MCID: HRD223
MIFTS: 39

Hereditary Melanoma

Categories: Cancer diseases, Genetic diseases, Rare diseases, Skin diseases

Aliases & Classifications for Hereditary Melanoma

MalaCards integrated aliases for Hereditary Melanoma:

Name: Hereditary Melanoma 52
Hereditary Cutaneous Melanoma 52 29 6
Hereditary Cutaneous Melanoma 52
Familial Cutaneous Melanoma 52
Familial Melanoma 52

Classifications:



Summaries for Hereditary Melanoma

MalaCards based summary : Hereditary Melanoma, also known as hereditary cutaneous melanoma, is related to melanoma, cutaneous malignant 1 and dysplastic nevus syndrome. An important gene associated with Hereditary Melanoma is CDKN2A (Cyclin Dependent Kinase Inhibitor 2A), and among its related pathways/superpathways are Human cytomegalovirus infection and Endometrial cancer. Affiliated tissues include testes, skin and pancreas, and related phenotype is pigmentation.

Related Diseases for Hereditary Melanoma

Diseases in the Melanoma family:

Hereditary Melanoma

Diseases related to Hereditary Melanoma via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 140)
# Related Disease Score Top Affiliating Genes
1 melanoma, cutaneous malignant 1 31.0 MDM2 CMM CDKN2A CDK4
2 dysplastic nevus syndrome 30.1 CMM CDKN2A
3 melanoma in congenital melanocytic nevus 29.4 CDKN2A CDK4
4 melanoma 29.3 MDM2 CMM CDKN2A CDK4
5 skin melanoma 29.2 MDM2 CDKN2A
6 li-fraumeni syndrome 28.8 MDM2 CDKN2A CDK4
7 melanoma, uveal 28.8 MDM2 CDKN2A CDK4
8 familial retinoblastoma 28.6 MDM2 CDKN2A CDK4
9 retinoblastoma 28.6 MDM2 CDKN2A CDK4
10 adenocarcinoma 28.4 MDM2 CDKN2A CDK4
11 pancreatic adenocarcinoma 28.4 MDM2 CDKN2A CDK4
12 leukemia, chronic lymphocytic 28.3 MDM2 CDKN2A CDK4
13 glioblastoma multiforme 28.0 MDM2 CDKN2A CDK4
14 melanoma, cutaneous malignant 10 10.4
15 melanoma, cutaneous malignant 2 10.1
16 nodular malignant melanoma 10.1 CDKN2A CDK4
17 brain stem glioma 10.0 CDKN2A CDK4
18 pancreatic cancer 9.9
19 esophagus verrucous carcinoma 9.9 MDM2 CDKN2A
20 verrucous carcinoma 9.9 MDM2 CDKN2A
21 inflammatory liposarcoma 9.9 MDM2 CDKN2A
22 ring chromosome 7 9.9 MDM2 CDK4
23 ring chromosome 9.9 MDM2 CDK4
24 adult astrocytic tumour 9.9 MDM2 CDKN2A
25 undifferentiated embryonal sarcoma of the liver 9.8 MDM2 CDK4
26 embryonal sarcoma 9.8 MDM2 CDK4
27 spindle cell liposarcoma 9.8 MDM2 CDK4
28 pediatric liposarcoma 9.8 MDM2 CDK4
29 infiltrating lipoma 9.8 MDM2 CDK4
30 gastric liposarcoma 9.8 MDM2 CDK4
31 malignant spiradenoma 9.8 MDM2 CDKN2A
32 lipoblastoma 9.8 MDM2 CDK4
33 diffuse lipomatosis 9.8 MDM2 CDK4
34 liposarcoma of bone 9.8 MDM2 CDK4
35 anal squamous cell carcinoma 9.8 MDM2 CDKN2A
36 malignant inflammatory fibrous histiocytoma 9.8 MDM2 CDK4
37 adult liposarcoma 9.8 MDM2 CDK4
38 pancreas sarcoma 9.8 MDM2 CDK4
39 juxtacortical osteosarcoma 9.8 MDM2 CDK4
40 paratesticular lipoma 9.8 MDM2 CDK4
41 lipoma of spermatic cord 9.8 MDM2 CDK4
42 pleomorphic lipoma 9.8 MDM2 CDK4
43 gliomatosis cerebri 9.8 MDM2 CDKN2A
44 peripheral osteosarcoma 9.8 MDM2 CDK4
45 mixed liposarcoma 9.8 MDM2 CDK4
46 extraosseous osteosarcoma 9.8 MDM2 CDK4
47 xeroderma pigmentosum, variant type 9.8
48 melanoma-pancreatic cancer syndrome 9.8
49 retroperitoneal sarcoma 9.8 MDM2 CDK4
50 spindle cell lipoma 9.8 MDM2 CDK4

