Home
User Guide
What's in a MalaCard Search Guide Our Sources
Analysis Tools
GeneCards GeneAnalytics GeneAlaCart PathCards VarElect
Release Notes Disease Lists/Categories
About
About MalaCards Datasets Our Publications Weizmann Institute LifeMap Discovery® Terms of Use MalaCards Team
MCID: HMG005
MIFTS: 55

Hemoglobinopathy

Categories: Blood diseases, Rare diseases
Data Licensing
For inquiries, contact:
[email protected]
Genes Variations Tissues Related diseases Publications Symptoms & Phenotypes Drugs
Sources

Aliases & Classifications for Hemoglobinopathy

About this section

MalaCards integrated aliases for Hemoglobinopathy:

Name: Hemoglobinopathy 11 19 58 75 28 5 14
Hemoglobinopathies 11 53 2 43 14 71

Classifications:

MalaCards categories:
Global: Rare diseases
Anatomical: Blood diseases
See all MalaCards categories (disease lists)
ICD10: 31
Orphanet: 58  
Rare haematological diseases


External Ids:

Disease Ontology 11 DOID:2860
MeSH 43 D006453
NCIt 49 C3092
SNOMED-CT 68 154794008
ICD10 31 D58.2
MESH via Orphanet 44 D006453
UMLS via Orphanet 72 C0019045
Orphanet 58 ORPHA68364
UMLS 71 C0019045
Sources

Summaries for Hemoglobinopathy

About this section

CDC: 2 Hemoglobinopathies is the medical term for a group of blood disorders and diseases that affect red blood cells. These disorders include both sickle cell disease (SCD) and thalassemia. Hemoglobinopathies monitoring means finding out the number of people with these conditions and how having a hemoglobinopathy affects their health, so that researchers and health care providers can ultimately improve the health of people with hemoglobinopathies.

MalaCards based summary: Hemoglobinopathy, also known as hemoglobinopathies, is related to methemoglobinemia, beta-globin type and heinz body anemias, and has symptoms including cyanosis An important gene associated with Hemoglobinopathy is HBB (Hemoglobin Subunit Beta), and among its related pathways/superpathways are Response to elevated platelet cytosolic Ca2+ and HIF-1-alpha transcription factor network. The drugs Ribavirin and Peginterferon alfa-2b have been mentioned in the context of this disorder. Affiliated tissues include bone marrow, t cells and bone, and related phenotypes are Increased shRNA abundance (Z-score > 2) and homeostasis/metabolism

GARD: 19 A group of inherited disorders characterized by structural alterations within the hemoglobin molecule.

Wikipedia: 75 Hemoglobinopathy is the medical term for a group of inherited blood disorders and diseases that... more...
Sources

Related Diseases for Hemoglobinopathy

About this section

Diseases related to Hemoglobinopathy via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 404)
# Related Disease Score Top Affiliating Genes
1 methemoglobinemia, beta-globin type 32.8 LOC110006319 LOC107133510 LOC106099062 HBB HBA2 HBA1
2 heinz body anemias 32.3 LOC110006319 LOC107133510 LOC106099062 HP HBB HBA2
3 hereditary persistence of fetal hemoglobin-sickle cell disease syndrome 32.0 KLF1 HBG1 HBB BCL11A
4 hemoglobin c disease 32.0 LOC107133510 LOC106099062 KLF1 HBG1 HBE1 HBD
5 hemoglobin d disease 32.0 LOC110006319 LOC107133510 HP HBE1 HBD HBB
6 hemoglobin e disease 32.0 TFRC LOC107133510 LOC106099062 KLF1 HBE1 HBD
7 sickle cell anemia 31.8 VCAM1 TFRC LOC110006319 LOC107133510 LOC106099062 KLF1
8 alpha-thalassemia 31.7 VCAM1 TFRC LOC110006319 LOC107133510 LOC106099062 KLF1
9 thalassemia 31.4 TFRC TF LOC110006319 LOC107133510 KLF1 HP
10 sickle cell disease 31.4 VCAM1 LOC110006319 LOC107133510 LOC106099062 HBG1 HBD
11 hemoglobin se disease 31.1 LOC110006319 LOC107133510 LOC106099062 HBB
12 beta-thalassemia 31.1 TFRC TF LOC110006319 LOC107133510 LOC106099062 KLF1
13 iron metabolism disease 31.0 TFRC TF HBB G6PD EPO
14 splenomegaly 31.0 HBB HBA2 HBA1 EPO
15 histiocytosis-lymphadenopathy plus syndrome 30.9 HBE1 HBB HBA2 HBA1 G6PD
16 hemosiderosis 30.8 TFRC TF HP EPO
17 beta-thalassemia intermedia 30.7 TFRC KLF1 HBG1 HBE1 HBB EPO
18 anemia, sideroblastic, 1 30.7 TFRC KLF1 HBB EPO
19 thalassemia minor 30.7 HBG1 HBE1 HBD HBB HBA2 HBA1
20 hemolytic anemia 30.7 TFRC TF LOC107133510 LOC106099062 KLF1 HP
21 deficiency anemia 30.7 TFRC TF LOC107133510 LOC106099062 KLF1 HP
22 hemoglobin e-beta-thalassemia syndrome 30.7 LOC107133510 LOC106099062 HBB
23 fetal hemoglobin quantitative trait locus 1 30.7 LOC110006319 LOC107133510 LOC106099062 KLF1 HBG1 HBE1
24 acute chest syndrome 30.6 VCAM1 HP HBB BCL11A
25 iron deficiency anemia 30.6 TFRC TF G6PD EPO
26 glucosephosphate dehydrogenase deficiency 30.6 HP HBE1 HBB HBA2 HBA1 G6PD
27 microcytic anemia 30.6 TFRC TF HBB HBA2 G6PD EPO
28 beta-thalassemia major 30.6 TFRC LOC110006319 LOC107133510 LOC106099062 KLF1 HP
29 hemoglobin h disease 30.6 TFRC HBE1 HBB HBA2 HBA1 BCL11A
30 splenic infarction 30.5 HP HBB
31 methemoglobinemia 30.5 HP HBB G6PD CYB5R3
32 splenic sequestration 30.5 HP HBE1 HBB EPO
33 thrombotic thrombocytopenic purpura 30.5 HP HBB HBA1
34 polycythemia 30.5 TFRC HBB HBA2 HBA1 EPO
35 hereditary elliptocytosis 30.5 HBE1 HBB G6PD
36 plasmodium falciparum malaria 30.4 HP HBB G6PD
37 congenital hypothyroidism 30.4 TFRC HP G6PD BTD
38 nutritional deficiency disease 30.4 TFRC TF EPO
39 hereditary spherocytosis 30.3 TFRC KLF1 HP HBG1 HBE1 HBB
40 priapism 30.3 HP HBB BCL11A
41 erythrocytosis, familial, 7 30.3 HBB HBA2 HBA1 CYB5R3
42 acquired methemoglobinemia 30.3 G6PD CYB5R3
43 beta-thalassemia, dominant inclusion body type 30.3 LOC110006319 LOC107133510 LOC106099062 HBB
44 acute erythroid leukemia 30.2 TFRC KLF1 EPO
45 neonatal anemia 30.2 TFRC KLF1 HBB EPO
46 anemia, autoimmune hemolytic 30.2 HP G6PD EPO
47 takayasu arteritis 30.2 VCAM1 PECAM1 HP
48 hypochromic microcytic anemia 30.2 TFRC TF HBE1 HBB HBA2 HBA1
49 erythroleukemia 30.1 TFRC KLF1 HBG1 HBE1 HBB EPO
50 hemochromatosis, type 1 30.1 TFRC TF HP HBB HBA2 HBA1

