Home
User Guide
What's in a MalaCard Search Guide Our Sources
Analysis Tools
GeneCards GeneAnalytics GeneAlaCart PathCards VarElect
News and Views Disease Lists/Categories
About
About MalaCards Datasets Our Publications Weizmann Institute LifeMap Discovery® Terms of Use MalaCards Team
MCID: HMG005
MIFTS: 55

Hemoglobinopathy

Categories: Blood diseases, Rare diseases
Genes Variations Tissues Related diseases Publications Pathways Symptoms & Phenotypes Drugs
Sources

Aliases & Classifications for Hemoglobinopathy

About this section

MalaCards integrated aliases for Hemoglobinopathy:

Name: Hemoglobinopathy 12 73 20 58 29 6 15
Hemoglobinopathies 12 54 3 44 15 70

Classifications:

MalaCards categories:
Global: Rare diseases
Anatomical: Blood diseases
See all MalaCards categories (disease lists)
ICD10: 32 33
Orphanet: 58  
Rare haematological diseases


External Ids:

Disease Ontology 12 DOID:2860
MeSH 44 D006453
NCIt 50 C3092
SNOMED-CT 67 154794008
ICD10 32 D58.2
MESH via Orphanet 45 D006453
UMLS via Orphanet 71 C0019045
Orphanet 58 ORPHA68364
UMLS 70 C0019045
Sources

Summaries for Hemoglobinopathy

About this section
CDC : 3 Hemoglobinopathies is the medical term for a group of blood disorders and diseases that affect red blood cells. These disorders include both sickle cell disease (SCD) and thalassemia. Hemoglobinopathies monitoring means finding out the number of people with these conditions and how having a hemoglobinopathy affects their health, so that researchers and health care providers can ultimately improve the health of people with hemoglobinopathies.

MalaCards based summary : Hemoglobinopathy, also known as hemoglobinopathies, is related to methemoglobinemia, beta-globin type and heinz body anemias, and has symptoms including cyanosis An important gene associated with Hemoglobinopathy is HBB (Hemoglobin Subunit Beta), and among its related pathways/superpathways are Glucose / Energy Metabolism and Binding and Uptake of Ligands by Scavenger Receptors. The drugs Peginterferon alfa-2a and Peginterferon alfa-2b have been mentioned in the context of this disorder. Affiliated tissues include bone, bone marrow and t cells, and related phenotype is liver/biliary system.

Wikipedia : 73 Hemoglobinopathy is the medical term for a group of blood disorders and diseases that affect red blood... more...

Sources

Related Diseases for Hemoglobinopathy

About this section

Diseases related to Hemoglobinopathy via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 353)
# Related Disease Score Top Affiliating Genes
1 methemoglobinemia, beta-globin type 32.3 LOC110006319 LOC107133510 LOC106099062 HBB HBA2 HBA1
2 heinz body anemias 32.2 LOC110006319 LOC107133510 LOC106099062 HP HBB HBA2
3 thalassemia 31.7 LOC110006319 LOC107133510 LOC106099062 HBG1 HBD HBB
4 sickle cell disease 31.1 UGT1A1 LOC110006319 LOC107133510 LOC106099062 HP HBG1
5 sickle cell anemia 31.0 UGT1A1 LOC110006319 LOC107133510 LOC106099062 HBG1 HBB
6 beta-thalassemia major 31.0 LOC110006319 LOC107133510 LOC106099062 HFE HBB
7 hemoglobin e disease 31.0 LOC107133510 LOC106099062 KLF1 HBD HBB
8 splenomegaly 31.0 HBA2 HBA1 EPO
9 rare hereditary hemochromatosis 31.0 TFR2 HJV HFE HAMP
10 beta-thalassemia intermedia 30.9 LOC110006319 LOC107133510 LOC106099062 HBB
11 iron metabolism disease 30.9 TFR2 HJV HFE HBB HAMP G6PD
12 hemosiderosis 30.8 TFR2 HP HJV HFE HAMP EPO
13 hemoglobin d disease 30.8 LOC110006319 LOC107133510 HBD HBB
14 beta-thalassemia 30.8 UGT1A1 TFR2 LOC110006319 LOC107133510 LOC106099062 KLF1
15 cholelithiasis 30.7 UGT1A1 HP HBB
16 splenic infarction 30.7 LOC107133510 LOC106099062 HBB
17 hemoglobin c disease 30.7 LOC107133510 LOC106099062 HBD HBB
18 hemolytic anemia 30.6 UGT1A1 LOC107133510 LOC106099062 KLF1 HP HFE
19 bilirubin metabolic disorder 30.6 UGT1A1 HP G6PD EPO
20 alpha-thalassemia 30.6 UGT1A1 LOC110006319 LOC107133510 LOC106099062 KLF1 HP
21 hypochromic microcytic anemia 30.6 HJV HBB HBA2 HBA1 HAMP ALAS2
22 thalassemia minor 30.5 UGT1A1 LOC107133510 LOC106099062 KLF1 HBD HBB
23 splenic sequestration 30.5 HP HBB EPO
24 polycythemia 30.5 HBB HBA2 HAMP EPO
25 iron deficiency anemia 30.4 TFR2 HJV HFE HBA1 HAMP G6PD
26 plasmodium falciparum malaria 30.4 HP HBB G6PD
27 microcytic anemia 30.4 TFR2 HJV HBA2 HBA1 HAMP G6PD
28 methemoglobinemia 30.4 LOC107133510 LOC106099062 HP HBB HBA2 HBA1
29 hemoglobin e-beta-thalassemia syndrome 30.4 LOC107133510 LOC106099062 HBB
30 hemoglobin zurich 30.4 LOC107133510 LOC106099062 HBB HBA2
31 deficiency anemia 30.3 TFR2 LOC107133510 LOC106099062 KLF1 HP HJV
32 erythrocytosis, familial, 7 30.3 HBA2 HBA1
33 hereditary spherocytosis 30.3 UGT1A1 KLF1 HP HFE HBG1 HBB
34 neonatal anemia 30.3 KLF1 HBA2 EPO
35 acute erythroid leukemia 30.2 KLF1 HBG1 HBB EPO
36 fetal hemoglobin quantitative trait locus 1 30.2 LOC110006319 LOC107133510 LOC106099062 HBG1 HBD HBB
37 glucosephosphate dehydrogenase deficiency 30.2 UGT1A1 HP HBB G6PD
38 sideroblastic anemia 30.2 TFR2 HAMP ALAS2
39 gilbert syndrome 30.2 UGT1A1 HP HFE G6PD
40 inherited metabolic disorder 30.2 UGT1A1 TFR2 HJV HFE HAMP
41 arthropathy 30.0 HJV HFE HAMP
42 hemochromatosis, type 1 30.0 TFR2 HP HJV HFE HBB HAMP
43 hemoglobin h disease 30.0 KLF1 HBG1 HBD HBB HBA2 HBA1
44 congenital hemolytic anemia 29.9 KLF1 HP HBG1 HBD HBB HBA2
45 malaria 29.9 PECAM1 LOC110006319 LOC107133510 LOC106099062 HP HBB
46 diabetes mellitus 29.8 PECAM1 HP HFE HBB HBA1 G6PD
47 genetic hemoglobinopathy 11.0
48 hemoglobinopathy toms river 10.9
49 dehydrated hereditary stomatocytosis 1 with or without pseudohyperkalemia and/or perinatal edema 10.9
50 sickle cell - hemoglobin d disease 10.9

