysplastic Nevi Unveils Implications for Diagnosis of Melanoma. 38
27890785 2017
24
"Melanoma: Questions and Answers." Development and evaluation of a psycho-educational resource for people with a history of melanoma. 38
27465047 2016
25
Erythematous-violaceous macule on the chest in a patient with dysplastic nevus syndrome. 38
27444088 2016
26
Knowledge about Ultraviolet Radiation Hazards and Tanning Behavior of Cosmetology and Medical Students. 38
27149135 2016
27
Germline CDKN2A mutations in childhood melanoma: a case of melanoma-pancreatic cancer syndrome. 38
26381259 2015
28
Multiple Cutaneous Melanomas and Clinically Atypical Moles in a Patient With a Novel Germline BAP1 Mutation. 38
26154183 2015
29
Immunosuppression is an independent prognostic factor associated with aggressive tumor behavior in cutaneous melanoma. 38
26209220 2015
30
Characterization, treatment, and outcome of uveal melanoma in the first two years of life. 38
25300563 2015
31
Four cases of dysplastic nevus syndrome. 38
25143698 2014
32
Detection of primary melanoma in individuals at extreme high risk: a prospective 5-year follow-up study. 38
24964862 2014
33
Primary uveal melanoma in a 4-year-old black child. 38
24160981 2013
34
On the clinical significance of cutaneous melanoma's precursors. 38
23130279 2012
35
Primary gallbladder melanoma in dysplastic nevus syndrome: report of case and literature review. 38
22287410 2011
36
Melanocyte-specific immune response in a patient with multiple regressing nevi and a history of melanoma. 38
22110189 2011
37
Epidemiology of melanoma. 38
21277533 2010
38
Morphologic features and natural history of scalp nevi in children. 38
20479298 2010
39
Childhood melanoma. 38
19880040 2009
40
Atypical familial presentation of FAMMM syndrome with a high incidence of pancreatic cancer: case finding of asymptomatic individuals by EUS surveillance. 9
19417680 2009
41
Dysplastic nevus syndrome with development of multiple melanomas. A surgical concept for prophylaxis. 38
19456853 2009
42
Novel presentation of a familial pancreatic cancer syndrome. 38
19089513 2009
43
Neurofibromatosis type 1 associated with dysplastic nevus syndrome. 38
19595268 2009
44
Nevi and melanoma in the pregnant woman. 38
19095157 2009
45
Undifferentiated carcinoma with osteoclastic giant cells (UCOCGC) of the pancreas associated with the familial atypical multiple mole melanoma syndrome (FAMMM). 9
18813118 2008
46
Predicting the risk of pancreatic cancer: on CDKN2A mutations in the melanoma-pancreatic cancer syndrome in Italy. 38
18024887 2007
47
Monitoring of kindreds with hereditary predisposition for cutaneous melanoma and dysplastic nevus syndrome: results of a Swedish preventive program. 38
17602087 2007
48
Cutaneous malignant melanoma metastatic to the vitreous. 38
17460596 2007
49
Malignant melanoma in childhood and adolescence: report of 13 cases. 38
16243130 2005
50
Agminated acquired melanocytic nevi of the common and dysplastic type. 38
15627083 2005
Sources

Variations for Dysplastic Nevus Syndrome

About this section

ClinVar genetic disease variations for Dysplastic Nevus Syndrome:

