GSD
MCID: GRS011
MIFTS: 55

Gerstmann-Straussler Disease (GSD)

Categories: Genetic diseases, Mental diseases, Neuronal diseases, Rare diseases

Aliases & Classifications for Gerstmann-Straussler Disease

MalaCards integrated aliases for Gerstmann-Straussler Disease:

Name: Gerstmann-Straussler Disease 56 73 13 39
Gerstmann-Straussler-Scheinker Disease 56 12 52 53 73 54 43 71
Gerstmann-Straussler-Scheinker Syndrome 12 74 52 58 29 6 15
Cerebral Amyloid Angiopathy, Prnp-Related 56 29 6
Prion Dementia 56 12 73
Cerebellar Ataxia, Progressive Dementia, and Amyloid Deposits in Cns 56 73
Subacute Spongiform Encephalopathy, Gerstmann-Straussler Type 52 58
Amyloidosis, Cerebral, with Spongiform Encephalopathy 56 71
Gsd 56 73
Gss 56 73
Cerebellar Ataxia, Progressive Dementia, and Amyloid Deposits in the Central Nervous System 52
Encephalopathy, Subacute Spongiform, Gerstmann-Straussler Type 56
Encephalopathy Subacute Spongiform Gerstmann-Straussler Type 52
Subacute Spongiform Encephalopathy Gerstmann-Straussler Type 73
Amyloidosis Cerebral with Spongiform Encephalopathy 52
Cerebral Amyloidosis with Spongiform Encephalopathy 73
Gerstmann-Straussler-Scheinker Disease; Gss 56
Gerstmann Straussler Scheinker Syndrome 52
Gluthathione Synthetase Deficiency 71
Gssd 52

Characteristics:

Orphanet epidemiological data:

58
gerstmann-straussler-scheinker syndrome
Inheritance: Autosomal dominant,Not applicable; Age of onset: Adult;

OMIM:

56
Inheritance:
autosomal dominant

Miscellaneous:
variable phenotype
adult onset, usually 30's to 40's, but up to early 60's
rapidly progressive, but slower than creutzfeldt-jakob disease
average disease duration of 7 years
longer disease duration than creutzfeldt-jakob disease


HPO:

31
gerstmann-straussler disease:
Inheritance autosomal dominant inheritance
Onset and clinical course adult onset rapidly progressive


Classifications:

Orphanet: 58  
Rare neurological diseases


External Ids:

Disease Ontology 12 DOID:4249
OMIM 56 137440
ICD9CM 34 046.71
MeSH 43 D016098
NCIt 49 C84727
SNOMED-CT 67 67155006
ICD10 32 A81.82
MESH via Orphanet 44 D016098
ICD10 via Orphanet 33 A81.8
UMLS via Orphanet 72 C0017495
Orphanet 58 ORPHA356
MedGen 41 C0017495
UMLS 71 C0017495 C0398746 C2931022

Summaries for Gerstmann-Straussler Disease

OMIM : 56 Gerstmann-Straussler disease is a rare inherited prion disease characterized by adult onset of memory loss, dementia, ataxia, and pathologic deposition of amyloid-like plaques in the brain (Gerstmann et al., 1936). Gerstmann-Straussler disease typically presents with progressive limb and truncal ataxia, dysarthria, and cognitive decline in the thirties and forties, and the average disease duration is 7 years. GSD can be distinguished from CJD by earlier age at onset, longer disease duration, and prominent cerebellar ataxia (Masters et al., 1981). On the basis of clinical and pathologic criteria, Hsiao et al. (1989) suggested that Gerstmann-Straussler syndrome could be classified into 3 forms: an 'ataxic' form, a 'dementing' form, and a dementing form that is accompanied by pathologic quantities of neurofibrillary tangles (NFTs). However, these distinctions may only underscore the phenotypic variability in presentation and progression of the disease (Panegyres et al., 2001). PRNP-related amyloid angiopathy is usually not a feature of CJD, GSD, or FFI. However, PRNP-immunoreactive amyloid deposits within the walls of cerebral vessels have been observed in patients with truncating mutations in the PRNP gene. Data suggest that C-terminal-truncated PRNP proteins lacking the glycosylphosphatidylinositol (GPI) anchor required to attach the protein to the plasma membrane may readily form amyloid fibrils that result in cerebrovascular amyloid deposition (summary by Revesz et al., 2009). (137440)

MalaCards based summary : Gerstmann-Straussler Disease, also known as gerstmann-straussler-scheinker disease, is related to gerstmann syndrome and alzheimer disease 4, and has symptoms including tremor, myoclonus and gait ataxia. An important gene associated with Gerstmann-Straussler Disease is PRNP (Prion Protein), and among its related pathways/superpathways are Neuroscience and A-beta Signaling Pathways. Affiliated tissues include brain, cerebellum and eye, and related phenotypes are spasticity and hyperreflexia

Disease Ontology : 12 A prion disease characterized by adult onset of memory loss, dementia, ataxia, and pathologic deposition of amyloid-like plaques in the brain.