Graphical network of the top 20 diseases related to Hemoglobinopathy:



Diseases related to Hemoglobinopathy
Sources

Symptoms & Phenotypes for Hemoglobinopathy

About this section

UMLS symptoms related to Hemoglobinopathy:


cyanosis

GenomeRNAi Phenotypes related to Hemoglobinopathy according to GeneCards Suite gene sharing:

25 (show all 38)
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Increased shRNA abundance (Z-score > 2) GR00366-A-102 10.08 PECAM1
2 Increased shRNA abundance (Z-score > 2) GR00366-A-104 10.08 HBG1
3 Increased shRNA abundance (Z-score > 2) GR00366-A-105 10.08 PECAM1
4 Increased shRNA abundance (Z-score > 2) GR00366-A-113 10.08 HBA1 HBA2
5 Increased shRNA abundance (Z-score > 2) GR00366-A-121 10.08 HBG1
6 Increased shRNA abundance (Z-score > 2) GR00366-A-123 10.08 PECAM1 HBG1
7 Increased shRNA abundance (Z-score > 2) GR00366-A-13 10.08 PECAM1
8 Increased shRNA abundance (Z-score > 2) GR00366-A-14 10.08 PECAM1
9 Increased shRNA abundance (Z-score > 2) GR00366-A-140 10.08 HBA1 HBA2 PECAM1
10 Increased shRNA abundance (Z-score > 2) GR00366-A-148 10.08 HBE1
11 Increased shRNA abundance (Z-score > 2) GR00366-A-153 10.08 HBG1
12 Increased shRNA abundance (Z-score > 2) GR00366-A-163 10.08 HBG1
13 Increased shRNA abundance (Z-score > 2) GR00366-A-164 10.08 HBE1
14 Increased shRNA abundance (Z-score > 2) GR00366-A-176 10.08 HBE1
15 Increased shRNA abundance (Z-score > 2) GR00366-A-177 10.08 HBE1
16 Increased shRNA abundance (Z-score > 2) GR00366-A-180 10.08 PECAM1
17 Increased shRNA abundance (Z-score > 2) GR00366-A-181 10.08 HBA1 HBA2
18 Increased shRNA abundance (Z-score > 2) GR00366-A-192 10.08 CYB5R3
19 Increased shRNA abundance (Z-score > 2) GR00366-A-211 10.08 PECAM1
20 Increased shRNA abundance (Z-score > 2) GR00366-A-214 10.08 PECAM1
21 Increased shRNA abundance (Z-score > 2) GR00366-A-23 10.08 HBE1
22 Increased shRNA abundance (Z-score > 2) GR00366-A-24 10.08 CYB5R3
23 Increased shRNA abundance (Z-score > 2) GR00366-A-29 10.08 HBG1
24 Increased shRNA abundance (Z-score > 2) GR00366-A-35 10.08 HBG1
25 Increased shRNA abundance (Z-score > 2) GR00366-A-42 10.08 PECAM1
26 Increased shRNA abundance (Z-score > 2) GR00366-A-47 10.08 HBG1
27 Increased shRNA abundance (Z-score > 2) GR00366-A-48 10.08 HBA1 HBA2
28 Increased shRNA abundance (Z-score > 2) GR00366-A-52 10.08 PECAM1
29 Increased shRNA abundance (Z-score > 2) GR00366-A-55 10.08 HBG1
30 Increased shRNA abundance (Z-score > 2) GR00366-A-56 10.08 PECAM1
31 Increased shRNA abundance (Z-score > 2) GR00366-A-63 10.08 HBG1
32 Increased shRNA abundance (Z-score > 2) GR00366-A-68 10.08 CYB5R3
33 Increased shRNA abundance (Z-score > 2) GR00366-A-72 10.08 HBG1
34 Increased shRNA abundance (Z-score > 2) GR00366-A-74 10.08 CYB5R3
35 Increased shRNA abundance (Z-score > 2) GR00366-A-75 10.08 PECAM1
36 Increased shRNA abundance (Z-score > 2) GR00366-A-77 10.08 HBG1
37 Increased shRNA abundance (Z-score > 2) GR00366-A-78 10.08 CYB5R3
38 Increased shRNA abundance (Z-score > 2) GR00366-A-82 10.08 CYB5R3

MGI Mouse Phenotypes related to Hemoglobinopathy:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 homeostasis/metabolism MP:0005376 10.13 BCL11A BTD CYB5R3 EPO G6PD HBA1
2 muscle MP:0005369 9.97 BTD CYB5R3 EPO HBA1 HBA2 HBB
3 cellular MP:0005384 9.9 BCL11A EPO G6PD HBA1 HBA2 HBB
4 liver/biliary system MP:0005370 9.87 EPO HBB HBD HP KLF1 PECAM1
5 hematopoietic system MP:0005397 9.8 BCL11A CYB5R3 EPO G6PD HBA1 HBA2
6 mortality/aging MP:0010768 9.44 BCL11A CYB5R3 EPO G6PD HBA1 HBA2
Sources