Graphical network of the top 20 diseases related to Hereditary Melanoma:



Diseases related to Hereditary Melanoma

Symptoms & Phenotypes for Hereditary Melanoma

MGI Mouse Phenotypes related to Hereditary Melanoma:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 pigmentation MP:0001186 8.8 CDK4 CDKN2A MDM2

Drugs & Therapeutics for Hereditary Melanoma

Interventional clinical trials:


# Name Status NCT ID Phase Drugs
1 Genetic Analysis of Familial Melanoma Completed NCT00339404
2 Studies of Familial Melanoma Recruiting NCT00450593
3 Clinical, Laboratory, and Epidemiologic Characterization of Individuals and Families at High Risk of Melanoma Recruiting NCT00040352
4 Natural History and Biospecimen Acquisition Study for Children and Adults With Rare Solid Tumors Recruiting NCT03739827

Search NIH Clinical Center for Hereditary Melanoma

Genetic Tests for Hereditary Melanoma

Genetic tests related to Hereditary Melanoma:

# Genetic test Affiliating Genes
1 Hereditary Cutaneous Melanoma 29

Anatomical Context for Hereditary Melanoma

MalaCards organs/tissues related to Hereditary Melanoma:

40
Testes, Skin, Pancreas

Publications for Hereditary Melanoma

Articles related to Hereditary Melanoma:

(show top 50) (show all 108)
# Title Authors PMID Year
1
Germline mutations predisposing to melanoma. 61
32249949 2020
2
High-Throughput Sequencing Identifies 3 Novel Susceptibility Genes for Hereditary Melanoma. 61
32276436 2020
3
Assessing a single SNP located at TERT/CLPTM1L multi-cancer risk region as a genetic modifier for risk of pancreatic cancer and melanoma in Dutch CDKN2A mutation carriers. 61
31203567 2019
4
POT1 pathogenic variants: not all telomere pathway genes are equal in risk of hereditary cutaneous melanoma. 61
31259399 2019
5
Hereditary melanoma: a five-year study of Brazilian patients in a cancer referral center - phenotypic characteristics of probands and pathological features of primary tumors. 61
29924249 2018
6
Rare Variant, Gene-Based Association Study of Hereditary Melanoma Using Whole-Exome Sequencing. 61
29522175 2017
7
Pediatric Predispositional Genetic Risk Communication: Potential Utility for Prevention and Control of Melanoma Risk as an Exemplar. 61
28547663 2017
8
Germline CDKN2A/P16INK4A mutations contribute to genetic determinism of sarcoma. 61
28592523 2017
9
Identification, genetic testing, and management of hereditary melanoma. 61
28283772 2017
10
The absence of multiple atypical nevi in germline CDKN2A mutations: Comment on "Hereditary melanoma: Update on syndromes and management: Genetics of familial atypical multiple mole melanoma syndrome". 61
27646763 2016
11
Hereditary melanoma: Update on syndromes and management: Emerging melanoma cancer complexes and genetic counseling. 61
26892651 2016
12
Hereditary melanoma: Update on syndromes and management: Genetics of familial atypical multiple mole melanoma syndrome. 61
26892650 2016
13
Framing recommendations to promote prevention behaviors among people at high risk: A simulation study of responses to melanoma genetic test reporting. 61
25582532 2015
14
LINE-1 hypermethylation in peripheral blood of cutaneous melanoma patients is associated with metastasis. 61
25647737 2015
15
Genome-wide DNA methylation profile of leukocytes from melanoma patients with and without CDKN2A mutations. 61
25236571 2014
16
Germline CDKN2A mutations in Brazilian patients of hereditary cutaneous melanoma. 61
25023876 2014
17
Unaffected family members report improvements in daily routine sun protection 2 years following melanoma genetic testing. 61
24763292 2014
18
MDM2 SNP309 promoter polymorphism confers risk for hereditary melanoma. 61
24625390 2014
19
Clinical applications of melanoma genetics. 61
24652319 2014
20
New high-risk gene mutation for hereditary melanoma development identified. 61
25022025 2014
21
Melanoma susceptibility genes and risk assessment. 61
24258989 2014
22
Analysis of Latvian familial melanoma patients shows novel variants in the noncoding regions of CDKN2A and that the CDK4 mutation R24H is a founder mutation. 61
23546221 2013
23
Novel germline CDKN2A mutation associated with head and neck squamous cell carcinomas and melanomas. 61
22083977 2013
24
Genetic variations of patients with familial or multiple melanoma in Southern Brazil. 61
22621339 2013
25
Genetic testing for hereditary melanoma and pancreatic cancer: a longitudinal study of psychological outcome. 61
23382133 2013
26
Genetic testing by cancer site: skin. 61
22846740 2012
27
Hereditary melanoma. 61
21911180 2011
28
Hereditary genodermatoses with cancer predisposition. 61
20816579 2010
29
Investigation of IGF2/ApaI and H19/RsaI polymorphisms in patients with cutaneous melanoma. 61
20483645 2010
30
Familial cutaneous melanoma. 61
20687502 2010
31
Estimating CDKN2A carrier probability and personalizing cancer risk assessments in hereditary melanoma using MelaPRO. 61
20068151 2010
32
Clinical genetic testing for familial melanoma in Italy: a cooperative study. 61
19500876 2009
33
CDKN2A mutations in melanoma families from Uruguay. 61
19523171 2009
34
Melanoma genetics: an update on risk-associated genes. 61
19464594 2009
35
Clinical and molecular characterization of patients at risk for hereditary melanoma in southern Brazil. 61
17713569 2008
36
Epigenetic mutations in CDKN2A in western Swedish families with hereditary malignant melanoma. 61
21479383 2008
37
The p.G23S CDKN2A founder mutation in high-risk melanoma families from Central Italy. 61
17992122 2007
38
Monitoring of kindreds with hereditary predisposition for cutaneous melanoma and dysplastic nevus syndrome: results of a Swedish preventive program. 61
17602087 2007
39
Novel CDKN2A mutations detected in western Swedish families with hereditary malignant melanoma. 61
17255954 2007
40
MELPREDICT: a logistic regression model to estimate CDKN2A carrier probability. 61
16169933 2006
41
Activating mutations in the extracellular domain of the melanoma inducing receptor Xmrk are tumorigenic in vivo. 61
15957173 2005
42
Hereditary melanoma and predictive genetic testing: why not? 61
15744786 2005
43
[New insights on genetics of malignant melanoma]. 61
16193861 2005
44
Genetic testing in hereditary melanoma. 61
15523363 2004
45
A novel methionine-53-valine mutation of p16 in a hereditary melanoma kindred. 61
15304098 2004
46
Germline CDKN2A mutations are rare in child and adolescent cutaneous melanoma. 61
15305154 2004
47
Comparative genomic hybridization analysis of hereditary swine cutaneous melanoma revealed loss of the swine 13q36-49 chromosomal region in the nodular melanoma subtype. 61
15069687 2004
48
Case 7-2004: hereditary melanoma and pancreatic cancer. 61
15201425 2004
49
Identification of five chromosomal regions involved in predisposition to melanoma by genome-wide scan in the MeLiM swine model. 61
15054867 2004
50
Clinical germline genetic testing for melanoma. 61
15120668 2004

