MCID: DYS002
MIFTS: 53

Dysplastic Nevus Syndrome

Categories: Cancer diseases, Endocrine diseases, Genetic diseases, Rare diseases, Skin diseases

Aliases & Classifications for Dysplastic Nevus Syndrome

MalaCards integrated aliases for Dysplastic Nevus Syndrome:

Name: Dysplastic Nevus Syndrome 12 74 54 43 15 71
Melanoma-Pancreatic Cancer Syndrome 52 58 71
Familial Atypical Multiple Mole Melanoma-Pancreatic Carcinoma Syndrome 52 58
Familial Atypical Multiple Mole Melanoma Syndrome 52 58
Familial Atypical Multiple Mole-Melanoma 12 71
Familial Atypical Mole Melanoma Syndrome 52 71
Familial Dysplastic Nevus Syndrome 52 58
Familial Atypical Mole Syndrome 52 58
B-K Mole Syndrome 52 58
Famm-Pc Syndrome 52 58
Fammm Syndrome 52 58
Familial Atypical Multiple Mole Melanoma-Pancreatic Carcinoma 52
Familial Atypical Multiple Mole Melanoma 54
Familial Clark Nevus Syndrome 52
Dysplastic Nevus 17
Famm Syndrome 12

Characteristics:

Orphanet epidemiological data:

58
familial atypical multiple mole melanoma syndrome
Inheritance: Autosomal dominant; Age of onset: Adolescent,Adult,Childhood; Age of death: adult;

Classifications:

Orphanet: 58  
Rare skin diseases


External Ids:

Disease Ontology 12 DOID:10041
MeSH 43 D004416
ICD10 via Orphanet 33 D22.9
UMLS via Orphanet 72 C0013403 C0205747 C1838547 more
Orphanet 58 ORPHA404560
UMLS 71 C0013403 C0205747 C1838547 more

Summaries for Dysplastic Nevus Syndrome

NIH Rare Diseases : 52 Familial atypical multiple mole melanoma syndrome (FAMMM syndrome) is an inherited condition characterized by the presence of multiple moles . Atypical moles , also called dysplastic nevi, are benign but are associated with an increased risk of melanoma . They can occur sporadically (with no other cases in a family), but are a symptom of FAMMM when multiple family members are affected. FAMMM syndrome may also increase the risk of pancreatic cancer in addition to melanoma . FAMMM syndrome is marked by: one or more 1st or 2nd degree relatives (parent, sibling, child, grandparent, grandchild, aunt, or uncle) with malignant melanoma; many moles, some of which are atypical (asymmetrical, raised, or different shades of color) and often of different sizes; and moles that have specific features when examined under a microscope. FAMMM syndrome may be caused by mutations in the CDKN2A gene (in about 40% of cases) or CDK4 gene (in very rare cases). However, in about 60% of cases, the cause is unknown. Inheritance is autosomal dominant . Treatment for FAMMM syndrome typically involves surgery. Family members of people with this condition should have surveillance at periodic intervals for melanoma.

MalaCards based summary : Dysplastic Nevus Syndrome, also known as melanoma-pancreatic cancer syndrome, is related to hereditary melanoma and tetraploidy. An important gene associated with Dysplastic Nevus Syndrome is CDKN2A (Cyclin Dependent Kinase Inhibitor 2A), and among its related pathways/superpathways are DNA Double-Strand Break Repair and Regulation of TP53 Activity. The drugs Tretinoin and Fenretinide have been mentioned in the context of this disorder. Affiliated tissues include skin, pancreas and testes, and related phenotypes are Synthetic lethal with MLN4924 (a NAE inhibitor) and Synthetic lethal with MLN4924 (a NAE inhibitor)

Wikipedia : 74 Dysplastic nevus syndrome, also known as familial atypical multiple mole-melanoma (FAMMM) syndrome, is... more...