Drugs & Therapeutics for Hemoglobinopathy

About this section

Drugs for Hemoglobinopathy (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 128)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Ribavirin Approved Phase 4 36791-04-5 37542
2
Peginterferon alfa-2b Approved Phase 4 215647-85-1, 99210-65-8
3
Peginterferon alfa-2a Approved, Investigational Phase 4 198153-51-4
4
Deferasirox Approved, Investigational Phase 4 201530-41-8 214348 5493381
5 Anti-Infective Agents Phase 4
6 Immunologic Factors Phase 4
7 Antiviral Agents Phase 4
8 Antimetabolites Phase 4
9 Interferon alpha-2 Phase 4
10 interferons Phase 4
11 Interferon-alpha Phase 4
12 Interferon-alfa-1b Phase 4
13 Iron Chelating Agents Phase 4
14 Chelating Agents Phase 4
15
Iron Approved Phase 3 7439-89-6 29936
16
Vidarabine Approved, Investigational Phase 2, Phase 3 24356-66-9 21704
17
Deferiprone Approved Phase 3 30652-11-0 2972
18
Busulfan Approved, Investigational Phase 2, Phase 3 55-98-1 2478
19 Anti-Bacterial Agents Phase 3
20 Penicillins Phase 3
21 Pharmaceutical Solutions Phase 3
22
Deferoxamine Approved, Investigational Phase 2 70-51-9 2973
23
Hydroxyurea Approved Phase 1, Phase 2 127-07-1 3657
24
Clofarabine Approved, Investigational Phase 2 123318-82-1 119182
25
Thiotepa Approved, Investigational Phase 1, Phase 2 52-24-4 5453
26
Abatacept Approved Phase 1, Phase 2 332348-12-6
27
Methotrexate Approved Phase 1, Phase 2 1959-05-2, 59-05-2 4112 126941
28
Melphalan Approved Phase 1, Phase 2 148-82-3 4053 460612
29
Treosulfan Approved, Investigational Phase 2 299-75-2 9296
30
Fludarabine Approved Phase 2 75607-67-9, 21679-14-1 30751 657237
31
Mycophenolic acid Approved, Investigational Phase 2 24280-93-1 446541
32
Miconazole Approved, Investigational, Vet_approved Phase 2 22916-47-8 4189
33
Clotrimazole Approved, Vet_approved Phase 2 23593-75-1 2812
34
Alemtuzumab Approved, Investigational Phase 2 216503-57-0
35
Lenograstim Approved, Investigational Phase 2 135968-09-1
36
Cyclophosphamide Approved, Investigational Phase 2 50-18-0, 6055-19-2 2907
37
Phenytoin Approved, Vet_approved Phase 2 57-41-0 1775
38
Tacrolimus Approved, Investigational Phase 2 104987-11-3 6473866 445643
39
Levetiracetam Approved Phase 2 102767-28-2 441341 5284583
40
Sirolimus Approved, Investigational Phase 2 53123-88-9 5284616 6436030
41
Prednisone Approved, Vet_approved Phase 2 53-03-2 5865
42
Folic acid Approved, Nutraceutical, Vet_approved Phase 2 59-30-3 6037
43
Pyridoxine Approved, Investigational, Nutraceutical, Vet_approved Phase 2 65-23-6 1054
44 Vitamins Phase 2
45 Folate Phase 2
46 Vitamin B9 Phase 2
47 Vitamin B6 Phase 2
48 Trace Elements Phase 2
49 Pyridoxal isonicotinoyl hydrazone Phase 2
50 Vitamin B Complex Phase 2

Interventional clinical trials:

(show top 50) (show all 86)
# Name Status NCT ID Phase Drugs
1 Phase IV Study of Effectiveness of Interferon and Ribavirin Treatment in Thalassemia Major Patients With Chronic Viral Hepatitis C Unknown status NCT00887081 Phase 4 PEG-IFN alpha2a or PEG-IFN alpha2b and Ribavirin
2 A Study of Magnetic Resonance Imaging Assessment of Cardiac and Liver Iron Load in Patients With Haemoglobinopathies, Myelodysplastic Syndromes (MDS) or Other Anaemias Treated With Exjade® (Deferasirox) (The MILE Study) Completed NCT00673608 Phase 4 deferasirox
3 Allogeneic Hematopoietic Stem Cell Transplant for Patients With High Risk Hemoglobinopathy Using a Preparative Regimen to Achieve Stable Mixed Chimerism Completed NCT00176852 Phase 2, Phase 3 Busulfan, Fludarabine, ATG, TLI;Busulfan, Cyclophosphamide, ATG, GCSF;Campath, Fludarabine, Cyclophosphamide
4 Multicenter Study of Hydroxyurea in Patients With Sickle Cell Anemia (MSH) Completed NCT00000586 Phase 3 hydroxyurea
5 Penicillin Prophylaxis in Sickle Cell Disease (PROPS) Completed NCT00000585 Phase 3 penicillin
6 Stroke Prevention in Sickle Cell Anemia (STOP 1) Completed NCT00000592 Phase 3
7 Multicentre, Randomised, Open Label, Non-inferiority Trial to Evaluate the Efficacy and Safety of Deferiprone Compared to Deferasirox in Patients Aged From 1 Month to Less Than 18 Years Affected by Transfusion Dependent Haemoglobinopathies Completed NCT01825512 Phase 3 Deferiprone;Deferasirox
8 A Phase 3 Study to Evaluate the Safety and Efficacy of a Single Dose of CTX001 in Pediatric Subjects With Severe Sickle Cell Disease Recruiting NCT05329649 Phase 3
9 A Phase 3 Study to Evaluate the Safety and Efficacy of a Single Dose of CTX001 in Pediatric Subjects With Transfusion-Dependent β-Thalassemia Recruiting NCT05356195 Phase 3
10 A Phase 3b Study to Evaluate Efficacy and Safety of a Single Dose of Autologous CRISPR Cas9 Modified CD34+ Human Hematopoietic Stem and Progenitor Cells (CTX001) in Subjects With Transfusion-Dependent β-Thalassemia or Severe Sickle Cell Disease Recruiting NCT05477563 Phase 3
11 A Phase 1/2/3 Study to Evaluate the Safety and Efficacy of a Single Dose of Autologous CRISPR-Cas9 Modified CD34+ Human Hematopoietic Stem and Progenitor Cells (CTX001) in Subjects With Severe Sickle Cell Disease Active, not recruiting NCT03745287 Phase 2, Phase 3
12 A Phase 1/2/3 Study of the Safety and Efficacy of a Single Dose of Autologous CRISPR-Cas9 Modified CD34+ Human Hematopoietic Stem and Progenitor Cells (hHSPCs) in Subjects With Transfusion-Dependent β-Thalassemia Active, not recruiting NCT03655678 Phase 2, Phase 3
13 Effect of Hydroxyurea on the Level of Ineffective Erythropoiesis, Transfusion Requirement, and Fetal Hemoglobin Synthesis in Patients With Beta-Thalassemia-Intermedia Completed NCT00001958 Phase 2 Hydroxyurea
14 Phase I/II Pilot Study of Mixed Chimerism to Treat Hemoglobinopathies Completed NCT00777231 Phase 1, Phase 2
15 Multi-Center Study Using Allogeneic Stem Cell Transplantation Following Reduced Intensity Chemotherapy in Patients With Hemoglobinopathies Completed NCT00153985 Phase 2 Busulfex;Fludarabine;Alemtuzumab
16 Allogeneic Stem Cell Transplantation of NiCord®, Umbilical Cord Blood-Derived Ex Vivo Expanded Stem and Progenitor Cells, in Patients With Hemoglobinopathies Completed NCT01590628 Phase 1, Phase 2 NiCord
17 Allogeneic Mixed Chimerism Stem Cell Transplantation Utilizing In Vivo and In Vitro Campath for Hemoglobinopathies and Bone Marrow Failure Syndromes Completed NCT00004143 Phase 2 Campath, Chemo and/or TBI Allo SCT
18 ALLOGENEIC HEMATOPOIETIC STEM CELL TRANSPLANTATION (HSCT) IN PATIENTS WITH HIGH RISK HEMOGLOBINOPATHIES LIKE SICKLE CELL DISEASE AND β-THALESSEMIA-MAJOR USING REDUCED INTENSITY CONDITIONING REGIMEN Completed NCT02435901 Phase 1, Phase 2 alemtuzumab (Campath IH);Fludarabine;Melphalan;Cyclosporine;Mycophenolate mofetil;Tacrolimus
19 A Phase 1/2 Open Label Study Evaluating the Safety and Efficacy of Gene Therapy of the β-Hemoglobinopathies (Sickle Cell Anemia and β-Thalassemia Major) by Transplantation of Autologous CD34+ Stem Cells Transduced Ex Vivo With a Lentiviral β-A-T87Q Globin Vector (LentiGlobin BB305 Drug Product) Completed NCT02151526 Phase 1, Phase 2 LentiGlobin BB305 Drug Product
20 Chelation Therapy of Iron Overload With Oral Pyridoxal Isonicotinoyl Hydrazone Completed NCT00000588 Phase 2 Chelation therapy
21 Evaluation of Subcutaneous Desferrioxamine as Treatment for Transfusional Hemochromatosis Completed NCT00000595 Phase 2 deferoxamine
22 Pediatric Hydroxyurea in Sickle Cell Anemia (PED HUG) Completed NCT00000602 Phase 2 hydroxyurea
23 Multi-centre, Oral Single Dose Experimental and Modelling Study to Evaluate the Pharmacokinetics of Deferiprone in Patients Aged From 1 Month to Less Than 6 Years of Age Affected by Transfusion-dependent Haemoglobinopathies. Completed NCT01740713 Phase 2 Deferiprone, dose level 1;Deferiprone, dose level 2;Deferiprone, dose level 3
24 Study of TCR Alpha Beta T-Cell and CD19 B-Cell Depletion for Hematopoietic Cell Transplantation From Haploidentical Donors in the Treatment of Non-Malignant Hematological Disorders in Children Recruiting NCT04356469 Phase 2
25 Cord Blood Transplantation in Children and Young Adults With Hematologic Malignancies and Non-malignant Disorders Recruiting NCT04644016 Phase 2 Clofarabine;Fludarabine;Busulfan;Cyclosporine-A;Mycophenolate Mofetil
26 A Phase 1/2 Study to Evaluate the Safety and Efficacy of a Single Dose of Autologous Clustered Regularly Interspaced Short Palindromic Repeats Gene-edited CD34+ Human Hematopoietic Stem and Progenitor Cells (EDIT-301) in Subjects With Severe Sickle Cell Disease Recruiting NCT04853576 Phase 1, Phase 2