Graphical network of the top 20 diseases related to Hemoglobinopathy:



Diseases related to Hemoglobinopathy
Sources

Symptoms & Phenotypes for Hemoglobinopathy

About this section

UMLS symptoms related to Hemoglobinopathy:


cyanosis

MGI Mouse Phenotypes related to Hemoglobinopathy:

46
# Description MGI Source Accession Score Top Affiliating Genes
1 liver/biliary system MP:0005370 9.17 EPO HFE HJV HP KLF1 PECAM1
Sources

Drugs & Therapeutics for Hemoglobinopathy

About this section

Drugs for Hemoglobinopathy (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 138)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Peginterferon alfa-2a Approved, Investigational Phase 4 198153-51-4 5360545
2
Peginterferon alfa-2b Approved Phase 4 99210-65-8, 215647-85-1
3
Deferasirox Approved, Investigational Phase 4 201530-41-8 5493381 214348
4 interferons Phase 4
5 Interferon alpha-2 Phase 4
6 Interferon-alpha Phase 4
7 Chelating Agents Phase 4
8 Iron Chelating Agents Phase 4
9
Vidarabine Approved, Investigational Phase 2, Phase 3 24356-66-9 21704 32326
10
Iron Approved Phase 3 7439-89-6 23925 29936
11
Deferiprone Approved Phase 3 30652-11-0 2972
12 Antiviral Agents Phase 2, Phase 3
13 penicillins Phase 3
14 Pharmaceutical Solutions Phase 3
15
Deferoxamine Approved, Investigational Phase 2 70-51-9 2973
16
rituximab Approved Phase 2 174722-31-7 10201696
17
Methylprednisolone Approved, Vet_approved Phase 2 83-43-2 6741
18
Prednisolone Approved, Vet_approved Phase 2 50-24-8 5755
19
Methylprednisolone hemisuccinate Approved Phase 2 2921-57-5
20
Acetaminophen Approved Phase 2 103-90-2 1983
21
Promethazine Approved, Investigational Phase 2 60-87-7 4927
22
Diphenhydramine Approved, Investigational Phase 2 58-73-1, 147-24-0 3100
23
Prednisolone phosphate Approved, Vet_approved Phase 2 302-25-0
24
Prednisolone acetate Approved, Vet_approved Phase 2 52-21-1
25
Hydroxyurea Approved Phase 1, Phase 2 127-07-1 3657
26
Thiotepa Approved, Investigational Phase 1, Phase 2 52-24-4 5453
27
Abatacept Approved Phase 1, Phase 2 332348-12-6 10237
28
Methotrexate Approved Phase 2 1959-05-2, 59-05-2 126941
29
Treosulfan Approved, Investigational Phase 2 299-75-2 9296
30
Levoleucovorin Approved, Investigational Phase 2 68538-85-2 149436
31
Melphalan Approved Phase 1, Phase 2 148-82-3 4053 460612
32
Fludarabine Approved Phase 2 21679-14-1, 75607-67-9 30751
33
Tacrolimus Approved, Investigational Phase 2 104987-11-3 6473866 445643 439492
34
Miconazole Approved, Investigational, Vet_approved Phase 2 22916-47-8 4189
35
Clotrimazole Approved, Vet_approved Phase 2 23593-75-1 2812
36
Mycophenolic acid Approved Phase 2 24280-93-1 446541
37
Busulfan Approved, Investigational Phase 2 55-98-1 2478
38
Cyclophosphamide Approved, Investigational Phase 2 50-18-0, 6055-19-2 2907
39
Prednisone Approved, Vet_approved Phase 2 53-03-2 5865
40
alemtuzumab Approved, Investigational Phase 2 216503-57-0
41
Sargramostim Approved, Investigational Phase 2 123774-72-1, 83869-56-1
42
Lenograstim Approved, Investigational Phase 2 135968-09-1
43
Phenytoin Approved, Vet_approved Phase 2 57-41-0 1775
44
Sirolimus Approved, Investigational Phase 2 53123-88-9 6436030 5284616
45
Levetiracetam Approved Phase 2 102767-28-2 441341
46
Pyridoxine Approved, Investigational, Nutraceutical, Vet_approved Phase 2 65-23-6 1054
47
Folic acid Approved, Nutraceutical, Vet_approved Phase 2 59-30-3 6037
48
Prednisolone hemisuccinate Experimental Phase 2 2920-86-7
49
Molgramostim Investigational Phase 2 99283-10-0
50 Vitamin B 6 Phase 2