Related Diseases for Dysplastic Nevus Syndrome

Diseases related to Dysplastic Nevus Syndrome via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 221)
# Related Disease Score Top Affiliating Genes
1 hereditary melanoma 31.3 CMM CDKN2A
2 tetraploidy 30.6 BRCA2 BRCA1
3 skin melanoma 30.1 PMS2 MLH1 CDKN2A
4 ataxia-telangiectasia 29.5 BRCA2 BRCA1 ATM
5 neurofibromatosis 28.8 PMS2 MSH6 MSH2 MLH1
6 rhabdomyosarcoma 28.7 PMS2 MSH6 MSH2 CDKN2A BRCA1
7 xeroderma pigmentosum, variant type 28.5 MSH6 MSH2 MLH1 BRCA2 BRCA1 ATM
8 adenocarcinoma 28.5 STK11 MSH6 MSH2 MLH1 CDKN2A BRCA2
9 esophageal cancer 28.2 STK11 MSH2 MLH1 MIR200A CDKN2A BRCA2
10 melanoma, cutaneous malignant 1 27.9 STK11 PRSS58 PRSS1 PMS2 PALB2 MSH6
11 pancreatic adenocarcinoma 27.8 PRSS1 PALLD MLH1 MIR200A CDKN2A BRCA2
12 endometrial cancer 27.0 PMS2 MSH6 MSH2 MLH1 MIR200A CDKN2A
13 pancreatic cancer 26.8 STK11 PRSS1 PALLD PALB2 MSH2 MLH1
14 breast cancer 26.0 STK11 PMS2 PALB2 MSH6 MSH2 MLH1
15 melanoma-pancreatic cancer syndrome 12.9
16 melanoma 10.7
17 melanoma, cutaneous malignant 10 10.6
18 erythrokeratoderma ''en cocardes'' 10.4
19 vaginal tubulovillous adenoma 10.4 STK11 CDKN2A
20 pancreatic ductal adenocarcinoma 10.4
21 cervical mucinous adenocarcinoma 10.4 STK11 PALB2
22 ocular melanoma 10.4
23 tracheoesophageal fistula with or without esophageal atresia 10.3 PALB2 BRCA2
24 fallopian tube clear cell adenocarcinoma 10.3 BRCA2 BRCA1
25 rare malignant breast tumor 10.3 BRCA2 BRCA1
26 synchronous bilateral breast carcinoma 10.3 BRCA2 BRCA1
27 ovary transitional cell carcinoma 10.3 BRCA2 BRCA1
28 hereditary site-specific ovarian cancer syndrome 10.3 BRCA2 BRCA1
29 biliary dyskinesia 10.3 PRSS58 PRSS1
30 familial ovarian cancer 10.3 BRCA2 BRCA1
31 cancerophobia 10.3 BRCA2 BRCA1
32 basaloid lung carcinoma 10.3 BRCA2 BRCA1
33 nosophobia 10.3 BRCA2 BRCA1
34 breast-ovarian cancer, familial 2 10.3 BRCA2 BRCA1
35 mediastinum liposarcoma 10.3 CDKN2A ATM
36 endosalpingiosis 10.2 BRCA2 BRCA1
37 ovarian carcinosarcoma 10.2 BRCA2 BRCA1
38 squamous cell carcinoma 10.2
39 mutagen sensitivity 10.2 BRCA2 BRCA1
40 lentigines 10.2
41 primary peritoneal carcinoma 10.2 BRCA2 BRCA1
42 breast juvenile papillomatosis 10.2 BRCA2 ATM
43 serous cystadenocarcinoma 10.2 CDKN2A BRCA2 BRCA1
44 ovarian cystadenocarcinoma 10.1 CDKN2A BRCA2 BRCA1
45 pre-malignant neoplasm 10.1 CDKN2A BRCA2 BRCA1
46 bladder cancer 10.1
47 beckwith-wiedemann syndrome 10.1
48 birt-hogg-dube syndrome 10.1
49 retinoblastoma 10.1
50 incontinentia pigmenti 10.1

Graphical network of the top 20 diseases related to Dysplastic Nevus Syndrome:



Diseases related to Dysplastic Nevus Syndrome

Symptoms & Phenotypes for Dysplastic Nevus Syndrome

GenomeRNAi Phenotypes related to Dysplastic Nevus Syndrome according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Synthetic lethal with MLN4924 (a NAE inhibitor) GR00250-A-1 9.84 BRCA1 BRCA2 CDKN2A MLH1 PALB2 STK11
2 Synthetic lethal with MLN4924 (a NAE inhibitor) GR00250-A-2 9.84 ATM BRCA1 BRCA2 CDKN2A MLH1 PALB2
3 Synthetic lethal with MLN4924 (a NAE inhibitor) GR00250-A-3 9.84 ATM BRCA1 BRCA2 MLH1 MSH2 MSH6
4 Increased viability with MLN4924 (a NAE inhibitor) GR00250-A-1 9.65 ATM
5 Increased viability with MLN4924 (a NAE inhibitor) GR00250-A-2 9.65 ATM BRCA1 CDKN2A PALB2
6 Increased viability with MLN4924 (a NAE inhibitor) GR00250-A-3 9.65 ATM BRCA1 BRCA2 MLH1 PALB2
7 Decreased viability after ionizing radiation GR00232-A-2 9.33 ATM BRCA1 BRCA2

MGI Mouse Phenotypes related to Dysplastic Nevus Syndrome:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 cellular MP:0005384 10.17 ATM BRCA1 BRCA2 CDKN2A MLH1 MSH2
2 hematopoietic system MP:0005397 9.97 ATM BRCA1 BRCA2 CDKN2A MLH1 MSH2
3 digestive/alimentary MP:0005381 9.95 BRCA1 BRCA2 CDKN2A MLH1 MSH2 PMS2
4 embryo MP:0005380 9.91 ATM BRCA1 BRCA2 CDKN2A PALB2 PALLD
5 immune system MP:0005387 9.91 ATM BRCA1 BRCA2 CDKN2A MLH1 MSH2
6 integument MP:0010771 9.81 ATM BRCA1 BRCA2 CDKN2A MLH1 MSH2
7 mortality/aging MP:0010768 9.7 ATM BRCA1 BRCA2 CDKN2A MLH1 MSH2
8 neoplasm MP:0002006 9.32 ATM BRCA1 BRCA2 CDKN2A MLH1 MSH2