NIH Rare Diseases : 52 Gerstmann-Straussler-Scheinker disease (GSS) is a type of prion disease . Prion diseases are a group of conditions that affect the nervous system. The main feature of GSS is a progressive degeneration of the cerebellum (a part of the brain that controls coordination, balance, equilibrium and muscle tone ), as well as different degrees of dementia . Signs and symptoms generally develop between ages 35 and 50 years and may include weakness in the legs, poor reflexes, abnormal sensations, progressive ataxia , cognitive dysfunction, slurred speech, and spasticity . On average, people affected by GSS survive approximately 60 months (range 2 to 10 years) following diagnosis. It is caused by changes (mutations ) in the PRNP gene and inheritance is autosomal dominant . Treatment is based on the signs and symptoms present in each person. For information on other prion diseases, please visit GARD's Creutzfeldt-Jakob disease and fatal familial insomnia pages.

NINDS : 53 Gerstmann-Straussler-Scheinker disease (GSS) is an extremely rare, neurodegenerative brain disorder. It is almost always inherited and is found in only a few families around the world. Onset of the disease usually occurs between the ages of 35 and 55. In the early stages, patients may experience varying levels of ataxia (lack of muscle coordination), including clumsiness, unsteadiness, and difficulty walking. As the disease progresses, the ataxia becomes more pronounced and most patients develop dementia. Other symptoms may include dysarthria (slurring of speech), nystagmus (involuntary movements of the eyes), spasticity (rigid muscle tone), and visual disturbances, sometimes leading to blindness. Deafness also can occur. In some families, parkinsonian features are present. GSS belongs to a family of human and animal diseases known as the transmissible spongiform encephalopathies (TSEs). Other TSEs include Creutzfeldt-Jakob disease, kuru, and fatal familial insomnia.

UniProtKB/Swiss-Prot : 73 Gerstmann-Straussler disease: A rare inherited prion disease characterized by adult onset of memory loss, dementia, ataxia, and pathologic deposition of amyloid-like plaques in the brain. GSD presents with progressive limb and truncal ataxia, dysarthria, and cognitive decline in the thirties and forties, and the average disease duration is 7 years.

Wikipedia : 74 Gerstmann-Straussler-Scheinker syndrome (GSS) is an extremely rare, usually familial, fatal... more...

Related Diseases for Gerstmann-Straussler Disease

Diseases related to Gerstmann-Straussler Disease via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 199)
# Related Disease Score Top Affiliating Genes
1 gerstmann syndrome 32.9 PSEN2 PSEN1 PRNP MAPT
2 alzheimer disease 4 32.0 PSEN2 PSEN1 MAPT GSS
3 multiple system atrophy 1 30.1 SNCA PRNP MAPT HTT
4 creutzfeldt-jakob disease 30.1 SPRN SNCA PRNT PRNP PRND MSMB
5 fatal familial insomnia 30.1 SPRN PRNP PRND MSMB MIRLET7I MAPT
6 amyloidosis 29.9 SNCA PSEN1 PRNP MAPT APP
7 aceruloplasminemia 29.9 SNCA PSEN1 PRNP MAPT HTT APP
8 frontotemporal dementia 29.9 TARDBP SNCA PSEN2 PSEN1 PRNP MAPT
9 prion disease 29.9 TARDBP SPRN SNCA SCN2A PSEN2 PSEN1
10 scrapie 29.8 SPRN SCN2A PRNP PRND MSMB MIRLET7I
11 dementia 29.5 TARDBP SNCA PSEN2 PSEN1 PRNP MAPT
12 kuru 29.0 SPRN SCN2A PRNP PRND MSMB MAPT
13 alzheimer disease 28.5 TARDBP SNCA PSEN2 PSEN1 PRNP PRND
14 glycogen storage disease iv 12.5
15 glycogen storage disease iii 12.3
16 glycogen storage disease ia 12.3
17 glycogen storage disease vi 12.2
18 phosphorylase kinase deficiency 12.2
19 glycogen storage disease vii 12.2
20 glycogen storage disease 12.1
21 glycogen storage disease type 0 12.0
22 glycogen storage disease v 12.0
23 glycogen storage disease ib 12.0
24 glycogen storage disease ic 12.0
25 glycogen storage disease 0, liver 12.0
26 fanconi-bickel syndrome 11.9
27 glycogen storage disease x 11.9
28 glycogen storage disease ixa1 11.9
29 glycogen storage disease xii 11.9
30 glycogen storage disease xv 11.9
31 hemolytic anemia 11.9
32 glutathione synthetase deficiency of erythrocytes, hemolytic anemia due to 11.9
33 glycogen storage disease xiii 11.8
34 glycogen storage disease ii 11.8
35 congenital disorder of glycosylation, type it 11.8
36 metabolic acidosis 11.7
37 glycogen storage disease due to liver phosphorylase kinase deficiency 11.7
38 glycogen storage disease ixc 11.7
39 glycogen storage disease due to glucose-6-phosphatase deficiency 11.6
40 glycogen storage disease due to glycogen branching enzyme deficiency 11.6
41 glycogen storage disease, type ixd 11.6
42 glycogen storage disease ixb 11.5
43 granulomatous slack skin disease 11.5
44 cataract 11.4
45 glycogen storage disease due to glucose-6-phosphatase deficiency type ib 11.4
46 muscular phosphorylase kinase deficiency 11.4
47 5-oxoprolinase deficiency 11.4
48 glycogen storage disease of heart, lethal congenital 11.3
49 danon disease 11.3
50 glycogen storage disease 0, muscle 11.3