Variations for Hereditary Melanoma

ClinVar genetic disease variations for Hereditary Melanoma:

6 (show top 50) (show all 598) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 CDKN2A NC_000009.12:g.(?_21967752)_(21975133_?)deldeletion Pathogenic 417813 9:21967752-21975133
2 CDKN2A NM_058195.3(CDKN2A):c.*2deldeletion Pathogenic 406710 rs1060501263 9:21971000-21971000 9:21971001-21971001
3 CDKN2A NM_000077.4(CDKN2A):c.-19311G>ASNV Pathogenic 406708 rs1060501262 9:21994137-21994137 9:21994138-21994138
4 CDKN2A NM_058195.3(CDKN2A):c.194-3488deldeletion Pathogenic 429111 rs1131691187 9:21974695-21974695 9:21974696-21974696
5 CDKN2A NC_000009.12:g.(?_21994140)_(21994331_?)deldeletion Pathogenic 463461 9:21994139-21994330 9:21994140-21994331
6 CDKN2A NM_058197.4(CDKN2A):c.*206deldeletion Pathogenic 463493 rs1554654052 9:21971075-21971075 9:21971076-21971076
7 CDKN2A NM_000077.4(CDKN2A):c.79G>T (p.Glu27Ter)SNV Pathogenic 463512 rs1554656411 9:21974748-21974748 9:21974749-21974749
8 CDKN2A NC_000009.12:g.(?_21970896)_(21974833_?)deldeletion Pathogenic 463460 9:21970895-21974832 9:21970896-21974833
9 CDKN2A NM_058195.3(CDKN2A):c.194-3590deldeletion Pathogenic 463496 rs1554656624 9:21974797-21974797 9:21974798-21974798
10 CDKN2A NM_000077.4(CDKN2A):c.131dup (p.Tyr44Ter)duplication Pathogenic 483336 rs730881673 9:21974695-21974696 9:21974696-21974697
11 CDKN2A NM_058195.3(CDKN2A):c.97G>T (p.Glu33Ter)SNV Pathogenic 581437 rs1287464120 9:21994234-21994234 9:21994235-21994235
12 CDKN2A NC_000009.12:g.(?_21968219)_(21994341_?)deldeletion Pathogenic 583687 9:21968218-21994340 9:21968219-21994341
13 CDKN2A NM_001363763.2(CDKN2A):c.-4+582dupduplication Pathogenic 571028 rs779306249 9:21994233-21994234 9:21994234-21994235
14 CDKN2A NM_058197.4(CDKN2A):c.*120dupduplication Pathogenic 571109 rs1563889847 9:21971160-21971161 9:21971161-21971162
15 CDKN2A NM_058195.3(CDKN2A):c.194-3551deldeletion Pathogenic 572398 rs1563892715 9:21974758-21974758 9:21974759-21974759
16 CDKN2A NM_001363763.2(CDKN2A):c.-4+547deldeletion Pathogenic 576650 rs1563902931 9:21994273-21994273 9:21994274-21994274
17 CDKN2A NM_000077.4(CDKN2A):c.47T>C (p.Leu16Pro)SNV Pathogenic 649266 9:21974780-21974780 9:21974781-21974781
18 CDKN2A NM_000077.4(CDKN2A):c.41_43delinsG (p.Asp14fs)indel Pathogenic 659927 9:21974784-21974786 9:21974785-21974787
19 CDKN2A NC_000009.12:g.(?_21994129)_(21994341_?)deldeletion Pathogenic 657920 9:21994128-21994340 9:21994129-21994341
20 CDKN2A NM_058197.4(CDKN2A):c.*112deldeletion Pathogenic 644262 9:21971169-21971169 9:21971170-21971170
21 CDKN2A NM_000077.4(CDKN2A):c.132C>A (p.Tyr44Ter)SNV Pathogenic 655275 9:21974695-21974695 9:21974696-21974696
22 CDKN2A NM_000077.4(CDKN2A):c.35C>A (p.Ser12Ter)SNV Pathogenic 630390 rs141798398 9:21974792-21974792 9:21974793-21974793
23 CDKN2A NM_000077.4(CDKN2A):c.32dup (p.Ser12fs)duplication Pathogenic 857264 9:21974794-21974795 9:21974795-21974796
24 CDKN2A NC_000009.12:g.(?_21974668)_(21975028_?)deldeletion Pathogenic 830817 9:21974667-21975027
25 CDKN2A NC_000009.12:g.(?_21974668)_(21994341_?)deldeletion Pathogenic 833264 9:21974667-21994340
26 CDKN2A NM_000077.4(CDKN2A):c.45G>A (p.Trp15Ter)SNV Pathogenic 850910 9:21974782-21974782 9:21974783-21974783