Interventional clinical trials:

(show top 50) (show all 82)
# Name Status NCT ID Phase Drugs
1 Phase IV Study of Effectiveness of Interferon and Ribavirin Treatment in Thalassemia Major Patients With Chronic Viral Hepatitis C Unknown status NCT00887081 Phase 4 PEG-IFN alpha2a or PEG-IFN alpha2b and Ribavirin
2 A Study of Magnetic Resonance Imaging Assessment of Cardiac and Liver Iron Load in Patients With Haemoglobinopathies, Myelodysplastic Syndromes (MDS) or Other Anaemias Treated With Exjade® (Deferasirox) (The MILE Study) Completed NCT00673608 Phase 4 deferasirox
3 Allogeneic Hematopoietic Stem Cell Transplant for Patients With High Risk Hemoglobinopathy Using a Preparative Regimen to Achieve Stable Mixed Chimerism Completed NCT00176852 Phase 2, Phase 3 Busulfan, Fludarabine, ATG, TLI;Busulfan, Cyclophosphamide, ATG, GCSF;Campath, Fludarabine, Cyclophosphamide
4 Stroke Prevention in Sickle Cell Anemia (STOP 1) Completed NCT00000592 Phase 3
5 Penicillin Prophylaxis in Sickle Cell Disease (PROPS) Completed NCT00000585 Phase 3 penicillin
6 Multicentre, Randomised, Open Label, Non-inferiority Trial to Evaluate the Efficacy and Safety of Deferiprone Compared to Deferasirox in Patients Aged From 1 Month to Less Than 18 Years Affected by Transfusion Dependent Haemoglobinopathies Completed NCT01825512 Phase 3 Deferiprone;Deferasirox
7 Multicenter Study of Hydroxyurea in Patients With Sickle Cell Anemia (MSH) Completed NCT00000586 Phase 3 hydroxyurea
8 Reduced Intensity Stem Cell Transplant in Children and Young Adults Utilizing Photopheresis, Fludarabine, and Busulfan Completed NCT00179790 Phase 1, Phase 2
9 A Multiple-dose, Subject- and Investigator-blinded, Placebo-controlled, Parallel Design Study to Assess the Efficacy, Safety and Tolerability of ACZ885 (Canakinumab) in Pediatric and Young Adult Patients With Sickle Cell Anemia Completed NCT02961218 Phase 2 ACZ885;Placebo
10 Multi-Center Study Using Allogeneic Stem Cell Transplantation Following Reduced Intensity Chemotherapy in Patients With Hemoglobinopathies Completed NCT00153985 Phase 2 Busulfex;Fludarabine;Alemtuzumab
11 Allogeneic Mixed Chimerism Stem Cell Transplantation Utilizing In Vivo and In Vitro Campath for Hemoglobinopathies and Bone Marrow Failure Syndromes Completed NCT00004143 Phase 2 Campath, Chemo and/or TBI Allo SCT
12 ALLOGENEIC HEMATOPOIETIC STEM CELL TRANSPLANTATION (HSCT) IN PATIENTS WITH HIGH RISK HEMOGLOBINOPATHIES LIKE SICKLE CELL DISEASE AND β-THALESSEMIA-MAJOR USING REDUCED INTENSITY CONDITIONING REGIMEN Completed NCT02435901 Phase 1, Phase 2 alemtuzumab (Campath IH);Fludarabine;Melphalan;Cyclosporine;Mycophenolate mofetil;Tacrolimus
13 A Phase 1/2 Open Label Study Evaluating the Safety and Efficacy of Gene Therapy of the β-Hemoglobinopathies (Sickle Cell Anemia and β-Thalassemia Major) by Transplantation of Autologous CD34+ Stem Cells Transduced Ex Vivo With a Lentiviral β-A-T87Q Globin Vector (LentiGlobin BB305 Drug Product) Completed NCT02151526 Phase 1, Phase 2 LentiGlobin BB305 Drug Product
14 Phase I/II Pilot Study of Mixed Chimerism to Treat Hemoglobinopathies Completed NCT00777231 Phase 1, Phase 2
15 Effect of Hydroxyurea on the Level of Ineffective Erythropoiesis, Transfusion Requirement, and Fetal Hemoglobin Synthesis in Patients With Beta-Thalassemia-Intermedia Completed NCT00001958 Phase 2 Hydroxyurea
16 Evaluation of Subcutaneous Desferrioxamine as Treatment for Transfusional Hemochromatosis Completed NCT00000595 Phase 2 deferoxamine
17 Chelation Therapy of Iron Overload With Pyridoxal Isonicotinoyl Hydrazone Completed NCT00000588 Phase 2 chelation therapy
18 Pediatric Hydroxyurea in Sickle Cell Anemia (PED HUG) Completed NCT00000602 Phase 2 hydroxyurea