Graphical network of the top 20 diseases related to Gerstmann-Straussler Disease:



Diseases related to Gerstmann-Straussler Disease

Symptoms & Phenotypes for Gerstmann-Straussler Disease

Human phenotypes related to Gerstmann-Straussler Disease:

31 (show all 26)
# Description HPO Frequency HPO Source Accession
1 spasticity 31 HP:0001257
2 hyperreflexia 31 HP:0001347
3 emotional lability 31 HP:0000712
4 depressivity 31 HP:0000716
5 dysarthria 31 HP:0001260
6 tremor 31 HP:0001337
7 myoclonus 31 HP:0001336
8 areflexia 31 HP:0001284
9 weight loss 31 HP:0001824
10 memory impairment 31 HP:0002354
11 gait ataxia 31 HP:0002066
12 limb ataxia 31 HP:0002070
13 rigidity 31 HP:0002063
14 psychosis 31 HP:0000709
15 aggressive behavior 31 HP:0000718
16 apraxia 31 HP:0002186
17 dementia 31 HP:0000726
18 truncal ataxia 31 HP:0002078
19 cerebellar atrophy 31 HP:0001272
20 bradykinesia 31 HP:0002067
21 lower limb muscle weakness 31 HP:0007340
22 parkinsonism 31 HP:0001300
23 neurofibrillary tangles 31 HP:0002185
24 personality changes 31 HP:0000751
25 impaired smooth pursuit 31 HP:0007772
26 perseveration 31 HP:0030223

Symptoms via clinical synopsis from OMIM:

56
Neurologic Central Nervous System:
spasticity
hyperreflexia
dysarthria
tremor
myoclonus
more
Head And Neck Eyes:
impaired smooth pursuit

Neurologic Peripheral Nervous System:
dysesthesias of the lower limbs
loss of deep tendon reflexes

Neurologic Behavioral Psychiatric Manifestations:
emotional lability
psychosis
aggressive behavior
personality changes
depression

Growth Weight:
rapid weight loss late in the disease

Clinical features from OMIM:

137440

UMLS symptoms related to Gerstmann-Straussler Disease:


tremor, myoclonus, gait ataxia, bradykinesia, personality changes, memory loss, muscle rigidity, muscle spasticity, cerebellar ataxia, ataxia, truncal

MGI Mouse Phenotypes related to Gerstmann-Straussler Disease:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 behavior/neurological MP:0005386 9.9 APP HTT MAPT PRND PRNP PSEN1
2 integument MP:0010771 9.61 APP HTT MAPT MGRN1 MSMB PRNP
3 nervous system MP:0003631 9.44 APP HTT MAPT MGRN1 PRND PRNP

Drugs & Therapeutics for Gerstmann-Straussler Disease

Search Clinical Trials , NIH Clinical Center for Gerstmann-Straussler Disease

Cochrane evidence based reviews: gerstmann-straussler-scheinker disease

Genetic Tests for Gerstmann-Straussler Disease

Genetic tests related to Gerstmann-Straussler Disease:

# Genetic test Affiliating Genes
1 Gerstmann-Straussler-Scheinker Syndrome 29 PRNP
2 Cerebral Amyloid Angiopathy, Prnp-Related 29

Anatomical Context for Gerstmann-Straussler Disease

MalaCards organs/tissues related to Gerstmann-Straussler Disease:

40
Brain, Cerebellum, Eye, Liver, Heart, Bone, Skin

Publications for Gerstmann-Straussler Disease

Articles related to Gerstmann-Straussler Disease:

(show top 50) (show all 141)
# Title Authors PMID Year
1
A new PRNP mutation (G131V) associated with Gerstmann-Sträussler-Scheinker disease. 54 56 6
11709001 2001
2
Mutant prion proteins in Gerstmann-Sträussler-Scheinker disease with neurofibrillary tangles. 54 56 6
1363810 1992
3
Substitutions at residue 211 in the prion protein drive a switch between CJD and GSS syndrome, a new mechanism governing inherited neurodegenerative disorders. 56 6
22965875 2012
4
Familial prion disease with Alzheimer disease-like tau pathology and clinical phenotype. 56 6
21416485 2011
5
Prion protein amyloidosis with divergent phenotype associated with two novel nonsense mutations in PRNP. 56 6
19911184 2010
6
Genetics and molecular pathogenesis of sporadic and hereditary cerebral amyloid angiopathies. 56 6
19225789 2009
7
Novel prion protein gene mutation presenting with subacute PSP-like syndrome. 56 6
17353478 2007
8
Vascular variant of prion protein cerebral amyloidosis with tau-positive neurofibrillary tangles: the phenotype of the stop codon 145 mutation in PRNP. 56 6
8570627 1996
9
Linkage of the Indiana kindred of Gerstmann-Sträussler-Scheinker disease to the prion protein gene. 56 6
1363809 1992
10
Prion protein mutation in family first reported by Gerstmann, Sträussler, and Scheinker. 56 6
1674033 1991
11
Gerstmann-Sträussler-Scheinker disease. I. Extending the clinical spectrum. 56 6
2812321 1989
12
Linkage of a prion protein missense variant to Gerstmann-Sträussler syndrome. 56 6
2564168 1989
13
Early abnormality of diffusion-weighted magnetic resonance imaging followed by brain atrophy in a case of Gerstmann-Straussler-Scheinker disease. 61 56
17353395 2007
14
Disease-associated F198S mutation increases the propensity of the recombinant prion protein for conformational conversion to scrapie-like form. 61 6
12372829 2002
15
Cell surface accumulation of a truncated transmembrane prion protein in Gerstmann-Straussler-Scheinker disease P102L. 61 6
11967261 2002
16
Accumulation of protease-resistant prion protein (PrP) and apoptosis of cerebellar granule cells in transgenic mice expressing a PrP insertional mutation. 54 6
10805813 2000
17
Neurological illness in transgenic mice expressing a prion protein with an insertional mutation. 54 6
9883727 1998
18
Different patterns of truncated prion protein fragments correlate with distinct phenotypes in P102L Gerstmann-Sträussler-Scheinker disease. 54 6
9653185 1998
19
A prion disease with a novel 96-base pair insertional mutation in the prion protein gene. 61 6
8618679 1996
20
A Drosophila model of GSS syndrome suggests defects in active zones are responsible for pathogenesis of GSS syndrome. 56
20829230 2010
21
A novel PRNP-P105S mutation associated with atypical prion disease and a rare PrPSc conformation. 6
18955686 2008
22
Early clinical signs and imaging findings in Gerstmann-Sträussler-Scheinker syndrome (Pro102Leu). 56
16769939 2006
23
PRNP H187R mutation associated with neuropsychiatric disorders in childhood and dementia. 6
15824374 2005
24
Creutzfeldt-Jakob disease with a novel insertion and codon 219 Lys/Lys polymorphism in PRNP. 6
15557533 2004
25
Creutzfeldt-Jakob disease with a novel extra-repeat insertional mutation in the PRNP gene. 6
14610142 2003
26
Novel prion protein insert mutation associated with prolonged neurodegenerative illness. 6
12771252 2003
27
Genetic Prion Diseases 6
20301407 2003
28
Sporadic--but not variant--Creutzfeldt-Jakob disease is associated with polymorphisms upstream of PRNP exon 1. 6
11704923 2001
29
Huntington disease phenocopy is a familial prion disease. 6
11593450 2001
30
Inherited prion encephalopathy associated with the novel PRNP H187R mutation: a clinical study. 6
10953183 2000
31
Novel PRNP sequence variant associated with familial encephalopathy. 6
10581485 1999
32
Inherited prion disease with an alanine to valine mutation at codon 117 in the prion protein gene. 6
10506086 1999
33
Involvement of the spinal posterior horn in Gerstmann-Sträussler-Scheinker disease (PrP P102L). 56
9932941 1999
34
A transmembrane form of the prion protein in neurodegenerative disease. 6
9452375 1998
35
Interactions between wild-type and mutant prion proteins modulate neurodegeneration in transgenic mice. 56
8698234 1996
36
Prion disease associated with a novel nine octapeptide repeat insertion in the PRNP gene. 6
8750875 1995
37
Prion disease (PrP-A117V) presenting with ataxia instead of dementia. 6
7501157 1995
38
Amyloid fibrils in Gerstmann-Sträussler-Scheinker disease (Indiana and Swedish kindreds) express only PrP peptides encoded by the mutant allele. 6
7954833 1994
39
An Israeli family with Gerstmann-Sträussler-Scheinker disease manifesting the codon 102 mutation in the prion protein gene. 6
7902971 1993
40
A missense mutation at codon 105 with codon 129 polymorphism of the prion protein gene in a new variant of Gerstmann-Sträussler-Scheinker disease. 6
7902972 1993
41
Real and imagined clinicopathological limits of "prion dementia". 56
8093741 1993
42
Prion protein preamyloid and amyloid deposits in Gerstmann-Sträussler-Scheinker disease, Indiana kindred. 6
1357663 1992
43
Inherited prion disease with 144 base pair gene insertion. 1. Genealogical and molecular studies. 6
1352724 1992
44
Uncommon phenotype for a codon 178 mutation of the human PrP gene. 6
1353344 1992
45
Atypical Creutzfeldt-Jakob disease in an American family with an insert mutation in the PRNP amyloid precursor gene. 6
1736177 1992
46
Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene. 6
1683708 1991
47
Genetic predisposition to iatrogenic Creutzfeldt-Jakob disease. 6
1675319 1991
48
Support of linkage of Gerstmann-Sträussler-Scheinker syndrome to the prion protein gene on chromosome 20p12-pter. 6
1672296 1991
49
Prion dementia without characteristic pathology. 6
1973256 1990
50
Creutzfeldt-Jakob disease and kuru patients lack a mutation consistently found in the Gerstmann-Sträussler-Scheinker syndrome. 6
2190844 1990

