HDL1
MCID: HNT010
MIFTS: 53

Huntington Disease-Like 1 (HDL1)

Categories: Eye diseases, Genetic diseases, Mental diseases, Neuronal diseases, Rare diseases

Aliases & Classifications for Huntington Disease-Like 1

MalaCards integrated aliases for Huntington Disease-Like 1:

Name: Huntington Disease-Like 1 56 12 58 73 29 13 6 71
Hdl1 56 12 58 73
Early-Onset Prion Disease with Prominent Psychiatric Features 12 58
Huntington-Like Neurodegenerative Disorder 1 56 12
Huntington's Disease-Like 1 12 15
Hln1 56 12
Prion Disease, Early-Onset, with Prominent Psychiatric Features 56
Huntington-Like Neurodegenerative Disorder, Autosomal Dominant 56
Autosomal Dominant Huntington-Like Neurodegenerative Disorder 12
Huntington-Like Neurodegenerative Disorder 1; Hln1 56
Huntington Disease-Like, Type 1 39

Characteristics:

Orphanet epidemiological data:

58
huntington disease-like 1
Inheritance: Autosomal dominant; Age of onset: Adult;

OMIM:

56
Inheritance:
autosomal dominant

Miscellaneous:
mean age at onset 28 years
prominent psychiatric symptoms


HPO:

31
huntington disease-like 1:
Inheritance autosomal dominant inheritance


Classifications:

Orphanet: 58  
Rare neurological diseases


Summaries for Huntington Disease-Like 1

Disease Ontology : 12 A prion disease that is characterized by a phenocopy of Huntington disease (unwanted choreatic movements, behavioral and psychiatric disturbances and dementia) that has material basis in autosomal dominant inheritance of 8 extra octapeptide repeats in the prion protein (PRNP) gene on chromosome 20p13.

MalaCards based summary : Huntington Disease-Like 1, also known as hdl1, is related to huntington disease-like 2 and abetalipoproteinemia, and has symptoms including ataxia, restlessness and personality changes. An important gene associated with Huntington Disease-Like 1 is PRNP (Prion Protein), and among its related pathways/superpathways are Metabolism of water-soluble vitamins and cofactors and Lipoprotein metabolism. Affiliated tissues include eye, brain and liver, and related phenotypes are chorea and depressivity

UniProtKB/Swiss-Prot : 73 Huntington disease-like 1: Autosomal dominant, early-onset neurodegenerative disorder with prominent psychiatric features.

More information from OMIM: 603218

Related Diseases for Huntington Disease-Like 1

Diseases in the Huntington Disease family:

Huntington Disease-Like 1 Huntington Disease-Like 3
Huntington Disease-Like 2 Juvenile Huntington Disease
Huntington Disease-Like Syndrome Huntington Disease-Like Syndrome Due to C9orf72 Expansions