6 (show top 50) (show all 60)
# Gene Variation Type Significance SNP ID GRCh37 Pos GRCh38 Pos
1 CDKN2A NM_000077.4(CDKN2A): c.226_244del (p.Ala76fs) deletion Pathogenic,risk factor rs587776716 9:21971114-21971132 9:21971115-21971133
2 CDKN2A NM_000077.4(CDKN2A): c.377T> A (p.Val126Asp) single nucleotide variant Pathogenic rs104894098 9:21970981-21970981 9:21970982-21970982
3 CDKN2A CDKN2A, 5-BP DUP, NT19 duplication Pathogenic
4 CDKN2A NM_000077.4(CDKN2A): c.240_253del (p.Pro81fs) deletion Pathogenic rs730881675 9:21971105-21971118 9:21971106-21971119
5 CDKN2A NM_000077.4(CDKN2A): c.-34G> T single nucleotide variant Pathogenic rs1800586 9:21974860-21974860 9:21974861-21974861
6 CDKN2A NM_000077.4(CDKN2A): c.457G> T (p.Asp153Tyr) single nucleotide variant Pathogenic/Likely pathogenic rs45476696 9:21970901-21970901 9:21970902-21970902
7 CDKN2A NM_000077.4(CDKN2A): c.176T> G (p.Val59Gly) single nucleotide variant Pathogenic/Likely pathogenic rs104894099 9:21971182-21971182 9:21971183-21971183
8 CDKN2A NM_000077.4(CDKN2A): c.71G> C (p.Arg24Pro) single nucleotide variant Pathogenic/Likely pathogenic rs104894097 9:21974756-21974756 9:21974757-21974757
9 CDKN2A NM_000077.4(CDKN2A): c.301G> T (p.Gly101Trp) single nucleotide variant Conflicting interpretations of pathogenicity rs104894094 9:21971057-21971057 9:21971058-21971058
10 CDKN2A NM_000077.4(CDKN2A): c.373G> C (p.Asp125His) single nucleotide variant Conflicting interpretations of pathogenicity rs146179135 9:21970985-21970985 9:21970986-21970986
11 CDKN2A NM_000077.4(CDKN2A): c.146T> C (p.Ile49Thr) single nucleotide variant Conflicting interpretations of pathogenicity rs199907548 9:21974681-21974681 9:21974682-21974682
12 CDKN2A NM_000077.4(CDKN2A): c.369T> A (p.His123Gln) single nucleotide variant Conflicting interpretations of pathogenicity rs6413463 9:21970989-21970989 9:21970990-21970990
13 CDKN2A NM_000077.4(CDKN2A): c.150+37G> C single nucleotide variant Conflicting interpretations of pathogenicity rs45456595 9:21974640-21974640 9:21974641-21974641
14 CDKN2A NM_000077.4(CDKN2A): c.151-4G> C single nucleotide variant Conflicting interpretations of pathogenicity rs529380972 9:21971211-21971211 9:21971212-21971212
15 CDKN2A NM_000077.4(CDKN2A): c.-14C> T single nucleotide variant Conflicting interpretations of pathogenicity rs764244718 9:21974840-21974840 9:21974841-21974841
16 CDKN2A NM_000077.4(CDKN2A): c.370C> T (p.Arg124Cys) single nucleotide variant Conflicting interpretations of pathogenicity rs34170727 9:21970988-21970988 9:21970989-21970989
17 CDKN2A NM_000077.4(CDKN2A): c.273G> A (p.Leu91=) single nucleotide variant Conflicting interpretations of pathogenicity rs4987127 9:21971085-21971085 9:21971086-21971086
18 CDKN2A NM_000077.4(CDKN2A): c.-34G> C single nucleotide variant Conflicting interpretations of pathogenicity rs1800586 9:21974860-21974860 9:21974861-21974861
19 CDKN2A NM_058195.3(CDKN2A): c.92C> G (p.Thr31Arg) single nucleotide variant Conflicting interpretations of pathogenicity rs528789830 9:21994239-21994239 9:21994240-21994240
20 CDKN2A NM_058195.3(CDKN2A): c.13T> A (p.Phe5Ile) single nucleotide variant Uncertain significance rs776987532 9:21994318-21994318 9:21994319-21994319
21 CDKN2A NM_000077.4(CDKN2A): c.122C> A (p.Pro41Gln) single nucleotide variant Uncertain significance rs373407950 9:21974705-21974705 9:21974706-21974706
22 CDKN2A NM_000077.4(CDKN2A): c.427G> A (p.Ala143Thr) single nucleotide variant Uncertain significance rs754195015 9:21970931-21970931 9:21970932-21970932
23 CDKN2A NM_000077.4(CDKN2A): c.365G> T (p.Gly122Val) single nucleotide variant Uncertain significance rs373291490 9:21970993-21970993 9:21970994-21970994
24 CDKN2A NM_000077.4(CDKN2A): c.415G> C (p.Gly139Arg) single nucleotide variant Uncertain significance rs587781733 9:21970943-21970943 9:21970944-21970944
25 CDKN2A NM_000077.4(CDKN2A): c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) short repeat Uncertain significance rs587780668 9:21974795-21974818 9:21974796-21974819
26 CDKN2A NM_000077.4(CDKN2A): c.150+1104C> A single nucleotide variant Uncertain significance rs756102261 9:21973573-21973573 9:21973574-21973574
27 CDKN2A NM_058195.3(CDKN2A): c.43T> C (p.Cys15Arg) single nucleotide variant Uncertain significance rs1554659236 9:21994288-21994288 9:21994289-21994289