Drugs & Therapeutics for Dysplastic Nevus Syndrome

Drugs for Dysplastic Nevus Syndrome (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show all 30)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Tretinoin Approved, Investigational, Nutraceutical Phase 2 302-79-4 444795 5538
2
Fenretinide Investigational Phase 2 65646-68-6
3
Betulinic acid Investigational Phase 1, Phase 2 472-15-1 64971
4 Dermatologic Agents Phase 2
5 Protective Agents Phase 2
6 Keratolytic Agents Phase 2
7 Hormone Antagonists Phase 1, Phase 2
8 Hormones Phase 1, Phase 2
9 Anti-HIV Agents Phase 1, Phase 2
10 Analgesics, Non-Narcotic Phase 1, Phase 2
11 Prostaglandin Antagonists Phase 1, Phase 2
12 Anti-Infective Agents Phase 1, Phase 2
13 Analgesics Phase 1, Phase 2
14 Anti-Inflammatory Agents Phase 1, Phase 2
15 Antiparasitic Agents Phase 1, Phase 2
16 Antiviral Agents Phase 1, Phase 2
17 Antirheumatic Agents Phase 1, Phase 2
18 Antiprotozoal Agents Phase 1, Phase 2
19 Antimalarials Phase 1, Phase 2
20 Anti-Retroviral Agents Phase 1, Phase 2
21 Anti-Inflammatory Agents, Non-Steroidal Phase 1, Phase 2
22
Pancrelipase Approved, Investigational 53608-75-6
23
Secretin Approved 108153-74-8
24
Formaldehyde Approved, Vet_approved 50-00-0 712
25
Sulforaphane Investigational Early Phase 1 142825-10-3, 4478-93-7 5350
26 Sulforafan Early Phase 1
27 pancreatin
28 Gastrointestinal Agents
29 Anesthetics
30
Serine Investigational, Nutraceutical 56-45-1 5951

Interventional clinical trials:

(show all 19)
# Name Status NCT ID Phase Drugs
1 A Phase II Double-Blind Study of Topical Tretinoin With or Without Oral 4-HPR (Fenretinide) in Patients With the Dysplastic Nevus Syndrome Completed NCT00003601 Phase 2 fenretinide;tretinoin
2 Phase I/II Evaluation of Topical Application of 20% Betulinic Acid Ointment in the Treatment of Dysplastic Nevi With Moderate to Severe Dysplasia Suspended NCT00346502 Phase 1, Phase 2 20% betulinic acid ointment;BA
3 Identification of the Genetic Mutation Responsible for Segmental Dysplastic Nevi Unknown status NCT00955578
4 Dermoscopy Evaluation of Pigmented Skin Lesions by a Neuronal Network Clinical Decision Support: an Open Prospective Non Interventional Study Unknown status NCT03362138
5 Using High Resolution Function Imaging To Detect Melanoma and Dysplastic Nevi Completed NCT01118832
6 Potential Research Study Participant Registry Completed NCT00710489
7 Prospective Study of 2 mm Margins for the Biopsy of Dysplastic Nevi Completed NCT03094273
8 A Pilot Study Evaluation of Sulforaphane in Atypical Nevi--Precursor Lesions: Assessment of STAT1 and STAT3 Risk Markers of Melanoma Completed NCT01568996 Early Phase 1 broccoli sprout extract - sulforaphane (BSE-SFN);broccoli sprout extract - sulforaphane (BSE-SFN);broccoli sprout extract - sulforaphane (BSE-SFN)
9 Observational Study to Analyze the Outcomes of Subjects Who - Based Upon Their Sufficiently Elevated Risk for the Development of Pancreatic Adenocarcinoma- Elect to Undergo Early Detection Testing Recruiting NCT02206360
10 The Cancer of the Pancreas Screening-5 CAPS5)Study Recruiting NCT02000089 Human synthetic secretin
11 Pancreas Disease and High Risk Registry Recruiting NCT02775461
12 Italian Registry of Families At Risk of Pancreatic Cancer Recruiting NCT04095195
13 An Online Intervention for Skin Self-Checks Among Individuals at Increased Risk for Melanoma Recruiting NCT03725449
14 A Multicenter, Ambispective, Low-interventional Clinical Study Evaluating Molecular Genetic Markers for Non-invasive Differential Diagnosis of Benign and Malignant Pigmented Skin and Mucosal Neoplasms Recruiting NCT04353050
15 A Prospective, Multi-center Investigational Study of IMMray™ PanCan-d Diagnostic Assay for Early Detection of Pancreatic Ductal Adenocarcinoma in High-risk Populations Recruiting NCT03693378
16 Family Study of Melanoma in Italy Recruiting NCT00339222
17 Clinical, Laboratory, and Epidemiologic Characterization of Individuals and Families at High Risk of Melanoma Recruiting NCT00040352
18 Skin Lesion Detection With Novel Total Body Digital Photography Smartphone Application Active, not recruiting NCT02740257
19 Pancreatic Cancer Screening of High-Risk Individuals in Arkansas Withdrawn NCT02309632