27 A Phase I/II Trial of Reduced Intensity Conditioning and Familial HLA-Mismatched Bone Marrow Transplantation in Children With Non-Malignant Disorders Recruiting NCT03128996 Phase 1, Phase 2 RIC regimen;GVHD prophylaxis regimen
28 Reduced Intensity Conditioning (RIC) Regimen for Patients With Non-malignant Disorders Recruiting NCT01050855 Phase 2 RIC: Distal Campath;RIC:Intermediate Campath;RIC: Mini Busulfan
29 A Study of Hematopoietic Stem Cell Transplantation (HSCT) in Non-Malignant Disease Using a Reduced-Intensity Preparatory Regime Recruiting NCT00920972 Phase 1, Phase 2 Treatment Plan 1: Stratum 1;Treatment Plan 2: Strata 2, 3, or 4;GVHD Regimen A: UCB Recipients;GVHD Regimen B: BM Recipients
30 A Multicenter Study to Evaluate the Safety, Tolerability, and Efficacy of a Single Dose of Autologous Clustered Regularly Interspaced Short Palindromic Repeats Gene-edited Cluster of Differentiation 34 (CD34+) Human Hematopoietic Stem and Progenitor Cells (HSPC) (EDIT-301) in Transfusion-Dependent Beta Thalassemia (TDT) Recruiting NCT05444894 Phase 1, Phase 2
31 Phase I/II Study of CaspaCIDe® T Cells From an HLA-Partially Matched Family Donor After Negative Selection of TCR αβ+T Cells in Pediatric Patients Affected by Hematological Disorders Active, not recruiting NCT03301168 Phase 1, Phase 2 Rimiducid
32 Follow-up of Phase 1/2 Study of CaspaCIDe T Cells (BPX-501) From an HLA-partially Matched Family Donor After Negative Selection of TCR αβ+T Cells in Pediatric Patients Affected by Hematological Disorders Active, not recruiting NCT03733249 Phase 1, Phase 2 Rimiducid
33 CD34+ Stem Cell Selection for Patients Receiving a Matched or Partially Matched Family or Unrelated Adult Donor Allogeneic Stem Cell Transplantation for Non-Malignant Disease Active, not recruiting NCT01966367 Phase 1, Phase 2
34 Phase II Extension Study of CaspaCIDe T Cells (BPX-501) From an HLA-partially Matched Family Donor After Negative Selection of TCR αβ+T Cells in Pediatric Patients Affected by Hematological Disorders Active, not recruiting NCT02065869 Phase 2 rimiducid
35 Clinical Phase II Trial to Compare Treosulfan-based Conditioning Therapy With Busulfan-based Conditioning Prior to Allogeneic Haematopoietic Stem Cell Transplantation (HSCT) in Paediatric Patients With Non-malignant Diseases Active, not recruiting NCT02349906 Phase 2 Treosulfan;Busilvex
36 Phase I/II Pilot Study of Mixed Chimerism to Treat Hemoglobinopathies Suspended NCT01419704 Phase 1, Phase 2
37 A Phase II Study Using the CliniMACS® Device for CD34+ Cell Selection and T Cell Depletion for Graft-versus-Host Disease Prophylaxis in Alternative Donor Stem Cell Transplant Recipients Terminated NCT00968864 Phase 2
38 Allogeneic Bone Marrow Transplant From HLA Identical Related Donors for Patients With High Risk Hemoglobinopathies: Hemoglobin SS, Hemoglobin SC, Hemoglobin SB0/+ Thalassemia, or Homozygous B0/+ Thalassemia or Severe Variants of B0/+ Thalassemia Terminated NCT00040469 Phase 2 Campath -1H;Dilantin;Busulfan;Cyclophosphamide
39 Allo SCT From HLA Haploidentical Related Donors Using Sub-Myeloablative Conditioning For Patients With High Risk Hemoglobinopathies: Hemo SS, Hemo SC, Hemo SB0/+ Thalassemia, Homozygous B0/+ Thalassemia or Severe B0/+ Thalassemia Variants Terminated NCT00040417 Phase 2 FLUDARABINE;CAMPATH-IH;FK506;G-SCF (Granulocyte-colony stimulating factor)
40 A Phase II Trial of Non-Myeloablative Conditioning and Transplantation of Partially HLA-Mismatched and HLA-Matched Bone Marrow for Patients With Sickle Cell Anemia and Other Hemoglobinopathies Terminated NCT00489281 Phase 2 Cyclophosphamide;Fludarabine;Mycophenolate mofetil;Sirolimus;Levetiracetam
41 Allogeneic Stem Cell Transplantation Following Nonmyeloablative Chemotherapy in Patients With Hemoglobinopathies Terminated NCT00034528 Phase 2 Busulfan;Fludarabine;FK506;Prednisone
42 Allogeneic Stem Cell Transplantation of CordInâ„¢, Umbilical Cord Blood-Derived Ex Vivo Expanded Stem and Progenitor Cells, in Patients With Hemoglobinopathies Terminated NCT02504619 Phase 1, Phase 2
43 A Pilot Study of Reduced Intensity Conditioning in Pediatric Patients <21 Years of Age With Non-Malignant Disorders Undergoing Umbilical Cord Blood Transplantation Completed NCT00744692 Phase 1 Reduced Intensity Conditioning
44 Pilot Study to Evaluate the Safety and Feasibility of Induction of Mixed Chimerism in Sickle Cell Disease Patients With COH-MC-17: a Non-Myeloablative, Conditioning Regimen and CD4+ T-cell-depleted Haploidentical Hematopoietic Transplant Recruiting NCT03249831 Phase 1 Cyclophosphamide;Pentostatin;Rabbit anti-thymocyte globulin;Tacrolimus;Mycophenolate mofetil
45 A Study Evaluating BPX-501 T Cells and AP1903 for Prevention of Graft Versus Host Disease (GVHD) After Haploidentical, Related, T Cell-Depleted Hematopoietic Cell Transplantation for Non-Malignant Diseases Active, not recruiting NCT02231710 Phase 1
46 A Single-Center, Non-Randomized Study of the Safety and Efficacy of In Utero Hematopoietic Stem Cell Transplantation for the Treatment of Fetuses With Alpha Thalassemia Major Enrolling by invitation NCT02986698 Phase 1
47 Utility of Transient Elastography (Fibroscan) in Estimating Hepatic Iron Concentration in Comparison to MRI in Patients With Transfusion Dependent Hemoglobinopathies Unknown status NCT02067130
48 Retrospective and Prospective Database of COVID-19 Prevalence and Clinical Course in Pediatric and Young Adult Hematology/ Oncology/Stem Cell Therapy Patients in the New York Tri-State Area. Unknown status NCT04445402
49 A Pilot Study of Allogeneic Hematopoietic Stem Cell Transplantation for Patients With High Risk Hemoglobinopathy Using a Non-Myeloablative Preparative Regimen to Achieve Stable Mixed Chimerism Completed NCT00427661
50 Bone Marrow for Hemoglobinopathy Research Completed NCT00669305