19 Multi-centre, Oral Single Dose Experimental and Modelling Study to Evaluate the Pharmacokinetics of Deferiprone in Patients Aged From 1 Month to Less Than 6 Years of Age Affected by Transfusion-dependent Haemoglobinopathies. Completed NCT01740713 Phase 2 Deferiprone, dose level 1;Deferiprone, dose level 2;Deferiprone, dose level 3
20 A Prospective Study of Optimal Cord Selection for Haplo-Cord Transplantation: Targeting the Inherited Paternal Antigen (IPA) and Matching for the Non-Inherited Maternal Antigen (NIMA) Recruiting NCT01810588 Phase 2 Fludarabine;Melphalan;anti-thymocyte globulin (rabbit);Rituximab;Mycophenolate Mofetil;Tacrolimus
21 Study of TCR Alpha Beta T-Cell and CD19 B-Cell Depletion for Hematopoietic Cell Transplantation From Haploidentical Donors in the Treatment of Non-Malignant Hematological Disorders in Children Recruiting NCT04356469 Phase 2
22 Cord Blood Transplantation in Children and Young Adults With Hematologic Malignancies and Non-malignant Disorders Recruiting NCT04644016 Phase 2 Clofarabine;Fludarabine;Busulfan;Cyclosporine-A;Mycophenolate Mofetil
23 A Phase 1/2 Study of the Safety and Efficacy of a Single Dose of Autologous CRISPR-Cas9 Modified CD34+ Human Hematopoietic Stem and Progenitor Cells (hHSPCs) in Subjects With Transfusion-Dependent β-Thalassemia Recruiting NCT03655678 Phase 1, Phase 2
24 A Phase I/II Trial of Reduced Intensity Conditioning and Familial HLA-Mismatched Bone Marrow Transplantation in Children With Non-Malignant Disorders Recruiting NCT03128996 Phase 1, Phase 2 RIC regimen;GVHD prophylaxis regimen
25 A Phase 1/2 Study to Evaluate the Safety and Efficacy of a Single Dose of Autologous CRISPR-Cas9 Modified CD34+ Human Hematopoietic Stem and Progenitor Cells (CTX001) in Subjects With Severe Sickle Cell Disease Recruiting NCT03745287 Phase 1, Phase 2
26 Reduced Intensity Conditioning (RIC) Regimen for Patients With Non-malignant Disorders Recruiting NCT01050855 Phase 2 RIC: Distal Campath;RIC:Intermediate Campath;RIC: Mini Busulfan
27 A Study of Hematopoietic Stem Cell Transplantation (HSCT) in Non-Malignant Disease Using a Reduced-Intensity Preparatory Regime Recruiting NCT00920972 Phase 1, Phase 2 Treatment Plan 1: Stratum 1;Treatment Plan 2: Strata 2, 3, or 4;GVHD Regimen A: UCB Recipients;GVHD Regimen B: BM Recipients
28 Allogeneic Hematopoietic Cell Transplantation for Patients With Nonmalignant Inherited Disorders Using a Treosulfan Based Preparative Regimen Active, not recruiting NCT00919503 Phase 2 Cyclosporine;Fludarabine Phosphate;Methotrexate;Mycophenolate Mofetil;Tacrolimus;Treosulfan
29 Gene Transfer for Patients With Sickle Cell Disease Using a Gamma Globin Lentivirus Vector: An Open Label Phase 1/2 Pilot Study Active, not recruiting NCT02186418 Phase 1, Phase 2
30 Phase II Extension Study of CaspaCIDe T Cells (BPX-501) From an HLA-partially Matched Family Donor After Negative Selection of TCR αβ+T Cells in Pediatric Patients Affected by Hematological Disorders Active, not recruiting NCT02065869 Phase 2 rimiducid
31 Allogeneic Stem Cell Transplantation of NiCord®, Umbilical Cord Blood-Derived Ex Vivo Expanded Stem and Progenitor Cells, in Patients With Hemoglobinopathies Active, not recruiting NCT01590628 Phase 1, Phase 2 NiCord
32 Clinical Phase II Trial to Compare Treosulfan-based Conditioning Therapy With Busulfan-based Conditioning Prior to Allogeneic Haematopoietic Stem Cell Transplantation (HSCT) in Paediatric Patients With Non-malignant Diseases Active, not recruiting NCT02349906 Phase 2 Treosulfan;Busilvex
33 Phase I/II Study of CaspaCIDe® T Cells From an HLA-Partially Matched Family Donor After Negative Selection of TCR αβ+T Cells in Pediatric Patients Affected by Hematological Disorders Active, not recruiting NCT03301168 Phase 1, Phase 2 Rimiducid