27 CDKN2A NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile)SNV Pathogenic 9414 rs104894095 9:21971199-21971199 9:21971200-21971200
28 CDKN2A NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp)SNV Pathogenic 9420 rs104894098 9:21970981-21970981 9:21970982-21970982
29 CDK4 NM_000075.4(CDK4):c.70C>T (p.Arg24Cys)SNV Pathogenic 16928 rs11547328 12:58145431-58145431 12:57751648-57751648
30 CDKN2A NM_058195.3(CDKN2A):c.194-3518dupduplication Pathogenic 92427 rs398123152 9:21974720-21974721 9:21974721-21974722
31 CDKN2A NM_058195.3(CDKN2A):c.194-3573_194-3570delshort repeat Pathogenic 142061 rs587782206 9:21974777-21974780 9:21974778-21974781
32 CDKN2A NM_058197.4(CDKN2A):c.*163_*176deldeletion Pathogenic 182412 rs730881675 9:21971105-21971118 9:21971106-21971119
33 CDKN2A NM_058197.4(CDKN2A):c.*148_*166deldeletion Pathogenic 182411 rs730881674 9:21971115-21971133 9:21971116-21971134
34 CDKN2A NM_000077.4(CDKN2A):c.-34G>TSNV Pathogenic 182414 rs1800586 9:21974860-21974860 9:21974861-21974861
35 CDKN2A NM_000077.4(CDKN2A):c.142C>A (p.Pro48Thr)SNV Pathogenic 188286 rs786204195 9:21974685-21974685 9:21974686-21974686
36 CDKN2A NM_000077.4(CDKN2A):c.148C>T (p.Gln50Ter)SNV Pathogenic 220711 rs864622636 9:21974679-21974679 9:21974680-21974680
37 CDKN2A NM_000077.4(CDKN2A):c.47T>G (p.Leu16Arg)SNV Pathogenic 219815 rs864622263 9:21974780-21974780 9:21974781-21974781
38 CDKN2A NM_000077.4(CDKN2A):c.44G>A (p.Trp15Ter)SNV Pathogenic 230421 rs876658556 9:21974783-21974783 9:21974784-21974784
39 CDKN2A NM_000077.4(CDKN2A):c.260G>C (p.Arg87Pro)SNV Pathogenic 236984 rs878853647 9:21971098-21971098 9:21971099-21971099
40 CDKN2A NM_000077.4(CDKN2A):c.172C>T (p.Arg58Ter)SNV Pathogenic 376310 rs121913387 9:21971186-21971186 9:21971187-21971187
41 CDKN2A NM_000077.4(CDKN2A):c.95T>C (p.Leu32Pro)SNV Pathogenic/Likely pathogenic 236992 rs878853650 9:21974732-21974732 9:21974733-21974733
42 CDKN2A NM_000077.4(CDKN2A):c.334C>G (p.Arg112Gly)SNV Pathogenic/Likely pathogenic 233484 rs876660436 9:21971024-21971024 9:21971025-21971025
43 CDKN2A NM_000077.4(CDKN2A):c.457G>T (p.Asp153Tyr)SNV Pathogenic/Likely pathogenic 216035 rs45476696 9:21970901-21970901 9:21970902-21970902
44 CDKN2A NM_058197.4(CDKN2A):c.*258_*260dupduplication Pathogenic/Likely pathogenic 183759 rs768966657 9:21971020-21971021 9:21971021-21971022
45 CDKN2A NM_058195.3(CDKN2A):c.193+5G>ASNV Pathogenic/Likely pathogenic 141882 rs587782083 9:21994133-21994133 9:21994134-21994134
46 CDKN2A NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup)short repeat Pathogenic/Likely pathogenic 135827 rs587780668 9:21974794-21974795 9:21974795-21974796
47 CDKN2A NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly)SNV Pathogenic/Likely pathogenic 9423 rs104894099 9:21971182-21971182 9:21971183-21971183
48 CDKN2A NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile)SNV Pathogenic/Likely pathogenic 9425 rs104894109 9:21971191-21971191 9:21971192-21971192
49 CDKN2A NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro)SNV Pathogenic/Likely pathogenic 9415 rs104894097 9:21974756-21974756 9:21974757-21974757
50 CDKN2A NM_000077.4(CDKN2A):c.159G>A (p.Met53Ile)SNV Pathogenic/Likely pathogenic 532294 rs104894095 9:21971199-21971199 9:21971200-21971200