Search NIH Clinical Center for Hemoglobinopathy

Cochrane evidence based reviews: hemoglobinopathies

Sources

Genetic Tests for Hemoglobinopathy

About this section

Genetic tests related to Hemoglobinopathy:

# Genetic test Affiliating Genes
1 Hemoglobinopathy 28
Sources

Anatomical Context for Hemoglobinopathy

About this section

Organs/tissues related to Hemoglobinopathy:

MalaCards : Bone Marrow, T Cells, Bone, Liver, Thyroid, Pancreas, Whole Blood
Sources

Publications for Hemoglobinopathy

About this section

Articles related to Hemoglobinopathy:

(show top 50) (show all 4859)
# Title Authors PMID Year
1
Hemoglobin San Diego: An Uncommon Cause of Hereditary Erythrocytosis Discovered Incidentally in a Military Trainee. 62 5
30423154 2019
2
Low oxygen saturation and severe anemia in compound heterozygous Hb Louisville [β42(CD1)Phe→Leu] and Hb La Desirade [β129(H7)Ala→Val]. 62 5
27670359 2017
3
Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population. 62 5
27828729 2017
4
Report on Ten Years' Experience of Premarital Hemoglobinopathy Screening at a Center in Antalya, Southern Turkey. 62 5
27207683 2016
5
Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations. 62 5
26635043 2016
6
Broader spectrum of β-thalassemia mutations in Oman: regional distribution and comparison with neighboring countries. 62 5
25677748 2015
7
Detection of germline rearrangements in patients with α- and β-thalassemia using high resolution array CGH. 62 5
23491071 2013
8
Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China. 62 5
23383304 2013
9
Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach. 62 5
21423179 2011
10
Molecular basis of β-thalassemia in the United Arab Emirates. 62 5
22074124 2011
11
Molecular basis and hematological features of hemoglobin variants in Southern Thailand. 62 5
20838957 2010
12
Comprehensive and efficient HBB mutation analysis for detection of beta-hemoglobinopathies in a pan-ethnic population. 62 5
20395516 2010
13
Combination of Hb Knossos [Cod 27 (G-T)] and IVSII-745 (C-G) in a Turkish patient with beta-thalassemia major. 62 5
17949282 2007
14
The prevalence and molecular basis of hemoglobinopathies in Cambodia. 62 5
16987801 2006
15
Reliability of DHPLC in mutational screening of beta-globin (HBB) alleles. 62 5
11857746 2002
16
Distribution of beta-thalassemia mutations in the Indian population referred to a diagnostic center. 62 5
10975438 2000
17
Molecular and population genetic analyses of beta-thalassemia in Turkey. 62 5
9495372 1998
18
Hb Osler [beta 145(HC2)Tyr-->Asp] results from posttranslational modification. 62 5
9101280 1997
19
Two missense mutations in the beta-globin gene can cause severe beta thalassemia. Hemoglobin Medicine Lake (beta 32[B14]leucine-->glutamine; 98 [FG5] valine-->methionine). 62 5
7860732 1995
20
Molecular basis of morbidity from a series of studies of hemoglobinopathies in Western Japan. 62 5
5750181 1968
21
Coinherited Hemoglobin H/Constant Spring Disease and Heterozygous Hemoglobin Tak Causing Severe Hemolytic Anemia in a Thai Boy. 5
32925409 2021
22
Molecular epidemiological and hematological profile of thalassemia in the Dongguan Region of Guangdong Province, Southern China. 5
32986258 2021
23
Clinical and Laboratory Features of Hemoglobin La Desirade Variant in Association with Sickle Cell and Alpha Thalassemia Genes. 5
33489049 2021
24
Curating the gnomAD database: Report of novel variants in the globin-coding genes and bioinformatics analysis. 5
31553106 2020
25
Expression of South East Asian Ovalocytic Band 3 Disrupts Erythroblast Cytokinesis and Reticulocyte Maturation. 5
32411010 2020
26
Clinical Laboratory Manifestation and Molecular Diagnosis of β-Thalassemia Patients in Iraq. 5
31714438 2020
27
First Description of Hb San Diego (HBB: c.328G>A) in a Chinese Family with Congenital Erythrocytosis. 5
31304856 2019
28
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. 5
28603845 2017
29
Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil. 5
28366028 2017
30
Gene panel sequencing improves the diagnostic work-up of patients with idiopathic erythrocytosis and identifies new mutations. 5
27651169 2016
31
Mutation in a Highly Conserved COOH-Terminal Residue of Krüppel-Like Factor 1 Associated with Elevated Hb F in a Compound Heterozygous β-Thalassemia Patient with a Nontransfusion-Dependent Thalassemia Phenotype. 5
27821015 2016
32
The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon. 5
26372288 2016
33
Spectrum of α-thalassemia and β-thalassemia mutations in the Guilin Region of southern China. 5
26079343 2015
34
Genotype-phenotype correlation and report of novel mutations in β-globin gene in thalassemia patients. 5
25976460 2015
35
Repository of mutations from Oman: The entry point to a national mutation database. 5
26594346 2015
36
Genetic determinants of β-thalassemia intermedia in Pakistan. 5
25707679 2015
37
Hb Knossos: HBB:c.82G>T Associated with HBB:c.315+1G>A Beta Zero Mutation Causes Thalassemia Intermedia. 5
25332589 2014
38
Spectrum of Beta Globin Gene Mutations in Egyptian Children with β-Thalassemia. 5
25408857 2014
39
High resolution melting analysis: a rapid screening and typing tool for common β-thalassemia mutation in Chinese population. 5
25089872 2014
40
Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations. 5
24828949 2014
41
Molecular study of congenital erythrocytosis in 70 unrelated patients revealed a potential causal mutation in less than half of the cases (Where is/are the missing gene(s)?). 5
23859443 2013
42
The molecular basis of β-thalassemia. 5
23637309 2013
43
The spectrum of β-thalassemia mutations in Gaza Strip, Palestine. 5
23321370 2013
44
An empirical estimate of carrier frequencies for 400+ causal Mendelian variants: results from an ethnically diverse clinical sample of 23,453 individuals. 5
22975760 2013
45
Pitfalls in the genetic diagnosis of Hb S. 5
22995479 2013
46
Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population. 5
22392582 2012
47
Experience with multiplex ARMS (MARMS)-PCR for the detection of common β-thalassemia mutations in India. 5
22239493 2012
48
Molecular characteristics of three hemoglobin variants observed in a Chinese population: Hb Ube-1 [β98 (FG5) Val→Met], Hb Ube‑2 [α68 (E17) Asn→Asp] and Hb Ube‑4 [α116 (GH4) Glu→Ala]. 5
21523319 2011
49
Mechanism of escape from nonsense-mediated mRNA decay of human beta-globin transcripts with nonsense mutations in the first exon. 5
21389146 2011
50
Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil. 5
21797703 2011
Sources

Variations for Hemoglobinopathy

About this section

ClinVar genetic disease variations for Hemoglobinopathy:

5 (show all 45)
# Gene Name Type Significance ClinVarId dbSNP ID Position
1 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.127_129del (p.Phe43del) DEL Pathogenic
 15121 rs41417446 GRCh37: 11:5247993-5247995
GRCh38: 11:5226763-5226765
2 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.81G>C (p.Glu27Asp) SNV Pathogenic
 599394 rs281864581 GRCh37: 11:5248171-5248171
GRCh38: 11:5226941-5226941
3 LOC106099062, HBB, LOC107133510 NM_000518.4(HBB):c.86T>C (p.Leu29Pro) SNV Pathogenic
 15183 rs33916412 GRCh37: 11:5248166-5248166
GRCh38: 11:5226936-5226936
4 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.347C>A (p.Ala116Asp) SNV Pathogenic
 15526 rs35485099 GRCh37: 11:5246925-5246925
GRCh38: 11:5225695-5225695
5 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.45dup (p.Trp16fs) DUP Pathogenic
 15426 rs35383398 GRCh37: 11:5248206-5248207
GRCh38: 11:5226976-5226977
6 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.93-2A>C SNV Pathogenic
 439167 rs63750513 GRCh37: 11:5248031-5248031
GRCh38: 11:5226801-5226801
7 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.93-15T>G SNV Pathogenic
 550356 rs35456885 GRCh37: 11:5248044-5248044
GRCh38: 11:5226814-5226814
8 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.-29G>A SNV Pathogenic
 393702 rs34704828 GRCh37: 11:5248280-5248280
GRCh38: 11:5227050-5227050
9 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.*111A>G SNV Pathogenic
 15488 rs63751128 GRCh37: 11:5246717-5246717
GRCh38: 11:5225487-5225487
10 overlap with 2 genes NC_000011.9:g.(?_5246695)_(5255713_?)del DEL Pathogenic
 996224 GRCh37: 11:5246695-5255713
GRCh38:
11 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.129dup (p.Glu44Ter) DUP Pathogenic
 869297 rs33979901 GRCh37: 11:5247992-5247993
GRCh38: 11:5226762-5226763
12 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.138del (p.Phe46fs) DEL Pathogenic
 869338 rs35133315 GRCh37: 11:5247984-5247984
GRCh38: 11:5226754-5226754
13 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.71_73del (p.Val24del) DEL Pathogenic
 15166 rs34160180 GRCh37: 11:5248179-5248181
GRCh38: 11:5226949-5226951
14 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.295G>A (p.Val99Met) SNV Pathogenic
 15241 rs33933298 GRCh37: 11:5247827-5247827
GRCh38: 11:5226597-5226597
15 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.176C>G (p.Pro59Arg) SNV Pathogenic
 15398 rs33991472 GRCh37: 11:5247946-5247946
GRCh38: 11:5226716-5226716
16 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.380T>G (p.Val127Gly) SNV Pathogenic
 15483 rs33925391 GRCh37: 11:5246892-5246892
GRCh38: 11:5225662-5225662
17 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.51del (p.Lys18fs) DEL Pathogenic
 15414 rs35662066 GRCh37: 11:5248201-5248201
GRCh38: 11:5226971-5226971
18 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.70G>A (p.Val24Ile) SNV Pathogenic
 478897 rs33929459 GRCh37: 11:5248182-5248182
GRCh38: 11:5226952-5226952
19 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.85dup (p.Leu29fs) DUP Pathogenic
 15432 rs35532010 GRCh37: 11:5248166-5248167
GRCh38: 11:5226936-5226937
20 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.130G>T (p.Glu44Ter) SNV Pathogenic
 15406 rs33922842 GRCh37: 11:5247992-5247992
GRCh38: 11:5226762-5226762
21 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.82G>T (p.Ala28Ser) SNV Pathogenic
 15239 rs35424040 GRCh37: 11:5248170-5248170
GRCh38: 11:5226940-5226940
22 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.1A>G (p.Met1Val) SNV Pathogenic
 439140 rs34563000 GRCh37: 11:5248251-5248251
GRCh38: 11:5227021-5227021
23 HBB, LOC106099062, LOC107133510 NM_000518.4(HBB):c.-137C>T SNV Pathogenic
 36287 rs33941377 GRCh37: 11:5248388-5248388
GRCh38: 11:5227158-5227158
24 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.36del (p.Thr13fs) DEL Pathogenic
 15423 rs34856846 GRCh37: 11:5248216-5248216
GRCh38: 11:5226986-5226986
25 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.436T>A (p.Tyr146Asn) SNV Pathogenic
 633256 rs33949869 GRCh37: 11:5246836-5246836
GRCh38: 11:5225606-5225606
26 HBB, LOC106099062, LOC107133510 NM_000518.5(HBB):c.-138C>T SNV Pathogenic
 15460 rs33944208 GRCh37: 11:5248389-5248389
GRCh38: 11:5227159-5227159
27 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.112del (p.Trp38fs) DEL Pathogenic
 15431 rs63750532 GRCh37: 11:5248010-5248010
GRCh38: 11:5226780-5226780
28 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.114G>A (p.Trp38Ter) SNV Pathogenic
 15405 rs33974936 GRCh37: 11:5248008-5248008
GRCh38: 11:5226778-5226778
29 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.79G>T (p.Glu27Ter) SNV Pathogenic
 38650 rs33950507 GRCh37: 11:5248173-5248173
GRCh38: 11:5226943-5226943
30 HBB, LOC106099062, LOC107133510 NM_000518.5(HBB):c.-138C>A SNV Pathogenic
 393701 rs33944208 GRCh37: 11:5248389-5248389
GRCh38: 11:5227159-5227159
31 LOC106099062, HBB, LOC107133510 NM_000518.4(HBB):c.277C>A (p.His93Asn) SNV Pathogenic
 15494 rs33924775 GRCh37: 11:5247845-5247845
GRCh38: 11:5226615-5226615
32 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.404T>A (p.Val135Glu) SNV Pathogenic
 15290 rs33966761 GRCh37: 11:5246868-5246868
GRCh38: 11:5225638-5225638
33 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.199A>G (p.Lys67Glu) SNV Pathogenic
 15206 rs34165323 GRCh37: 11:5247923-5247923
GRCh38: 11:5226693-5226693
34 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.257T>C (p.Phe86Ser) SNV Pathogenic
 15122 rs35693898 GRCh37: 11:5247865-5247865
GRCh38: 11:5226635-5226635
35 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.328G>A (p.Val110Met) SNV Pathogenic
 15342 rs33969677 GRCh37: 11:5246944-5246944
GRCh38: 11:5225714-5225714
36 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.389C>T (p.Ala130Val) SNV Likely Pathogenic
 15245 rs111645889 GRCh37: 11:5246883-5246883
GRCh38: 11:5225653-5225653
37 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.316-1G>A SNV Likely Pathogenic
 552712 rs33952266 GRCh37: 11:5246957-5246957
GRCh38: 11:5225727-5225727
38 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.155del (p.Pro52fs) DEL Likely Pathogenic
 38659 rs63750128 GRCh37: 11:5247967-5247967
GRCh38: 11:5226737-5226737
39 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.8del (p.His3fs) DEL Likely Pathogenic
 869242 rs1847589398 GRCh37: 11:5248244-5248244
GRCh38: 11:5227014-5227014
40 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.440_441dup (p.Ter148ThrextTer?) DUP Likely Pathogenic
 439161 rs33999427 GRCh37: 11:5246830-5246831
GRCh38: 11:5225600-5225601
41 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.126dup (p.Phe43fs) DUP Likely Pathogenic
 1098798 GRCh37: 11:5247995-5247996
GRCh38: 11:5226765-5226766
42 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.292_295dup (p.Val99fs) DUP Likely Pathogenic
 619685 rs1564874901 GRCh37: 11:5247826-5247827
GRCh38: 11:5226596-5226597
43 LOC106099062, HBB, LOC107133510 NM_000518.5(HBB):c.176del (p.Pro59fs) DEL Likely Pathogenic
 632845 rs35395625 GRCh37: 11:5247946-5247946
GRCh38: 11:5226716-5226716
44 LOC110006319, HBB, LOC107133510 NM_000518.4(HBB):c.374C>G (p.Pro125Arg) SNV Likely Pathogenic
 15238 rs33983276 GRCh37: 11:5246898-5246898
GRCh38: 11:5225668-5225668
45 LOC110006319, HBB, LOC107133510 NM_000518.5(HBB):c.396_397del (p.Lys133fs) DEL Likely Pathogenic
 928758 rs63750320 GRCh37: 11:5246875-5246876
GRCh38: 11:5225645-5225646
Sources