34 CD34+ Stem Cell Selection for Patients Receiving a Matched or Partially Matched Family or Unrelated Adult Donor Allogeneic Stem Cell Transplantation for Non-Malignant Disease Active, not recruiting NCT01966367 Phase 1, Phase 2
35 Follow-up of Phase 1/2 Study of CaspaCIDe T Cells (BPX-501) From an HLA-partially Matched Family Donor After Negative Selection of TCR αβ+T Cells in Pediatric Patients Affected by Hematological Disorders Enrolling by invitation NCT03733249 Phase 1, Phase 2 Rimiducid
36 Phase I/II Pilot Study of Mixed Chimerism to Treat Hemoglobinopathies Suspended NCT01419704 Phase 1, Phase 2
37 Allogeneic Stem Cell Transplantation Following Nonmyeloablative Chemotherapy in Patients With Hemoglobinopathies Terminated NCT00034528 Phase 2 Busulfan;Fludarabine;FK506;Prednisone
38 Allogeneic Bone Marrow Transplant From HLA Identical Related Donors for Patients With High Risk Hemoglobinopathies: Hemoglobin SS, Hemoglobin SC, Hemoglobin SB0/+ Thalassemia, or Homozygous B0/+ Thalassemia or Severe Variants of B0/+ Thalassemia Terminated NCT00040469 Phase 2 Campath -1H;Dilantin;Busulfan;Cyclophosphamide
39 Allo SCT From HLA Haploidentical Related Donors Using Sub-Myeloablative Conditioning For Patients With High Risk Hemoglobinopathies: Hemo SS, Hemo SC, Hemo SB0/+ Thalassemia, Homozygous B0/+ Thalassemia or Severe B0/+ Thalassemia Variants Terminated NCT00040417 Phase 2 FLUDARABINE;CAMPATH-IH;FK506;G-SCF (Granulocyte-colony stimulating factor)
40 Allogeneic Stem Cell Transplantation of CordInâ„¢, Umbilical Cord Blood-Derived Ex Vivo Expanded Stem and Progenitor Cells, in Patients With Hemoglobinopathies Terminated NCT02504619 Phase 1, Phase 2
41 A Phase II Trial of Non-Myeloablative Conditioning and Transplantation of Partially HLA-Mismatched and HLA-Matched Bone Marrow for Patients With Sickle Cell Anemia and Other Hemoglobinopathies Terminated NCT00489281 Phase 2 Cyclophosphamide;Fludarabine;Mycophenolate mofetil;Sirolimus;Levetiracetam
42 A Phase II Study Using the CliniMACS® Device for CD34+ Cell Selection and T Cell Depletion for Graft-versus-Host Disease Prophylaxis in Alternative Donor Stem Cell Transplant Recipients Terminated NCT00968864 Phase 2
43 A Pilot Study of Reduced Intensity Conditioning in Pediatric Patients <21 Years of Age With Non-Malignant Disorders Undergoing Umbilical Cord Blood Transplantation Completed NCT00744692 Phase 1 Reduced Intensity Conditioning
44 A Single-Center, Non-Randomized Study of the Safety and Efficacy of In Utero Hematopoietic Stem Cell Transplantation for the Treatment of Fetuses With Alpha Thalassemia Major Recruiting NCT02986698 Phase 1
45 Pilot Study to Evaluate the Safety and Feasibility of Induction of Mixed Chimerism in Sickle Cell Disease Patients With COH-MC-17: a Non-Myeloablative, Conditioning Regimen and CD4+ T-cell-depleted Haploidentical Hematopoietic Transplant Recruiting NCT03249831 Phase 1 Cyclophosphamide;Pentostatin;Rabbit anti-thymocyte globulin;Tacrolimus;Mycophenolate mofetil
46 A Study Evaluating BPX-501 T Cells and AP1903 for Prevention of Graft Versus Host Disease (GVHD) After Haploidentical, Related, T Cell-Depleted Hematopoietic Cell Transplantation for Non-Malignant Diseases Active, not recruiting NCT02231710 Phase 1
47 The Validity of Kleinhauer Betke in Women With Known Hemoglobinopathy for Fetal-maternal Hemorrhage Unknown status NCT03591640
48 Sickle Cell Hemoglobinopathies and Bone Heath Unknown status NCT02306993
49 Utility of Transient Elastography (Fibroscan) in Estimating Hepatic Iron Concentration in Comparison to MRI in Patients With Transfusion Dependent Hemoglobinopathies Unknown status NCT02067130
50 Characteristics of Hgb C Carriers in Northern Israel and Clinical Features Among Hgb Homozygous Completed NCT00481260