Search NIH Clinical Center for Dysplastic Nevus Syndrome

Cochrane evidence based reviews: dysplastic nevus syndrome

Genetic Tests for Dysplastic Nevus Syndrome

Anatomical Context for Dysplastic Nevus Syndrome

MalaCards organs/tissues related to Dysplastic Nevus Syndrome:

40
Skin, Pancreas, Testes, Eye, Lymph Node, Thymus, Ovary

Publications for Dysplastic Nevus Syndrome

Articles related to Dysplastic Nevus Syndrome:

(show top 50) (show all 258)
# Title Authors PMID Year
1
Risk of developing pancreatic cancer in families with familial atypical multiple mole melanoma associated with a specific 19 deletion of p16 (p16-Leiden). 6 54
10956390 2000
2
A locus linked to p16 modifies melanoma risk in Dutch familial atypical multiple mole melanoma (FAMMM) syndrome families. 54 6
10400925 1999
3
Homozygotes for CDKN2 (p16) germline mutation in Dutch familial melanoma kindreds. 6 54
7670475 1995
4
ACG clinical guideline: Genetic testing and management of hereditary gastrointestinal cancer syndromes. 6
25645574 2015
5
Indication for CDKN2A-mutation analysis in familial pancreatic cancer families without melanomas. 6
22636603 2012
6
Predicting functional significance of cancer-associated p16(INK4a) mutations in CDKN2A. 6
20340136 2010
7
Hereditary p16-Leiden mutation in a patient with multiple head and neck tumors. 6
12549483 2003
8
High prevalence of the G101W germline mutation in the CDKN2A (P16(ink4a)) gene in 62 Italian malignant melanoma families. 6
11807902 2002
9
Sporadic multiple primary melanoma cases: CDKN2A germline mutations with a founder effect. 6
11579459 2001
10
A single genetic origin for the G101W CDKN2A mutation in 20 melanoma-prone families. 6
10869234 2000
11
Familial melanoma and pancreatic cancer. Ligurian Skin Tumor Study Group. 6
8552158 1996
12
Brief report: a familial syndrome of pancreatic cancer and melanoma with a mutation in the CDKN2 tumor-suppressor gene. 6
7666917 1995
13
Germline p16 mutations in familial melanoma. 6
7987387 1994
14
Frequent somatic mutation of the MTS1/CDK4I (multiple tumor suppressor/cyclin-dependent kinase 4 inhibitor) gene in esophageal squamous cell carcinoma. 6
8012957 1994
15
Familial atypical multiple mole melanoma (FAMMM) syndrome: history, genetics, and heterogeneity. 52
26892865 2016
16
Analysis of the p16 gene status of non-familial dysplastic nevus syndrome patients. 61 54
11820732 2001
17
Screening of germline mutations in the CDK4, CDKN2C and TP53 genes in familial melanoma: a clinic-based population study. 54 61
9724087 1998
18
Inherited susceptibility to several cancers but absence of linkage between dysplastic nevus syndrome and CDKN2A in a melanoma family with a mutation in the CDKN2A (P16INK4A) gene. 54 61
9439668 1997
19
Screening of germline mutations in the CDKN2A and CDKN2B genes in Swedish families with hereditary cutaneous melanoma. 61 54
9168184 1997
20
Cluster of pregnancy-associated melanoma: A case report and brief update. 61
32557800 2020
21
Neurofibromatosis type 1 and melanoma of the iris arising from a dysplastic nevus: A rare yet casual association? 61
32064917 2020
22
Malignant transformation of choroidal nevus according to race in 3334 consecutive patients. 61
31755445 2019
23
Skin Cancer: Precancers. 61
31188549 2019
24
Simultaneous long-lasting regression of multiple nevi and melanoma metastases after ipilimumab therapy. 61
31026247 2019
25
Innovations and Innovative Approaches or Pseudo-Innovations in the Context of General Globalization? It's Time to Wake Up! 61
29483969 2018
26
Genomic Characterization of Dysplastic Nevi Unveils Implications for Diagnosis of Melanoma. 61
27890785 2017
27
"Melanoma: Questions and Answers." Development and evaluation of a psycho-educational resource for people with a history of melanoma. 61
27465047 2016
28
Erythematous-violaceous macule on the chest in a patient with dysplastic nevus syndrome. 61
27444088 2016
29
Knowledge about Ultraviolet Radiation Hazards and Tanning Behavior of Cosmetology and Medical Students. 61
27149135 2016
30
Germline CDKN2A mutations in childhood melanoma: a case of melanoma-pancreatic cancer syndrome. 61
26381259 2015
31
Multiple Cutaneous Melanomas and Clinically Atypical Moles in a Patient With a Novel Germline BAP1 Mutation. 61
26154183 2015
32
Immunosuppression is an independent prognostic factor associated with aggressive tumor behavior in cutaneous melanoma. 61
26209220 2015
33
Characterization, treatment, and outcome of uveal melanoma in the first two years of life. 61
25300563 2015
34
Detection of primary melanoma in individuals at extreme high risk: a prospective 5-year follow-up study. 61
24964862 2014
35
Four cases of dysplastic nevus syndrome. 61
25143698 2014
36
Primary uveal melanoma in a 4-year-old black child. 61
24160981 2013
37
On the clinical significance of cutaneous melanoma's precursors. 61
23130279 2012
38
Primary gallbladder melanoma in dysplastic nevus syndrome: report of case and literature review. 61
22287410 2011
39
Melanocyte-specific immune response in a patient with multiple regressing nevi and a history of melanoma. 61
22110189 2011
40
Epidemiology of melanoma. 61
21277533 2010
41
Morphologic features and natural history of scalp nevi in children. 61
20479298 2010
42
Childhood melanoma. 61
19880040 2009
43
Atypical familial presentation of FAMMM syndrome with a high incidence of pancreatic cancer: case finding of asymptomatic individuals by EUS surveillance. 54
19417680 2009
44
Dysplastic nevus syndrome with development of multiple melanomas. A surgical concept for prophylaxis. 61
19456853 2009
45
Novel presentation of a familial pancreatic cancer syndrome. 61
19089513 2009
46
Nevi and melanoma in the pregnant woman. 61
19095157 2009
47
Neurofibromatosis type 1 associated with dysplastic nevus syndrome. 61
19595268 2009
48
Undifferentiated carcinoma with osteoclastic giant cells (UCOCGC) of the pancreas associated with the familial atypical multiple mole melanoma syndrome (FAMMM). 54
18813118 2008
49
Predicting the risk of pancreatic cancer: on CDKN2A mutations in the melanoma-pancreatic cancer syndrome in Italy. 61
18024887 2007
50
Monitoring of kindreds with hereditary predisposition for cutaneous melanoma and dysplastic nevus syndrome: results of a Swedish preventive program. 61
17602087 2007