Expression for Hemoglobinopathy

About this section
Search GEO for disease gene expression data for Hemoglobinopathy.
Sources

Pathways for Hemoglobinopathy

About this section

Pathways related to Hemoglobinopathy according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1
Response to elevated platelet cytosolic Ca2+ 66
Show member pathways
 12.86 TF PECAM1 HBG1 HBE1 HBD HBB
2
HIF-1-alpha transcription factor network 61
11.25 TFRC TF EPO
3
Binding and Uptake of Ligands by Scavenger Receptors 66
Show member pathways
 10.88 HP HBB HBA2 HBA1
4
O2/CO2 exchange in erythrocytes 66
Show member pathways
 10.69 HBB HBA2 HBA1
5
Methylene Blue Pathway, Pharmacodynamics 60
9.76 G6PD CYB5R3
Sources

GO Terms for Hemoglobinopathy

About this section

Cellular components related to Hemoglobinopathy according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 extracellular space GO:0005615 10.32 VCAM1 TFRC TF PECAM1 HP HBB
2 blood microparticle GO:0072562 10.06 HBA1 HBA2 HBB HBD HBE1 HP
3 endocytic vesicle lumen GO:0071682 9.86 HP HBB HBA2 HBA1
4 haptoglobin-hemoglobin complex GO:0031838 9.8 HP HBG1 HBE1 HBD HBB HBA2
5 HFE-transferrin receptor complex GO:1990712 9.67 TFRC TF
6 hemoglobin complex GO:0005833 9.47 HBG1 HBE1 HBD HBB HBA2 HBA1

Biological processes related to Hemoglobinopathy according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 cellular oxidant detoxification GO:0098869 10.17 HP HBG1 HBE1 HBD HBB HBA2
2 hydrogen peroxide catabolic process GO:0042744 10.03 HBA1 HBA2 HBB HBD HBE1 HBG1
3 response to hydrogen peroxide GO:0042542 10.01 HP HBB HBA2 HBA1
4 positive regulation of cell death GO:0010942 10 HP HBG1 HBE1 HBD HBB HBA2
5 acute-phase response GO:0006953 9.91 TFRC HP EPO
6 response to nutrient GO:0007584 9.85 VCAM1 TFRC EPO
7 nitric oxide transport GO:0030185 9.85 HBA1 HBA2 HBB
8 oxygen transport GO:0015671 9.73 HBA1 HBA2 HBB HBD HBE1 HBG1
9 carbon dioxide transport GO:0015670 9.4 HBG1 HBE1 HBD HBB HBA2 HBA1

Molecular functions related to Hemoglobinopathy according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 heme binding GO:0020037 10.18 HBG1 HBE1 HBD HBB HBA2 HBA1
2 peroxidase activity GO:0004601 10.1 HBG1 HBE1 HBD HBB HBA2 HBA1
3 oxygen binding GO:0019825 10.03 HBA1 HBA2 HBB HBD HBE1 HBG1
4 hemoglobin alpha binding GO:0031721 9.97 HBB HBD HBE1 HBG1
5 oxygen carrier activity GO:0005344 9.93 HBG1 HBE1 HBD HBB HBA2 HBA1
6 hemoglobin binding GO:0030492 9.73 HP HBB
7 haptoglobin binding GO:0031720 9.73 HBA1 HBA2 HBB HBD HBE1 HBG1
8 organic acid binding GO:0043177 9.4 HBA1 HBA2 HBB HBD HBE1 HBG1
Sources

Sources for Hemoglobinopathy

About this section
2 CDC
6 CNVD
8 Cosmic
9 dbSNP
10 DGIdb
16 EFO
17 ExPASy
18 FMA
19 GARD
27 GO
28 GTR
29 HMDB
30 HPO
31 ICD10
32 ICD10 via Orphanet
33 ICD11
34 ICD9CM
35 IUPHAR
36 LifeMap
38 LOVD
40 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
52 NINDS
53 Novoseek
55 ODiseA
56 OMIM via Orphanet
57 OMIM® (Updated 08-Dec-2022)
61 PubChem
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 Tocris
71 UMLS
72 UMLS via Orphanet
The MalaCards human disease database index: 1-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Content
Loading form....