Search NIH Clinical Center for Hemoglobinopathy

Cochrane evidence based reviews: hemoglobinopathies

Sources

Genetic Tests for Hemoglobinopathy

About this section

Genetic tests related to Hemoglobinopathy:

# Genetic test Affiliating Genes
1 Hemoglobinopathy 29
Sources

Anatomical Context for Hemoglobinopathy

About this section

MalaCards organs/tissues related to Hemoglobinopathy:

40
Bone, Bone Marrow, T Cells, Liver, Heart, Endothelial, Spleen
Sources

Publications for Hemoglobinopathy

About this section

Articles related to Hemoglobinopathy:

(show top 50) (show all 4437)
# Title Authors PMID Year
1
Hemoglobinopathies in North Africa: a review. 54 6 61
20113284 2010
2
Molecular Characteristics of Hb New York [β113(G15)Val→Glu, HBB: c.341T>A] in Thailand. 6 61
29464999 2018
3
Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population. 61 6
27828729 2017
4
Report on Ten Years' Experience of Premarital Hemoglobinopathy Screening at a Center in Antalya, Southern Turkey. 6 61
27207683 2016
5
Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations. 61 6
26635043 2016
6
Detection of germline rearrangements in patients with α- and β-thalassemia using high resolution array CGH. 6 61
23491071 2013
7
Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China. 61 6
23383304 2013
8
A novel sickling hemoglobinopathy. 6 61
22010933 2011
9
Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach. 61 6
21423179 2011
10
Molecular basis of β-thalassemia in the United Arab Emirates. 61 6
22074124 2011
11
Comprehensive and efficient HBB mutation analysis for detection of beta-hemoglobinopathies in a pan-ethnic population. 6 61
20395516 2010
12
Combination of Hb Knossos [Cod 27 (G-T)] and IVSII-745 (C-G) in a Turkish patient with beta-thalassemia major. 6 61
17949282 2007
13
The prevalence and molecular basis of hemoglobinopathies in Cambodia. 6 61
16987801 2006
14
Reliability of DHPLC in mutational screening of beta-globin (HBB) alleles. 61 6
11857746 2002
15
Molecular and population genetic analyses of beta-thalassemia in Turkey. 61 6
9495372 1998
16
Hb Osler [beta 145(HC2)Tyr-->Asp] results from posttranslational modification. 6 61
9101280 1997
17
Two missense mutations in the beta-globin gene can cause severe beta thalassemia. Hemoglobin Medicine Lake (beta 32[B14]leucine-->glutamine; 98 [FG5] valine-->methionine). 6 61
7860732 1995
18
Molecular epidemiological and hematological profile of thalassemia in the Dongguan Region of Guangdong Province, Southern China. 6
32986258 2021
19
Clinical Laboratory Manifestation and Molecular Diagnosis of β-Thalassemia Patients in Iraq. 6
31714438 2020
20
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. 6
28603845 2017
21
Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil. 6
28366028 2017
22
Mutation in a Highly Conserved COOH-Terminal Residue of Krüppel-Like Factor 1 Associated with Elevated Hb F in a Compound Heterozygous β-Thalassemia Patient with a Nontransfusion-Dependent Thalassemia Phenotype. 6
27821015 2016
23
The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon. 6
26372288 2016
24
Spectrum of α-thalassemia and β-thalassemia mutations in the Guilin Region of southern China. 6
26079343 2015
25
Hb Knossos: HBB:c.82G>T Associated with HBB:c.315+1G>A Beta Zero Mutation Causes Thalassemia Intermedia. 6
25332589 2014
26
Spectrum of Beta Globin Gene Mutations in Egyptian Children with β-Thalassemia. 6
25408857 2014
27
Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations. 6
24828949 2014
28
High resolution melting analysis: a rapid screening and typing tool for common β-thalassemia mutation in Chinese population. 6
25089872 2014
29
Genotyping of beta thalassemia trait by high-resolution DNA melting analysis. 6
24450243 2013
30
The spectrum of β-thalassemia mutations in Gaza Strip, Palestine. 6
23321370 2013
31
An empirical estimate of carrier frequencies for 400+ causal Mendelian variants: results from an ethnically diverse clinical sample of 23,453 individuals. 6
22975760 2013
32
Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population. 6
22392582 2012
33
Experience with multiplex ARMS (MARMS)-PCR for the detection of common β-thalassemia mutations in India. 6
22239493 2012
34
Molecular characteristics of three hemoglobin variants observed in a Chinese population: Hb Ube-1 [β98 (FG5) Val→Met], Hb Ube‑2 [α68 (E17) Asn→Asp] and Hb Ube‑4 [α116 (GH4) Glu→Ala]. 6
21523319 2011
35
Mechanism of escape from nonsense-mediated mRNA decay of human beta-globin transcripts with nonsense mutations in the first exon. 6
21389146 2011
36
Molecular lesion frequency of hemoglobin gene disorders in Taiwan. 6
21599435 2011
37
Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil. 6
21797703 2011
38
ThalassoChip, an array mutation and single nucleotide polymorphism detection tool for the diagnosis of β-thalassaemia. 6
20704537 2010
39
Phenotypic expression and origin of the rare beta-thalassemia splice site mutation HBB:c.315 + 1G>T. 6
20524821 2010
40
Clinical and haematological features in a compound heterozygote (HBB:c.92 + 5G > C/HBB:c.93-2A > C) case of thalassaemia major. 6
19486366 2010
41
Mutations of a country: a mutation review of single gene disorders in the United Arab Emirates (UAE). 6
20437613 2010
42
Abnormal hemoglobin phenotypes in carriers of mild anemia in Latin America. 6
20309827 2010
43
Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques. 6
19437135 2010
44
Profiling β-thalassaemia mutations in India at state and regional levels: implications for genetic education, screening and counselling programmes. 6
21119755 2009
45
Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations. 6
19460936 2009
46
Regional heterogeneity of beta-thalassemia mutations in the multi ethnic Indian population. 6
19254853 2009
47
Impact of single nucleotide polymorphisms in HBB gene causing haemoglobinopathies: in silico analysis. 6
19429541 2009
48
Hydroxyurea in sickle cell disease--a study of clinico-pharmacological efficacy in the Indian haplotype. 6
18954999 2009
49
Molecular basis of beta-thalassemia in Morocco: possible origins of the molecular heterogeneity. 6
18976160 2008
50
Rapid genotyping of known mutations and polymorphisms in beta-globin gene based on the DHPLC profile patterns of homoduplexes and heteroduplexes. 6
18339318 2008
Sources

Variations for Hemoglobinopathy

About this section

ClinVar genetic disease variations for Hemoglobinopathy:

6 (show all 43)
# Gene Name Type Significance ClinVarId dbSNP ID Position
1 overlap with 2 genes NC_000011.9:g.(?_5246695)_(5255713_?)del Deletion Pathogenic 996224 GRCh37: 11:5246695-5255713
GRCh38:
2 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.127_129del (p.Phe43del) Deletion Pathogenic 15121 rs41417446 GRCh37: 11:5247993-5247995
GRCh38: 11:5226763-5226765
3 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.257T>C (p.Phe86Ser) SNV Pathogenic 15122 rs35693898 GRCh37: 11:5247865-5247865
GRCh38: 11:5226635-5226635
4 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.199A>G (p.Lys67Glu) SNV Pathogenic 15206 rs34165323 GRCh37: 11:5247923-5247923
GRCh38: 11:5226693-5226693
5 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.295G>A (p.Val99Met) SNV Pathogenic 15241 rs33933298 GRCh37: 11:5247827-5247827
GRCh38: 11:5226597-5226597
6 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.404T>A (p.Val135Glu) SNV Pathogenic 15290 rs33966761 GRCh37: 11:5246868-5246868
GRCh38: 11:5225638-5225638
7 LOC106099062 , HBB , LOC107133510 NM_000518.4(HBB):c.277C>A (p.His93Asn) SNV Pathogenic 15494 rs33924775 GRCh37: 11:5247845-5247845
GRCh38: 11:5226615-5226615
8 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.347C>A (p.Ala116Asp) SNV Pathogenic 15526 rs35485099 GRCh37: 11:5246925-5246925
GRCh38: 11:5225695-5225695
9 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.51del (p.Lys18fs) Deletion Pathogenic 15414 rs35662066 GRCh37: 11:5248201-5248201
GRCh38: 11:5226971-5226971
10 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.81G>C (p.Glu27Asp) SNV Pathogenic 599394 rs281864581 GRCh37: 11:5248171-5248171
GRCh38: 11:5226941-5226941
11 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.45dup (p.Trp16fs) Duplication Pathogenic 15426 rs35383398 GRCh37: 11:5248206-5248207
GRCh38: 11:5226976-5226977
12 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.*113A>G SNV Pathogenic 15473 rs33985472 GRCh37: 11:5246715-5246715
GRCh38: 11:5225485-5225485
13 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-137C>T SNV Pathogenic 36287 rs33941377 GRCh37: 11:5248388-5248388
GRCh38: 11:5227158-5227158
14 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.36del (p.Thr13fs) Deletion Pathogenic 15423 rs34856846 GRCh37: 11:5248216-5248216
GRCh38: 11:5226986-5226986
15 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.-29G>A SNV Pathogenic 393702 rs34704828 GRCh37: 11:5248280-5248280
GRCh38: 11:5227050-5227050
16 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.436T>A (p.Tyr146Asn) SNV Pathogenic 633256 rs33949869 GRCh37: 11:5246836-5246836
GRCh38: 11:5225606-5225606
17 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.*6C>G SNV Pathogenic 393707 rs34809925 GRCh37: 11:5246822-5246822
GRCh38: 11:5225592-5225592
18 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-138C>T SNV Pathogenic 15460 rs33944208 GRCh37: 11:5248389-5248389
GRCh38: 11:5227159-5227159
19 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.112del (p.Trp38fs) Deletion Pathogenic 15431 rs63750532 GRCh37: 11:5248010-5248010
GRCh38: 11:5226780-5226780
20 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.341T>A (p.Val114Glu) SNV Pathogenic 15286 rs34484056 GRCh37: 11:5246931-5246931
GRCh38: 11:5225701-5225701
21 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.129dup (p.Glu44Ter) Duplication Pathogenic 869297 GRCh37: 11:5247992-5247993
GRCh38: 11:5226762-5226763
22 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.71_73del (p.Val24del) Deletion Pathogenic 15166 rs34160180 GRCh37: 11:5248179-5248181
GRCh38: 11:5226949-5226951
23 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.176C>G (p.Pro59Arg) SNV Pathogenic 15398 rs33991472 GRCh37: 11:5247946-5247946
GRCh38: 11:5226716-5226716
24 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.380T>G (p.Val127Gly) SNV Pathogenic 15483 rs33925391 GRCh37: 11:5246892-5246892
GRCh38: 11:5225662-5225662
25 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.70G>A (p.Val24Ile) SNV Pathogenic 478897 rs33929459 GRCh37: 11:5248182-5248182
GRCh38: 11:5226952-5226952
26 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.85dup (p.Leu29fs) Duplication Pathogenic 15432 rs35532010 GRCh37: 11:5248166-5248167
GRCh38: 11:5226936-5226937
27 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.130G>T (p.Glu44Ter) SNV Pathogenic 15406 rs33922842 GRCh37: 11:5247992-5247992
GRCh38: 11:5226762-5226762
28 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.82G>T (p.Ala28Ser) SNV Pathogenic 15239 rs35424040 GRCh37: 11:5248170-5248170
GRCh38: 11:5226940-5226940
29 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.93-15T>G SNV Pathogenic 550356 rs35456885 GRCh37: 11:5248044-5248044
GRCh38: 11:5226814-5226814
30 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.235del (p.Leu79fs) Deletion Pathogenic 632846 rs281865475 GRCh37: 11:5247887-5247887
GRCh38: 11:5226657-5226657
31 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.93-2A>C SNV Pathogenic 439167 rs63750513 GRCh37: 11:5248031-5248031
GRCh38: 11:5226801-5226801
32 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.1A>G (p.Met1Val) SNV Pathogenic 439140 rs34563000 GRCh37: 11:5248251-5248251
GRCh38: 11:5227021-5227021
33 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-138C>A SNV Pathogenic 393701 rs33944208 GRCh37: 11:5248389-5248389
GRCh38: 11:5227159-5227159
34 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.114G>A (p.Trp38Ter) SNV Pathogenic 15405 rs33974936 GRCh37: 11:5248008-5248008
GRCh38: 11:5226778-5226778
35 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.79G>T (p.Glu27Ter) SNV Pathogenic 38650 rs33950507 GRCh37: 11:5248173-5248173
GRCh38: 11:5226943-5226943
36 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.*111A>G SNV Pathogenic 15488 rs63751128 GRCh37: 11:5246717-5246717
GRCh38: 11:5225487-5225487
37 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.292_295dup (p.Val99fs) Duplication Likely pathogenic 619685 rs1564874901 GRCh37: 11:5247826-5247827
GRCh38: 11:5226596-5226597
38 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.155del (p.Pro52fs) Deletion Likely pathogenic 38659 rs63750128 GRCh37: 11:5247967-5247967
GRCh38: 11:5226737-5226737
39 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.316-1G>A SNV Likely pathogenic 552712 rs33952266 GRCh37: 11:5246957-5246957
GRCh38: 11:5225727-5225727
40 LOC110006319 , HBB , LOC107133510 NM_000518.4(HBB):c.374C>G (p.Pro125Arg) SNV Likely pathogenic 15238 rs33983276 GRCh37: 11:5246898-5246898
GRCh38: 11:5225668-5225668
41 HBB , LOC106099062 , LOC107133510 NM_000518.5(HBB):c.-137C>A SNV Likely pathogenic 36285 rs33941377 GRCh37: 11:5248388-5248388
GRCh38: 11:5227158-5227158
42 LOC110006319 , HBB , LOC107133510 NM_000518.5(HBB):c.396_397del (p.Lys133fs) Deletion Likely pathogenic 928758 GRCh37: 11:5246875-5246876
GRCh38: 11:5225645-5225646
43 LOC106099062 , HBB , LOC107133510 NM_000518.5(HBB):c.176del (p.Pro59fs) Deletion Likely pathogenic 632845 rs35395625 GRCh37: 11:5247946-5247946
GRCh38: 11:5226716-5226716
Sources