Variations for Dysplastic Nevus Syndrome

ClinVar genetic disease variations for Dysplastic Nevus Syndrome:

6 (show top 50) (show all 86) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 CDKN2A NM_058197.4(CDKN2A):c.*149_*167deldeletion Pathogenic,risk factor 9410 rs587776716 9:21971114-21971132 9:21971115-21971133
2 CDKN2A CDKN2A, 5-BP DUP, NT19duplication Pathogenic 37003
3 CDKN2A NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp)SNV Pathogenic 9420 rs104894098 9:21970981-21970981 9:21970982-21970982
4 CDKN2A NM_058197.4(CDKN2A):c.*163_*176deldeletion Pathogenic 182412 rs730881675 9:21971105-21971118 9:21971106-21971119
5 CDKN2A NM_000077.4(CDKN2A):c.-34G>TSNV Pathogenic 182414 rs1800586 9:21974860-21974860 9:21974861-21974861
6 CDKN2A NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly)SNV Pathogenic/Likely pathogenic 9423 rs104894099 9:21971182-21971182 9:21971183-21971183
7 CDKN2A NM_000077.4(CDKN2A):c.457G>T (p.Asp153Tyr)SNV Pathogenic/Likely pathogenic 216035 rs45476696 9:21970901-21970901 9:21970902-21970902
8 CDKN2A NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro)SNV Pathogenic/Likely pathogenic 9415 rs104894097 9:21974756-21974756 9:21974757-21974757
9 CDKN2A NM_000077.4(CDKN2A):c.259C>T (p.Arg87Trp)SNV Likely pathogenic 406707 rs749714198 9:21971099-21971099 9:21971100-21971100
10 CDKN2A NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp)SNV Conflicting interpretations of pathogenicity 9412 rs104894094 9:21971057-21971057 9:21971058-21971058
11 CDKN2A NM_000077.4(CDKN2A):c.150+37G>CSNV Conflicting interpretations of pathogenicity 41573 rs45456595 9:21974640-21974640 9:21974641-21974641
12 CDKN2A NM_000077.4(CDKN2A):c.373G>C (p.Asp125His)SNV Conflicting interpretations of pathogenicity 41577 rs146179135 9:21970985-21970985 9:21970986-21970986
13 CDKN2A NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr)SNV Conflicting interpretations of pathogenicity 127523 rs199907548 9:21974681-21974681 9:21974682-21974682
14 CDKN2A NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser)SNV Conflicting interpretations of pathogenicity 127524 rs200863613 9:21971060-21971060 9:21971061-21971061
15 CDKN2A NM_000077.4(CDKN2A):c.369T>A (p.His123Gln)SNV Conflicting interpretations of pathogenicity 127526 rs6413463 9:21970989-21970989 9:21970990-21970990
16 CDKN2A NM_000077.4(CDKN2A):c.-14C>TSNV Conflicting interpretations of pathogenicity 221032 rs764244718 9:21974840-21974840 9:21974841-21974841
17 CDKN2A NM_000077.4(CDKN2A):c.370C>T (p.Arg124Cys)SNV Conflicting interpretations of pathogenicity 231362 rs34170727 9:21970988-21970988 9:21970989-21970989
18 CDKN2A NM_000077.4(CDKN2A):c.250G>A (p.Asp84Asn)SNV Conflicting interpretations of pathogenicity 229806 rs11552822 9:21971108-21971108 9:21971109-21971109
19 CDKN2A NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val)SNV Conflicting interpretations of pathogenicity 220562 rs372266620 9:21971188-21971188 9:21971189-21971189
20 CDKN2A NM_000077.4(CDKN2A):c.197A>G (p.His66Arg)SNV Conflicting interpretations of pathogenicity 246117 rs756750256 9:21971161-21971161 9:21971162-21971162
21 CDKN2A NM_000077.4(CDKN2A):c.-34G>CSNV Conflicting interpretations of pathogenicity 245907 rs1800586 9:21974860-21974860 9:21974861-21974861
22 CDKN2A NM_000077.4(CDKN2A):c.-19413C>GSNV Conflicting interpretations of pathogenicity 265298 rs528789830 9:21994239-21994239 9:21994240-21994240
23 CDKN2A NM_000077.4(CDKN2A):c.273G>A (p.Leu91=)SNV Conflicting interpretations of pathogenicity 133882 rs4987127 9:21971085-21971085 9:21971086-21971086