Diseases related to Huntington Disease-Like 1 via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 95)
# Related Disease Score Top Affiliating Genes
1 huntington disease-like 2 29.9 XK VPS13A JPH3
2 abetalipoproteinemia 29.2 LPA LCAT CETP APOE APOB APOA1
3 hypercholesterolemia, familial, 1 29.1 LPA LCAT CETP APOE APOB APOA2
4 lipid metabolism disorder 27.9 SCARB1 LPA LCAT CETP APOE APOB
5 tangier disease 27.9 SCARB1 LPA LCAT CETP APOE APOB
6 familial hypercholesterolemia 27.9 SCARB1 LPA LCAT CETP APOE APOB
7 huntington disease-like syndrome 11.4
8 familial combined hyperlipoproteinemia 10.4 APOB APOA1
9 genetic prion diseases 10.4 PRNP APOE
10 xanthoma disseminatum 10.4 APOE APOB
11 gerstmann syndrome 10.4 PRNP APOE
12 hypercholesterolemia, familial, 2 10.3 APOE APOB
13 hepatic lipase deficiency 10.3 APOE APOA1
14 hereditary amyloidosis 10.3 APOA2 APOA1
15 apo a-i deficiency 10.2 LCAT APOA1
16 familial lipoprotein lipase deficiency 10.2 APOE APOB APOA1
17 hyperlipoproteinemia, type v 10.2 APOE APOB APOA1
18 silent myocardial infarction 10.2 LPA APOB
19 amyloidosis, hereditary, transthyretin-related 10.2 PRNP APOA2 APOA1
20 leukodystrophy, hypomyelinating, 3 10.2 APOB APOA2 APOA1
21 dentatorubral-pallidoluysian atrophy 10.2 TBP PRNP JPH3
22 cerebral atherosclerosis 10.2 LPA APOE APOA1
23 peripheral artery disease 10.2 APOE APOB APOA1
24 schnyder corneal dystrophy 10.1 APOE APOB APOA2
25 huntington disease-like 3 10.1
26 rapidly involuting congenital hemangioma 10.1
27 generalized atherosclerosis 10.1 LPA APOE APOB
28 amyloidosis, familial visceral 10.1 APOE APOA2 APOA1
29 ichthyosis, congenital, autosomal recessive 4a 10.1 APOA1 ABCA1
30 intermediate coronary syndrome 10.1 LPA APOB APOA1
31 platelet glycoprotein iv deficiency 10.1 SCARB1 APOE APOB
32 fetal macrosomia 10.0 LCAT APOB APOA1
33 defective apolipoprotein b-100 10.0 LCAT APOE APOB
34 fish-eye disease 10.0 LCAT APOA2 APOA1
35 sea-blue histiocyte disease 10.0 LCAT APOE
36 corneal degeneration 10.0 LPA APOB
37 acquired immunodeficiency syndrome 10.0 APOE APOB APOA1
38 hyperlipoproteinemia, type iv 10.0 LPA APOE APOB APOA1
39 amyloidosis aa 10.0 LPA LCAT APOA1
40 overnutrition 10.0 ICOSLG APOE APOB APOA1
41 gallbladder disease 10.0 CETP APOE APOB APOA1
42 acquired metabolic disease 9.9 ICOSLG APOE APOB APOA1
43 homozygous familial hypercholesterolemia 9.9 APOE APOB APOA1 ABCA1
44 arteriosclerosis 9.9 LPA APOE APOB APOA1
45 familial lcat deficiency 9.9 LCAT APOE APOA2 APOA1
46 xanthomatosis 9.8 LPA APOE APOB ABCA1
47 sitosterolemia 9.8 SCARB1 APOB APOA1 ABCA1
48 dementia 9.8 TBP PRNP JPH3 APOE
49 arcus corneae 9.8 LPA LCAT APOB APOA1
50 hypertriglyceridemia, familial 9.8 CETP APOE APOB APOA2 APOA1

Graphical network of the top 20 diseases related to Huntington Disease-Like 1:



Diseases related to Huntington Disease-Like 1

Symptoms & Phenotypes for Huntington Disease-Like 1

Human phenotypes related to Huntington Disease-Like 1:

58 31 (show top 50) (show all 51)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 chorea 58 31 hallmark (90%) Very frequent (99-80%) HP:0002072
2 depressivity 58 31 frequent (33%) Frequent (79-30%) HP:0000716
3 dysarthria 58 31 frequent (33%) Frequent (79-30%) HP:0001260
4 gait ataxia 58 31 frequent (33%) Frequent (79-30%) HP:0002066
5 ventriculomegaly 58 31 frequent (33%) Frequent (79-30%) HP:0002119
6 dementia 58 31 frequent (33%) Frequent (79-30%) HP:0000726
7 delusions 58 31 frequent (33%) Frequent (79-30%) HP:0000746
8 seizures 58 31 occasional (7.5%) Occasional (29-5%) HP:0001250
9 eeg abnormality 58 31 occasional (7.5%) Occasional (29-5%) HP:0002353
10 nystagmus 58 31 occasional (7.5%) Occasional (29-5%) HP:0000639
11 delayed speech and language development 58 31 occasional (7.5%) Occasional (29-5%) HP:0000750
12 cerebral cortical atrophy 58 31 occasional (7.5%) Occasional (29-5%) HP:0002120
13 generalized hypotonia 58 31 occasional (7.5%) Occasional (29-5%) HP:0001290
14 weight loss 58 31 occasional (7.5%) Occasional (29-5%) HP:0001824
15 slurred speech 58 31 occasional (7.5%) Occasional (29-5%) HP:0001350
16 memory impairment 58 31 occasional (7.5%) Occasional (29-5%) HP:0002354
17 dysmetria 58 31 occasional (7.5%) Occasional (29-5%) HP:0001310
18 poor fine motor coordination 58 31 occasional (7.5%) Occasional (29-5%) HP:0007010
19 mask-like facies 58 31 occasional (7.5%) Occasional (29-5%) HP:0000298
20 clumsiness 58 31 occasional (7.5%) Occasional (29-5%) HP:0002312
21 cerebellar atrophy 58 31 occasional (7.5%) Occasional (29-5%) HP:0001272
22 bradykinesia 58 31 occasional (7.5%) Occasional (29-5%) HP:0002067
23 abnormality of the shoulder 58 31 occasional (7.5%) Occasional (29-5%) HP:0003043
24 hypokinesia 58 31 occasional (7.5%) Occasional (29-5%) HP:0002375
25 frequent falls 58 31 occasional (7.5%) Occasional (29-5%) HP:0002359
26 restlessness 58 31 occasional (7.5%) Occasional (29-5%) HP:0000711
27 gliosis 58 31 occasional (7.5%) Occasional (29-5%) HP:0002171
28 hyperactive deep tendon reflexes 58 31 occasional (7.5%) Occasional (29-5%) HP:0006801
29 slow saccadic eye movements 58 31 occasional (7.5%) Occasional (29-5%) HP:0000514
30 jerky ocular pursuit movements 58 31 occasional (7.5%) Occasional (29-5%) HP:0008003
31 abnormality of the basal ganglia 58 31 occasional (7.5%) Occasional (29-5%) HP:0002134
32 abnormal posturing 58 31 occasional (7.5%) Occasional (29-5%) HP:0002533
33 jerky head movements 58 31 occasional (7.5%) Occasional (29-5%) HP:0006961
34 simultanapraxia 58 31 occasional (7.5%) Occasional (29-5%) HP:0040201
35 incoordination 58 31 Occasional (29-5%) HP:0002311
36 abnormality of eye movement 58 Occasional (29-5%)
37 gait disturbance 58 Frequent (79-30%)
38 behavioral abnormality 58 Frequent (79-30%)
39 cognitive impairment 58 Frequent (79-30%)
40 anxiety 31 HP:0000739
41 abnormality of saccadic eye movements 58 Occasional (29-5%)
42 rigidity 31 HP:0002063
43 aggressive behavior 31 HP:0000718
44 involuntary movements 58 Frequent (79-30%)
45 abnormality of higher mental function 58 Occasional (29-5%)
46 personality changes 31 HP:0000751
47 unsteady gait 31 HP:0002317
48 abnormal head movements 58 Occasional (29-5%)
49 abnormality of ocular smooth pursuit 58 Occasional (29-5%)
50 global brain atrophy 31 HP:0002283

Symptoms via clinical synopsis from OMIM:

56
Neurologic Central Nervous System:
ataxia
dysarthria
chorea
dysmetria
rigidity
more
Neurologic Behavioral Psychiatric Manifestations:
anxiety
restlessness
personality changes
delusions
depression
more

Clinical features from OMIM:

603218

UMLS symptoms related to Huntington Disease-Like 1:


ataxia, restlessness, personality changes, muscle rigidity, grimacing

GenomeRNAi Phenotypes related to Huntington Disease-Like 1 according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Decreased free cholesterol GR00340-A-2 9.1 ABCA1 APOA1 APOB APOE CETP LPA

MGI Mouse Phenotypes related to Huntington Disease-Like 1:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 homeostasis/metabolism MP:0005376 9.93 ABCA1 APOA1 APOA2 APOB APOE CSF1R
2 liver/biliary system MP:0005370 9.43 ABCA1 APOA1 APOB APOE LCAT SCARB1
3 reproductive system MP:0005389 9.28 ABCA1 APOB APOE CSF1R JPH3 PRNP

Drugs & Therapeutics for Huntington Disease-Like 1

Search Clinical Trials , NIH Clinical Center for Huntington Disease-Like 1

Genetic Tests for Huntington Disease-Like 1

Genetic tests related to Huntington Disease-Like 1:

# Genetic test Affiliating Genes
1 Huntington Disease-Like 1 29 PRNP

Anatomical Context for Huntington Disease-Like 1

MalaCards organs/tissues related to Huntington Disease-Like 1:

40
Eye, Brain, Liver, Kidney, Cortex, Heart, Adipocyte

Publications for Huntington Disease-Like 1

Articles related to Huntington Disease-Like 1:

(show top 50) (show all 196)
# Title Authors PMID Year
1
Huntington disease phenocopy is a familial prion disease. 56 6
11593450 2001
2
Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene. 56 6
1683708 1991
3
Genetic Prion Diseases 61 6
20301407 2003
4
Creutzfeldt-Jakob disease with a novel insertion and codon 219 Lys/Lys polymorphism in PRNP. 6
15557533 2004
5
Creutzfeldt-Jakob disease with a novel extra-repeat insertional mutation in the PRNP gene. 6
14610142 2003
6
Novel prion protein insert mutation associated with prolonged neurodegenerative illness. 6
12771252 2003
7
Accumulation of protease-resistant prion protein (PrP) and apoptosis of cerebellar granule cells in transgenic mice expressing a PrP insertional mutation. 6
10805813 2000
8
Prominent psychiatric features and early onset in an inherited prion disease with a new insertional mutation in the prion protein gene. 56
10581230 1999
9
Neurological illness in transgenic mice expressing a prion protein with an insertional mutation. 6
9883727 1998
10
A Huntington disease-like neurodegenerative disorder maps to chromosome 20p. 56
9792871 1998
11
A prion disease with a novel 96-base pair insertional mutation in the prion protein gene. 6
8618679 1996
12
Prion disease associated with a novel nine octapeptide repeat insertion in the PRNP gene. 6
8750875 1995
13
Hypokinesia and presenile dementia in a Dutch family with a novel insertion in the prion protein gene. 56
8595485 1995
14
Huntington disease without CAG expansion: phenocopies or errors in assignment? 56
8178825 1994
15
Inherited prion disease with 144 base pair gene insertion. 1. Genealogical and molecular studies. 6
1352724 1992
16
Uncommon phenotype for a codon 178 mutation of the human PrP gene. 6
1353344 1992
17
Atypical Creutzfeldt-Jakob disease in an American family with an insert mutation in the PRNP amyloid precursor gene. 6
1736177 1992
18
Genetic predisposition to iatrogenic Creutzfeldt-Jakob disease. 6
1675319 1991
19
Prion dementia without characteristic pathology. 6
1973256 1990
20
An in-frame insertion in the prion protein gene in familial Creutzfeldt-Jakob disease. 6
2159587 1990
21
Diagnosis of Gerstmann-Sträussler syndrome in familial dementia with prion protein gene analysis. 6
2567794 1989
22
Insertion in prion protein gene in familial Creutzfeldt-Jakob disease. 6
2563037 1989
23
Cholesterol Subfraction Analysis in Patients with Acute Coronary Syndrome. 61
29852873 2019
24
High-Density Lipoprotein and Low-Density Lipoprotein Subfractions in Patients with Chronic Kidney Disease. 61
27697068 2017
25
Lipoprotein Subfractions, Uric Acid and Cardiovascular Risk in End-Stage Renal Disease (ESRD) Patients. 61
27774887 2017
26
Do HDL and LDL subfractions play a role in atherosclerosis in end-stage renal disease (ESRD) patients? 61
27942970 2017
27
Lipoprotein subfractions by nuclear magnetic resonance are associated with tumor characteristics in breast cancer. 61
26970778 2016
28
High density lipoprotein subfractions and paraoxonase 1 in children. 61
27262841 2016
29
Portulaca oleracea reduces triglyceridemia, cholesterolemia, and improves lecithin: cholesterol acyltransferase activity in rats fed enriched-cholesterol diet. 61
25442258 2014
30
Paraoxonase 1 and HDL subfractions in hypercholesterolemic children and adolescents. 61
26461330 2014
31
Huntington disease and Huntington disease-like in a case series from Brazil. 61
24102565 2014
32
Modified interferon-α subtypes production and chemokine networks in the thymus during acute simian immunodeficiency virus infection, impact on thymopoiesis. 61
24614087 2014
33
Comparison of plasma lipoprotein profiles and malondialdehyde between hyperlipidemia dogs with/without treatment. 61
24625120 2014
34
The Influence of an Obesogenic Diet on Oxysterol Metabolism in C57BL/6J Mice. 61
24672716 2014
35
Genotype-phenotype analysis in inherited prion disease with eight octapeptide repeat insertional mutation. 61
24275071 2013
36
Huntington disease-like 2 (HDL2) in Venezuela: frequency and ethnic origin. 61
22971727 2013
37
Inborn errors of brain myelin formation. 61
23622380 2013
38
Genetic screening of Greek patients with Huntington’s disease phenocopies identifies an SCA8 expansion. 61
22297462 2012
39
In vitro lipid transfer between lipoproteins and midgut-diverticula in the spider Polybetes pythagoricus. 61
21889600 2011
40
Potential use of cholesterol lipoprotein profile to confirm obesity status in dogs. 61
21327518 2011
41
Huntington's disease look-alikes. 61
21496572 2011
42
HDL subfractions analysis: a new laboratory diagnostic assay for patients with cardiovascular diseases and dyslipoproteinemia. 61
21876506 2011
43
[Differential diagnosis of chorea]. 61
19697886 2009
44
Heme-binding storage proteins in the Chelicerata. 61
19183556 2009
45
Atherosclerotic lesion formation and triglyceride storage in obese apolipoprotein AI-deficient mice. 61
18280133 2008
46
Huntington disease-like 2: the first patient with apparent European ancestry. 61
18341606 2008
47
Huntington's disease phenocopies are clinically and genetically heterogeneous. 61
18181206 2008
48
Huntington's disease phenocopy syndromes. 61
17992089 2007
49
The differential diagnosis of chorea. 61
18024776 2007
50
The Huntington's disease-like syndromes: what to consider in patients with a negative Huntington's disease gene test. 61
17805246 2007