Expression for Hereditary Melanoma

Search GEO for disease gene expression data for Hereditary Melanoma.

Pathways for Hereditary Melanoma

Pathways related to Hereditary Melanoma according to GeneCards Suite gene sharing:

(show all 23)
# Super pathways Score Top Affiliating Genes
1
Show member pathways
12.57 MDM2 CDKN2A CDK4
2
Show member pathways
12.51 MDM2 CDKN2A CDK4
3 12.48 MDM2 CDKN2A CDK4
4
Show member pathways
12.31 MDM2 CDKN2A CDK4
5
Show member pathways
12.19 MDM2 CDKN2A CDK4
6 12.12 MDM2 CDKN2A CDK4
7
Show member pathways
12 MDM2 CDKN2A CDK4
8 11.9 MDM2 CDKN2A CDK4
9 11.81 MDM2 CDKN2A CDK4
10 11.67 MDM2 CDKN2A
11 11.63 MDM2 CDKN2A
12 11.63 MDM2 CDKN2A CDK4
13 11.54 MDM2 CDK4
14
Show member pathways
11.43 MDM2 CDKN2A
15 11.42 MDM2 CDKN2A
16 11.38 MDM2 CDKN2A CDK4
17 11.28 MDM2 CDKN2A
18 11.19 MDM2 CDK4
19 11.15 MDM2 CDK4
20 11 MDM2 CDKN2A CDK4
21
Show member pathways
10.78 MDM2 CDKN2A
22 10.75 MDM2 CDKN2A
23 10.3 MDM2 CDKN2A CDK4

GO Terms for Hereditary Melanoma

Biological processes related to Hereditary Melanoma according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 G1/S transition of mitotic cell cycle GO:0000082 9.43 CDKN2A CDK4
2 response to toxic substance GO:0009636 9.4 MDM2 CDK4
3 protein sumoylation GO:0016925 9.37 MDM2 CDKN2A
4 negative regulation of G1/S transition of mitotic cell cycle GO:2000134 9.32 CDKN2A CDK4
5 protein destabilization GO:0031648 9.26 MDM2 CDKN2A
6 positive regulation of cell cycle GO:0045787 9.16 MDM2 CDK4
7 negative regulation of cell cycle arrest GO:0071157 8.96 MDM2 CDK4
8 amyloid fibril formation GO:1990000 8.62 MDM2 CDKN2A

Molecular functions related to Hereditary Melanoma according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 disordered domain specific binding GO:0097718 8.96 MDM2 CDKN2A
2 SUMO transferase activity GO:0019789 8.62 MDM2 CDKN2A

Sources for Hereditary Melanoma

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....