24 CDKN2A NM_000077.4(CDKN2A):c.318G>A (p.Val106=)SNV Conflicting interpretations of pathogenicity 135826 rs199888003 9:21971040-21971040 9:21971041-21971041
25 CDKN2A NM_000077.4(CDKN2A):c.151-4G>CSNV Conflicting interpretations of pathogenicity 141600 rs529380972 9:21971211-21971211 9:21971212-21971212
26 CDKN2A NM_000077.4(CDKN2A):c.365G>T (p.Gly122Val)SNV Uncertain significance 182419 rs373291490 9:21970993-21970993 9:21970994-21970994
27 CDKN2A NM_000077.4(CDKN2A):c.122C>A (p.Pro41Gln)SNV Uncertain significance 141111 rs373407950 9:21974705-21974705 9:21974706-21974706
28 CDKN2A NM_000077.4(CDKN2A):c.-19492T>ASNV Uncertain significance 245816 rs776987532 9:21994318-21994318 9:21994319-21994319
29 CDKN2A NM_000077.4(CDKN2A):c.150+1104C>ASNV Uncertain significance 220864 rs756102261 9:21973573-21973573 9:21973574-21973574
30 CDKN2A NM_000077.4(CDKN2A):c.427G>A (p.Ala143Thr)SNV Uncertain significance 245681 rs754195015 9:21970931-21970931 9:21970932-21970932
31 CDKN2A NM_000077.4(CDKN2A):c.415G>C (p.Gly139Arg)SNV Uncertain significance 216276 rs587781733 9:21970943-21970943 9:21970944-21970944
32 CDKN2A NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del)short repeat Uncertain significance 216277 rs587780668 9:21974795-21974818 9:21974796-21974819
33 CDKN2A NM_058195.3(CDKN2A):c.358C>A (p.Arg120Ser)SNV Uncertain significance 406702 rs763269347 9:21971043-21971043 9:21971044-21971044
34 CDKN2A NM_058195.3(CDKN2A):c.43T>C (p.Cys15Arg)SNV Uncertain significance 548785 rs1554659236 9:21994288-21994288 9:21994289-21994289
35 CDKN2A NM_000077.4(CDKN2A):c.150+82A>GSNV Uncertain significance 584731 rs1231900408 9:21974595-21974595 9:21974596-21974596
36 CDKN2A NM_058195.3(CDKN2A):c.194-3588C>TSNV Uncertain significance 584734 rs1374664673 9:21974795-21974795 9:21974796-21974796
37 CDKN2A NM_000077.4(CDKN2A):c.301G>A (p.Gly101Arg)SNV Uncertain significance 463494 rs104894094 9:21971057-21971057 9:21971058-21971058
38 CDKN2A NM_058195.3(CDKN2A):c.203A>C (p.Asp68Ala)SNV Uncertain significance 463486 rs201314211 9:21971198-21971198 9:21971199-21971199
39 CDKN2A NM_058195.3(CDKN2A):c.167G>A (p.Gly56Glu)SNV Uncertain significance 463514 rs748327367 9:21994164-21994164 9:21994165-21994165
40 CDKN2A NM_000077.4(CDKN2A):c.331G>A (p.Gly111Ser)SNV Uncertain significance 463499 rs778971134 9:21971027-21971027 9:21971028-21971028
41 CDKN2A NM_000077.4(CDKN2A):c.26T>C (p.Met9Thr)SNV Uncertain significance 483319 rs145445140 9:21974801-21974801 9:21974802-21974802
42 CDKN2A NM_058197.4(CDKN2A):c.*256C>TSNV Uncertain significance 802462 9:21971025-21971025 9:21971026-21971026
43 CDKN2A NM_058197.4(CDKN2A):c.*144A>CSNV Uncertain significance 802463 9:21971137-21971137 9:21971138-21971138
44 CDKN2A NM_058197.4(CDKN2A):c.*143G>CSNV Uncertain significance 802464 9:21971138-21971138 9:21971139-21971139
45 CDKN2A NM_058195.3(CDKN2A):c.79A>C (p.Ile27Leu)SNV Uncertain significance 371881 rs1057517575 9:21994252-21994252 9:21994253-21994253
46 CDKN2A NM_058195.3(CDKN2A):c.69C>A (p.Phe23Leu)SNV Uncertain significance 372023 rs374360796 9:21994262-21994262 9:21994263-21994263
47 CDKN2A NM_058195.3(CDKN2A):c.62G>A (p.Arg21Lys)SNV Uncertain significance 371974 rs1057517601 9:21994269-21994269 9:21994270-21994270
48 CDKN2A NM_058195.3(CDKN2A):c.-33G>ASNV Uncertain significance 372077 rs1057517639 9:21994363-21994363 9:21994364-21994364
49 CDKN2A NM_000077.4(CDKN2A):c.295C>G (p.Arg99Gly)SNV Uncertain significance 372062 rs34886500 9:21971063-21971063 9:21971064-21971064
50 CDKN2A NM_000077.4(CDKN2A):c.-34G>ASNV Likely benign 379882 rs1800586 9:21974860-21974860 9:21974861-21974861