Variations for Gerstmann-Straussler Disease

ClinVar genetic disease variations for Gerstmann-Straussler Disease:

6 (show all 50) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 GSS NM_000178.4(GSS):c.656A>G (p.Asp219Gly)SNV Pathogenic 8531 rs28938472 20:33524779-33524779 20:34936976-34936976
2 PRNP NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln)NT expansion Pathogenic 13394 rs193922906 20:4680026-4680049 20:4699379-4699380
3 PRNP NM_000311.5(PRNP):c.305C>T (p.Pro102Leu)SNV Pathogenic 13395 rs74315401 20:4680171-4680171 20:4699525-4699525
4 PRNP NM_000311.5(PRNP):c.350C>T (p.Ala117Val)SNV Pathogenic 13396 rs74315402 20:4680216-4680216 20:4699570-4699570
5 PRNP NM_000311.5(PRNP):c.593T>C (p.Phe198Ser)SNV Pathogenic 13401 rs74315405 20:4680459-4680459 20:4699813-4699813
6 PRNP NM_000311.5(PRNP):c.650A>G (p.Gln217Arg)SNV Pathogenic 13402 rs74315406 20:4680516-4680516 20:4699870-4699870
7 PRNP NM_000311.5(PRNP):c.314C>T (p.Pro105Leu)SNV Pathogenic 13404 rs11538758 20:4680180-4680180 20:4699534-4699534
8 PRNP NM_000311.5(PRNP):c.392G>T (p.Gly131Val)SNV Pathogenic 13410 rs74315410 20:4680258-4680258 20:4699612-4699612
9 PRNP NM_000311.5(PRNP):c.560A>G (p.His187Arg)SNV Pathogenic 13412 rs74315413 20:4680426-4680426 20:4699780-4699780
10 PRNP NM_000311.5(PRNP):c.398C>T (p.Ala133Val)SNV Pathogenic 13414 rs74315415 20:4680264-4680264 20:4699618-4699618
11 PRNP NM_000311.5(PRNP):c.313C>T (p.Pro105Ser)SNV Pathogenic 13415 rs74315414 20:4680179-4680179 20:4699533-4699533
12 PRNP NM_000311.5(PRNP):c.435T>G (p.Tyr145Ter)SNV Pathogenic 21147 rs80356710 20:4680301-4680301 20:4699655-4699655
13 PRNP NM_000311.5(PRNP):c.478C>T (p.Gln160Ter)SNV Pathogenic 21148 rs80356711 20:4680344-4680344 20:4699698-4699698
14 PRNP NM_000311.5(PRNP):c.633G>C (p.Glu211Asp)SNV Pathogenic 88922 rs398122413 20:4680499-4680499 20:4699853-4699853
15 PRNP NM_000311.5(PRNP):c.678C>A (p.Tyr226Ter)SNV Pathogenic 88926 rs398122414 20:4680544-4680544 20:4699898-4699898
16 PRNP NM_000311.5(PRNP):c.679C>T (p.Gln227Ter)SNV Pathogenic 88927 rs17852079 20:4680545-4680545 20:4699899-4699899
17 PRNP NM_000311.5(PRNP):c.489C>G (p.Tyr163Ter)SNV Pathogenic 88928 rs1555782101 20:4680355-4680355 20:4699709-4699709
18 GSS NM_000178.4(GSS):c.491G>A (p.Arg164Gln)SNV Pathogenic 8525 rs121909307 20:33530291-33530291 20:34942488-34942488
19 GSS GSS, 1-BP DEL, NT3/4Gdeletion Pathogenic 8526
20 GSS NM_000178.4(GSS):c.799C>T (p.Arg267Trp)SNV Pathogenic 8527 rs121909308 20:33523414-33523414 20:34935611-34935611
21 GSS NM_000178.4(GSS):c.847C>T (p.Arg283Cys)SNV Pathogenic 8528 rs121909309 20:33519924-33519924 20:34932121-34932121
22 GSS NM_000178.4(GSS):c.373C>T (p.Arg125Cys)SNV Pathogenic 8529 rs28936396 20:33530409-33530409 20:34942606-34942606
23 GSS NM_000178.4(GSS):c.-9+5G>ASNV Pathogenic 495702 rs1555889738 20:33543525-33543525 20:34955722-34955722
24 GSS NM_000178.4(GSS):c.1253G>A (p.Arg418Gln)SNV Conflicting interpretations of pathogenicity 338294 rs150141794 20:33517252-33517252 20:34929449-34929449
25 GSS NM_000178.4(GSS):c.834+4G>CSNV Conflicting interpretations of pathogenicity 338299 rs201359061 20:33523375-33523375 20:34935572-34935572