28 CDKN2A NM_000077.4(CDKN2A): c.295C> G (p.Arg99Gly) single nucleotide variant Uncertain significance rs34886500 9:21971063-21971063 9:21971064-21971064
29 CDKN2A NM_058195.3(CDKN2A): c.79A> C (p.Ile27Leu) single nucleotide variant Uncertain significance rs1057517575 9:21994252-21994252 9:21994253-21994253
30 CDKN2A NM_058195.3(CDKN2A): c.69C> A (p.Phe23Leu) single nucleotide variant Uncertain significance rs374360796 9:21994262-21994262 9:21994263-21994263
31 CDKN2A NM_058195.3(CDKN2A): c.62G> A (p.Arg21Lys) single nucleotide variant Uncertain significance rs1057517601 9:21994269-21994269 9:21994270-21994270
32 CDKN2A NM_058195.3(CDKN2A): c.-33G> A single nucleotide variant Uncertain significance rs1057517639 9:21994363-21994363 9:21994364-21994364
33 CDKN2A NM_000077.4(CDKN2A): c.315C> A (p.Asp105Glu) single nucleotide variant Uncertain significance rs763269347 9:21971043-21971043 9:21971044-21971044
34 CDKN2A NM_000077.4(CDKN2A): c.301G> A (p.Gly101Arg) single nucleotide variant Uncertain significance rs104894094 9:21971057-21971057 9:21971058-21971058
35 CDKN2A NM_058195.3(CDKN2A): c.167G> A (p.Gly56Glu) single nucleotide variant Uncertain significance rs748327367 9:21994164-21994164 9:21994165-21994165
36 CDKN2A NM_000077.4(CDKN2A): c.331G> A (p.Gly111Ser) single nucleotide variant Uncertain significance rs778971134 9:21971027-21971027 9:21971028-21971028
37 CDKN2A NM_000077.4(CDKN2A): c.150+170dupT duplication Likely benign rs753316964 9:21974507-21974507 9:21974508-21974508
38 CDKN2A NM_000077.4(CDKN2A): c.-33G> C single nucleotide variant Likely benign rs531597737 9:21974859-21974859 9:21974860-21974860
39 CDKN2A NM_058195.3(CDKN2A): c.193+7A> G single nucleotide variant Likely benign rs770519197 9:21994131-21994131 9:21994132-21994132
40 CDKN2A NM_000077.4(CDKN2A): c.458-465G> C single nucleotide variant Likely benign rs563204204 9:21968706-21968706 9:21968707-21968707
41 CDKN2A NM_000077.4(CDKN2A): c.458-541A> G single nucleotide variant Likely benign rs938889880 9:21968782-21968782 9:21968783-21968783
42 CDKN2A NM_000077.4(CDKN2A): c.150+1104C> T single nucleotide variant Likely benign rs756102261 9:21973573-21973573 9:21973574-21973574
43 CDKN2A NM_000077.4(CDKN2A): c.150+216A> G single nucleotide variant Likely benign rs147602781 9:21974461-21974461 9:21974462-21974462
44 CDKN2A NM_000077.4(CDKN2A): c.150+193G> A single nucleotide variant Likely benign rs1057517587 9:21974484-21974484 9:21974485-21974485
45 CDKN2A NM_000077.4(CDKN2A): c.150+104_150+105del deletion Likely benign rs1057517608 9:21974572-21974573 9:21974573-21974574
46 CDKN2A NM_000077.4(CDKN2A): c.150+71_150+76del deletion Likely benign rs753508262 9:21974601-21974606 9:21974602-21974607
47 CDKN2A NM_000077.4(CDKN2A): c.150+40C> T single nucleotide variant Likely benign rs1057517604 9:21974637-21974637 9:21974638-21974638
48 CDKN2A NM_000077.4(CDKN2A): c.458-492G> C single nucleotide variant Likely benign rs527814073 9:21968733-21968733 9:21968734-21968734
49 CDKN2A NM_000077.4(CDKN2A): c.150+20C> T single nucleotide variant Likely benign rs550846229 9:21974657-21974657 9:21974658-21974658
50 CDKN2A NM_058195.3(CDKN2A): c.-28C> G single nucleotide variant Likely benign rs149253558 9:21994358-21994358 9:21994359-21994359
Sources

Expression for Dysplastic Nevus Syndrome

About this section
Search GEO for disease gene expression data for Dysplastic Nevus Syndrome.
Sources

Pathways for Dysplastic Nevus Syndrome

About this section
Sources

GO Terms for Dysplastic Nevus Syndrome

About this section

Biological processes related to Dysplastic Nevus Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 dendrite self-avoidance GO:0070593 8.62 TNN PALLD
Sources

Sources for Dysplastic Nevus Syndrome

About this section
3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HGMD
31 HMDB
32 HPO
33 ICD10
34 ICD10 via Orphanet
35 ICD9CM
36 IUPHAR
37 KEGG
38 LifeMap
40 LOVD
42 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
54 NINDS
55 Novoseek
57 OMIM
58 OMIM via Orphanet
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 TGDB
71 Tocris
72 UMLS
73 UMLS via Orphanet
The MalaCards human disease database index: 1-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Content
Loading form....