Expression for Dysplastic Nevus Syndrome

Search GEO for disease gene expression data for Dysplastic Nevus Syndrome.

Pathways for Dysplastic Nevus Syndrome

Pathways related to Dysplastic Nevus Syndrome according to GeneCards Suite gene sharing:

(show all 22)
# Super pathways Score Top Affiliating Genes
1
Show member pathways
13.04 PMS2 PALB2 MSH6 MSH2 MLH1 BRCA2
2
Show member pathways
12.82 STK11 PMS2 MSH2 MLH1 CDKN2A BRCA1
3
Show member pathways
12.75 MSH6 MSH2 MLH1 BRCA2 BRCA1 ATM
4
Show member pathways
12.71 MSH6 MSH2 MLH1 CDKN2A BRCA2
5 12.68 MSH6 MSH2 MLH1 CDKN2A BRCA2
6
Show member pathways
12.54 MSH6 MSH2 BRCA2 BRCA1 ATM
7
Show member pathways
12.52 MSH6 CDKN2A BRCA2 BRCA1 ATM
8 12.38 MIR200A CDKN2A BRCA1 ATM
9
Show member pathways
12.34 MLH1 BRCA2 BRCA1 ATM
10
Show member pathways
12.15 PALB2 BRCA2 BRCA1 ATM
11
Show member pathways
11.99 PALB2 BRCA2 BRCA1 ATM
12 11.97 MSH6 MSH2 MLH1 CDKN2A BRCA2 BRCA1
13 11.9 PMS2 MSH2 MLH1
14 11.82 STK11 MSH6 MSH2 BRCA2 BRCA1 ATM
15
Show member pathways
11.76 PMS2 MSH6 MSH2 MLH1
16 11.69 PMS2 PALB2 MLH1 BRCA2 BRCA1
17
Show member pathways
11.57 MSH6 MSH2 BRCA2 BRCA1 ATM
18 11.37 MSH6 MSH2 BRCA1 ATM
19 11.13 PMS2 MSH6 MSH2 MLH1
20 10.96 MSH6 MSH2 MLH1 CDKN2A BRCA1 ATM
21
Show member pathways
10.95 CDKN2A ATM
22 10.87 BRCA1 ATM

GO Terms for Dysplastic Nevus Syndrome

Cellular components related to Dysplastic Nevus Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 nucleoplasm GO:0005654 9.85 STK11 PMS2 PALB2 MSH6 MSH2 MLH1
2 nuclear chromosome, telomeric region GO:0000784 9.54 MSH2 BRCA2 ATM
3 lateral element GO:0000800 9.32 BRCA2 BRCA1
4 MutLalpha complex GO:0032389 9.26 PMS2 MLH1
5 MutSalpha complex GO:0032301 8.96 MSH6 MSH2
6 mismatch repair complex GO:0032300 8.92 PMS2 MSH6 MSH2 MLH1