26 GSS NM_000178.4(GSS):c.4del (p.Ala2fs)deletion Conflicting interpretations of pathogenicity 338302 rs752560204 20:33539652-33539652 20:34951849-34951849
27 GSS NM_000178.4(GSS):c.941C>T (p.Pro314Leu)SNV Conflicting interpretations of pathogenicity 8530 rs75863437 20:33519830-33519830 20:34932027-34932027
28 GSS NM_000178.4(GSS):c.-46A>GSNV Conflicting interpretations of pathogenicity 338306 rs886056642 20:33543567-33543567 20:34955764-34955764
29 GSS NM_000178.4(GSS):c.768-3C>TSNV Conflicting interpretations of pathogenicity 338300 rs184506175 20:33523448-33523448 20:34935645-34935645
30 GSS NM_000178.4(GSS):c.-16G>ASNV Conflicting interpretations of pathogenicity 338303 rs575728230 20:33543537-33543537 20:34955734-34955734
31 GSS NM_000178.4(GSS):c.-18A>GSNV Uncertain significance 338304 rs886056640 20:33543539-33543539 20:34955736-34955736
32 GSS NM_000178.4(GSS):c.-29T>ASNV Uncertain significance 338305 rs886056641 20:33543550-33543550 20:34955747-34955747
33 GSS NM_000178.4(GSS):c.*391A>TSNV Uncertain significance 338287 rs886056638 20:33516240-33516240 20:34928437-34928437
34 GSS NM_000178.4(GSS):c.*90A>GSNV Uncertain significance 338290 rs35747685 20:33516541-33516541 20:34928738-34928738
35 GSS NM_000178.4(GSS):c.*69G>TSNV Uncertain significance 338291 rs200882573 20:33516562-33516562 20:34928759-34928759
36 GSS NM_000178.4(GSS):c.1186A>G (p.Ile396Val)SNV Uncertain significance 338296 rs771438550 20:33517319-33517319 20:34929516-34929516
37 GSS NM_000178.4(GSS):c.957G>A (p.Met319Ile)SNV Uncertain significance 338298 rs202181009 20:33519814-33519814 20:34932011-34932011
38 GSS NM_000178.4(GSS):c.448G>A (p.Ala150Thr)SNV Uncertain significance 338301 rs549377370 20:33530334-33530334 20:34942531-34942531
39 GSS NM_000178.4(GSS):c.-63G>CSNV Uncertain significance 338307 rs192442930 20:33543584-33543584 20:34955781-34955781
40 GSS NM_000178.4(GSS):c.-80G>CSNV Uncertain significance 338308 rs570588543 20:33543601-33543601 20:34955798-34955798
41 GSS NM_000178.4(GSS):c.*390G>TSNV Uncertain significance 338288 rs886056639 20:33516241-33516241 20:34928438-34928438
42 GSS NM_000178.4(GSS):c.*2G>ASNV Uncertain significance 338292 rs36000727 20:33516629-33516629 20:34928826-34928826
43 GSS NM_000178.4(GSS):c.1260C>G (p.Val420=)SNV Uncertain significance 338293 rs369657861 20:33517245-33517245 20:34929442-34929442
44 GSS NM_000178.4(GSS):c.73C>G (p.Arg25Gly)SNV Uncertain significance 461479 rs930264754 20:33539583-33539583 20:34951780-34951780
45 GSS NM_000178.4(GSS):c.*181C>TSNV Uncertain significance 338289 rs773689812 20:33516450-33516450 20:34928647-34928647
46 GSS NM_000178.4(GSS):c.1203C>T (p.Ile401=)SNV Uncertain significance 338295 rs138574949 20:33517302-33517302 20:34929499-34929499
47 GSS NM_000178.4(GSS):c.1158G>A (p.Leu386=)SNV Uncertain significance 338297 rs141866304 20:33517347-33517347 20:34929544-34929544
48 GSS NM_000178.4(GSS):c.754C>T (p.Arg252Ter)SNV Uncertain significance 631873 rs749741013 20:33524579-33524579 20:34936776-34936776
49 GSS NM_000178.4(GSS):c.1054G>A (p.Ala352Thr)SNV Uncertain significance 650657 20:33519196-33519196 20:34931393-34931393
50 GSS NM_000178.4(GSS):c.631C>G (p.Gln211Glu)SNV Uncertain significance 653428 20:33524804-33524804 20:34937001-34937001