Expression for Hemoglobinopathy

About this section
Search GEO for disease gene expression data for Hemoglobinopathy.
Sources

Pathways for Hemoglobinopathy

About this section

Pathways related to Hemoglobinopathy according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1
Glucose / Energy Metabolism 4
12.2 UGT1A1 HBG1 HBB G6PD
2
Binding and Uptake of Ligands by Scavenger Receptors 65
Show member pathways
 11.47 HP HBB HBA2 HBA1
3
African trypanosomiasis 36
11.07 HBB HBA2 HBA1
4
O2/CO2 exchange in erythrocytes 65
Show member pathways
 10.98 HBB HBA2 HBA1
5
Malaria 36
10.96 PECAM1 HBB HBA2 HBA1
6
Iron metabolism in placenta 1
10.45 TFR2 HAMP
7
Hfe effect on hepcidin production 1
9.64 HJV HFE HAMP
Sources

GO Terms for Hemoglobinopathy

About this section

Cellular components related to Hemoglobinopathy according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 extracellular space GO:0005615 10.02 PECAM1 HP HJV HFE HBB HBA2
2 blood microparticle GO:0072562 9.72 HP HBD HBB HBA2 HBA1
3 endocytic vesicle lumen GO:0071682 9.46 HP HBB HBA2 HBA1
4 HFE-transferrin receptor complex GO:1990712 9.43 TFR2 HJV HFE
5 hemoglobin complex GO:0005833 9.35 HBG1 HBD HBB HBA2 HBA1
6 haptoglobin-hemoglobin complex GO:0031838 9.1 HP HBG1 HBD HBB HBA2 HBA1

Biological processes related to Hemoglobinopathy according to GeneCards Suite gene sharing:

(show all 20)
# Name GO ID Score Top Affiliating Genes
1 receptor-mediated endocytosis GO:0006898 9.85 TFR2 HP HBB HBA2 HBA1
2 response to ethanol GO:0045471 9.76 UGT1A1 HAMP G6PD
3 response to hydrogen peroxide GO:0042542 9.73 HP HBB HBA2 HBA1
4 cellular oxidant detoxification GO:0098869 9.73 HP HBG1 HBD HBB HBA2 HBA1
5 cellular iron ion homeostasis GO:0006879 9.72 TFR2 HJV HFE HAMP ALAS2
6 positive regulation of cell death GO:0010942 9.71 HP HBB HBA2 HBA1
7 erythrocyte differentiation GO:0030218 9.7 KLF1 EPO ALAS2
8 bicarbonate transport GO:0015701 9.69 HBB HBA2 HBA1
9 iron ion homeostasis GO:0055072 9.67 TFR2 HJV HFE HAMP
10 response to iron ion GO:0010039 9.65 TFR2 HFE HAMP
11 response to vitamin A GO:0033189 9.59 HAMP EPO
12 cellular response to peptide GO:1901653 9.58 KLF10 KLF1
13 erythrocyte maturation GO:0043249 9.57 G6PD EPO
14 positive regulation of peptide hormone secretion GO:0090277 9.56 TFR2 HFE
15 cellular response to iron ion GO:0071281 9.55 TFR2 HFE
16 hydrogen peroxide catabolic process GO:0042744 9.55 HBG1 HBD HBB HBA2 HBA1
17 hemoglobin biosynthetic process GO:0042541 9.54 EPO ALAS2
18 response to iron ion starvation GO:1990641 9.49 HFE HAMP
19 oxygen transport GO:0015671 9.35 HBG1 HBD HBB HBA2 HBA1
20 acute-phase response GO:0006953 9.1 UGT1A1 TFR2 HP HFE HAMP EPO

Molecular functions related to Hemoglobinopathy according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 heme binding GO:0020037 9.8 HBG1 HBD HBB HBA2 HBA1
2 peroxidase activity GO:0004601 9.72 HBG1 HBD HBB HBA2 HBA1
3 oxygen binding GO:0019825 9.65 HBG1 HBD HBB HBA2 HBA1
4 oxygen carrier activity GO:0005344 9.55 HBG1 HBD HBB HBA2 HBA1
5 hemoglobin alpha binding GO:0031721 9.54 HBG1 HBD HBB
6 co-receptor binding GO:0039706 9.48 TFR2 HFE
7 transferrin receptor binding GO:1990459 9.46 HJV HFE
8 hemoglobin binding GO:0030492 9.43 HP HBB
9 organic acid binding GO:0043177 9.35 HBG1 HBD HBB HBA2 HBA1
10 haptoglobin binding GO:0031720 9.02 HBG1 HBD HBB HBA2 HBA1
Sources

Sources for Hemoglobinopathy

About this section
3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
20 GARD
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
53 NINDS
54 Novoseek
56 OMIM via Orphanet
57 OMIM® (Updated 05-Apr-2021)
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 Tocris
70 UMLS
71 UMLS via Orphanet
The MalaCards human disease database index: 1-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Content
Loading form....