Biological processes related to Dysplastic Nevus Syndrome according to GeneCards Suite gene sharing:

(show all 34)
# Name GO ID Score Top Affiliating Genes
1 cell cycle GO:0007049 10 STK11 MLH1 CDKN2A BRCA2 BRCA1 ATM
2 regulation of signal transduction by p53 class mediator GO:1901796 9.82 STK11 BRCA1 ATM
3 cell cycle arrest GO:0007050 9.81 STK11 MSH2 CDKN2A ATM
4 DNA recombination GO:0006310 9.78 PALB2 MSH2 BRCA2 BRCA1
5 double-strand break repair via nonhomologous end joining GO:0006303 9.77 MLH1 BRCA1 ATM
6 double-strand break repair GO:0006302 9.76 MSH2 BRCA2 BRCA1
7 DNA repair GO:0006281 9.76 PMS2 PALB2 MSH6 MSH2 MLH1 BRCA2
8 double-strand break repair via homologous recombination GO:0000724 9.73 PALB2 BRCA2 BRCA1 ATM
9 response to ionizing radiation GO:0010212 9.71 STK11 BRCA1 ATM
10 mismatch repair GO:0006298 9.67 PMS2 MSH6 MSH2 MLH1
11 male meiotic nuclear division GO:0007140 9.66 MLH1 ATM
12 female gonad development GO:0008585 9.66 BRCA2 ATM
13 response to X-ray GO:0010165 9.65 MSH2 BRCA2
14 negative regulation of TORC1 signaling GO:1904262 9.65 STK11 ATM
15 negative regulation of B cell proliferation GO:0030889 9.64 CDKN2A ATM
16 negative regulation of DNA recombination GO:0045910 9.64 MSH6 MSH2
17 DNA double-strand break processing GO:0000729 9.63 BRCA1 ATM
18 DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator GO:0006978 9.63 BRCA2 BRCA1
19 determination of adult lifespan GO:0008340 9.63 MSH6 MSH2 ATM
20 inner cell mass cell proliferation GO:0001833 9.62 PALB2 BRCA2
21 replicative senescence GO:0090399 9.62 CDKN2A ATM
22 postreplication repair GO:0006301 9.61 MSH2 BRCA1
23 positive regulation of isotype switching to IgG isotypes GO:0048304 9.61 MSH2 MLH1
24 cellular response to DNA damage stimulus GO:0006974 9.61 STK11 PMS2 PALB2 MSH6 MSH2 MLH1
25 meiotic telomere clustering GO:0045141 9.6 MLH1 ATM
26 positive regulation of helicase activity GO:0051096 9.58 MSH6 MSH2
27 isotype switching GO:0045190 9.58 MSH6 MSH2 MLH1
28 positive regulation of isotype switching to IgA isotypes GO:0048298 9.57 MSH2 MLH1
29 maintenance of DNA repeat elements GO:0043570 9.56 MSH6 MSH2
30 somatic hypermutation of immunoglobulin genes GO:0016446 9.56 PMS2 MSH6 MSH2 MLH1
31 chordate embryonic development GO:0043009 9.55 BRCA2 BRCA1
32 somatic recombination of immunoglobulin gene segments GO:0016447 9.5 MSH6 MSH2 MLH1
33 somatic recombination of immunoglobulin genes involved in immune response GO:0002204 9.49 MSH2 MLH1
34 intrinsic apoptotic signaling pathway in response to DNA damage GO:0008630 9.1 MSH6 MSH2 MLH1 BRCA2 BRCA1 ATM

Molecular functions related to Dysplastic Nevus Syndrome according to GeneCards Suite gene sharing:

(show all 13)
# Name GO ID Score Top Affiliating Genes
1 DNA binding GO:0003677 10.1 PMS2 PALB2 MSH6 MSH2 CDKN2A BRCA2
2 enzyme binding GO:0019899 9.83 MSH6 MSH2 MLH1 BRCA1
3 ATPase activity GO:0016887 9.78 PMS2 MSH6 MSH2 MLH1
4 damaged DNA binding GO:0003684 9.54 MSH6 MSH2 BRCA1
5 four-way junction DNA binding GO:0000400 9.51 MSH6 MSH2
6 MutSalpha complex binding GO:0032407 9.46 PMS2 MLH1
7 single-stranded DNA binding GO:0003697 9.46 PMS2 MSH2 MLH1 BRCA2
8 MutLalpha complex binding GO:0032405 9.43 MSH6 MSH2
9 oxidized purine DNA binding GO:0032357 9.4 MSH6 MSH2
10 single guanine insertion binding GO:0032142 9.32 MSH6 MSH2
11 single thymine insertion binding GO:0032143 9.26 MSH6 MSH2
12 guanine/thymine mispair binding GO:0032137 9.13 MSH6 MSH2 MLH1
13 mismatched DNA binding GO:0030983 8.92 PMS2 MSH6 MSH2 MLH1

Sources for Dysplastic Nevus Syndrome

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....