UniProtKB/Swiss-Prot genetic disease variations for Gerstmann-Straussler Disease:

73
# Symbol AA change Variation ID SNP ID
1 PRNP p.Pro102Leu VAR_006464 rs74315401
2 PRNP p.Pro105Leu VAR_006465 rs11538758
3 PRNP p.Phe198Ser VAR_006472 rs74315405
4 PRNP p.Gln217Arg VAR_006476 rs74315406
5 PRNP p.His187Arg VAR_008746 rs74315413
6 PRNP p.Asp202Asn VAR_008750 rs761807915
7 PRNP p.Gln212Pro VAR_008753 rs751882709
8 PRNP p.Gly131Val VAR_014264 rs74315410

Expression for Gerstmann-Straussler Disease

Search GEO for disease gene expression data for Gerstmann-Straussler Disease.

Pathways for Gerstmann-Straussler Disease

Pathways related to Gerstmann-Straussler Disease according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1 11.81 TARDBP SNCA SCN2A PSEN2 PSEN1 PRNP
2 11.28 PSEN2 PSEN1 APP
3 11.23 PRNP MAPT APP
4 10.91 PSEN2 PSEN1 MAPT APP
5 10.69 PSEN2 PSEN1 APP
6 9.96 PSEN2 PSEN1

GO Terms for Gerstmann-Straussler Disease

Cellular components related to Gerstmann-Straussler Disease according to GeneCards Suite gene sharing:

(show all 15)
# Name GO ID Score Top Affiliating Genes
1 cell GO:0005623 10.05 SNCA PSEN1 PRNP PRND MAPT HTT
2 cell surface GO:0009986 9.95 PSEN2 PSEN1 PRNP BSPH1 APP
3 early endosome GO:0005769 9.77 PSEN2 PSEN1 MGRN1 HTT APP
4 synaptic vesicle GO:0008021 9.73 SNCA PSEN2 PSEN1 APP
5 membrane raft GO:0045121 9.72 PSEN2 PSEN1 PRNP MAPT APP
6 neuromuscular junction GO:0031594 9.7 PSEN2 PSEN1 APP
7 rough endoplasmic reticulum GO:0005791 9.67 SNCA PSEN1 APP
8 integral component of presynaptic membrane GO:0099056 9.65 SCN2A PSEN2 PSEN1
9 dendritic shaft GO:0043198 9.58 PSEN2 PSEN1 APP
10 anchored component of external side of plasma membrane GO:0031362 9.54 PRNP PRND
11 main axon GO:0044304 9.46 MAPT APP
12 inclusion body GO:0016234 9.43 SNCA PRNP HTT
13 growth cone GO:0030426 9.35 SNCA PSEN2 PSEN1 MAPT APP
14 ciliary rootlet GO:0035253 9.33 PSEN2 PSEN1 APP
15 axon GO:0030424 9.17 SNCA SCN2A PSEN2 PSEN1 MAPT HTT

Biological processes related to Gerstmann-Straussler Disease according to GeneCards Suite gene sharing:

(show all 34)
# Name GO ID Score Top Affiliating Genes
1 negative regulation of gene expression GO:0010629 9.88 TARDBP PSEN1 MIRLET7I MAPT APP
2 response to oxidative stress GO:0006979 9.81 PSEN1 PRNP GSS APP
3 memory GO:0007613 9.8 SCN2A PSEN1 MAPT
4 Notch signaling pathway GO:0007219 9.8 PSEN2 PSEN1 PRNP APP
5 learning or memory GO:0007611 9.78 PSEN1 PRNP APP
6 protein destabilization GO:0031648 9.76 SNCA PRNP HTT
7 cellular response to amyloid-beta GO:1904646 9.75 PSEN1 PRNP APP
8 neuron apoptotic process GO:0051402 9.74 SCN2A PSEN1 APP
9 positive regulation of neuron death GO:1901216 9.7 SNCA PRNP MAPT
10 negative regulation of protein phosphorylation GO:0001933 9.67 TARDBP SNCA PSEN1 PRNP
11 regulation of long-term neuronal synaptic plasticity GO:0048169 9.66 SNCA APP
12 regulation of peptidyl-tyrosine phosphorylation GO:0050730 9.66 PRNP APP
13 positive regulation of tumor necrosis factor biosynthetic process GO:0042535 9.65 PSEN1 APP
14 membrane protein intracellular domain proteolysis GO:0031293 9.65 PSEN2 PSEN1
15 positive regulation of receptor recycling GO:0001921 9.65 SNCA PSEN1
16 amyloid-beta metabolic process GO:0050435 9.64 PSEN2 PSEN1
17 negative regulation of long-term synaptic potentiation GO:1900272 9.64 PRNP APP
18 supramolecular fiber organization GO:0097435 9.63 SNCA MAPT
19 microglial cell activation GO:0001774 9.63 SNCA MAPT APP
20 amyloid fibril formation GO:1990000 9.62 MAPT APP
21 amyloid precursor protein catabolic process GO:0042987 9.62 PSEN2 PSEN1
22 Notch receptor processing GO:0007220 9.61 PSEN2 PSEN1
23 cellular response to copper ion GO:0071280 9.61 SNCA PRNP APP
24 Notch receptor processing, ligand-dependent GO:0035333 9.6 PSEN2 PSEN1
25 negative regulation of low-density lipoprotein receptor activity GO:1905598 9.59 PSEN1 APP
26 positive regulation of amyloid fibril formation GO:1905908 9.56 PSEN1 APP
27 regulation of epidermal growth factor-activated receptor activity GO:0007176 9.55 PSEN1 APP
28 astrocyte activation involved in immune response GO:0002265 9.54 PSEN1 APP
29 astrocyte activation GO:0048143 9.5 PSEN1 MAPT APP
30 cellular copper ion homeostasis GO:0006878 9.43 PRNP PRND APP
31 smooth endoplasmic reticulum calcium ion homeostasis GO:0051563 9.4 PSEN1 APP
32 neuron projection maintenance GO:1990535 9.33 PSEN1 PRNP APP
33 synapse organization GO:0050808 9.26 SNCA PSEN1 MAPT APP
34 modulation of age-related behavioral decline GO:0090647 8.8 PSEN1 PRNP APP

Molecular functions related to Gerstmann-Straussler Disease according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 identical protein binding GO:0042802 9.8 TARDBP SNCA PRNP MAPT HTT GSS
2 dynactin binding GO:0034452 9.32 MAPT HTT
3 aspartic endopeptidase activity, intramembrane cleaving GO:0042500 9.16 PSEN2 PSEN1
4 copper ion binding GO:0005507 9.13 SNCA PRNP PRND
5 cuprous ion binding GO:1903136 8.62 SNCA PRNP

Sources for Gerstmann-Straussler Disease

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....