Variations for Huntington Disease-Like 1

ClinVar genetic disease variations for Huntington Disease-Like 1:

6 (show all 12) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 PRNP NM_000311.5(PRNP):c.598G>A (p.Glu200Lys)SNV Pathogenic 13398 rs28933385 20:4680464-4680464 20:4699818-4699818
2 PRNP NM_000311.5(PRNP):c.593T>C (p.Phe198Ser)SNV Pathogenic 13401 rs74315405 20:4680459-4680459 20:4699813-4699813
3 PRNP NM_000311.5(PRNP):c.628G>A (p.Val210Ile)SNV Pathogenic 13403 rs74315407 20:4680494-4680494 20:4699848-4699848
4 PRNP NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln)NT expansion Pathogenic 13394 rs193922906 20:4680026-4680049 20:4699379-4699380
5 PRNP NM_000311.5(PRNP):c.695T>G (p.Met232Arg)SNV Uncertain significance 13406 rs74315409 20:4680561-4680561 20:4699915-4699915
6 PRNP NM_000311.5(PRNP):c.462G>A (p.Met154Ile)SNV Uncertain significance 569467 rs144302267 20:4680328-4680328 20:4699682-4699682
7 PRNP NM_000311.5(PRNP):c.228C>T (p.Pro76=)SNV Benign/Likely benign 218578 rs112637437 20:4680094-4680094 20:4699448-4699448
8 PRNP NM_000311.5(PRNP):c.424G>A (p.Gly142Ser)SNV Benign/Likely benign 338652 rs150351644 20:4680290-4680290 20:4699644-4699644
9 PRNP NM_000311.5(PRNP):c.246_269del (p.60_67PHGGGWGQ[3])deletion Benign/Likely benign 536237 rs138688873 20:4680095-4680118 20:4699449-4699472
10 PRNP NM_000311.5(PRNP):c.385A>G (p.Met129Val)SNV Benign 13397 rs1799990 20:4680251-4680251 20:4699605-4699605
11 PRNP NM_000311.5(PRNP):c.246A>G (p.Gly82=)SNV Benign 338648 rs62643364 20:4680112-4680112 20:4699466-4699466
12 PRNP NM_000311.5(PRNP):c.351A>G (p.Ala117=)SNV Benign 338650 rs8124214 20:4680217-4680217 20:4699571-4699571

Expression for Huntington Disease-Like 1

Search GEO for disease gene expression data for Huntington Disease-Like 1.

Pathways for Huntington Disease-Like 1

Pathways related to Huntington Disease-Like 1 according to GeneCards Suite gene sharing:

(show all 11)
# Super pathways Score Top Affiliating Genes
1
Show member pathways
12.36 APOE APOB APOA2 APOA1
2
Show member pathways
12.14 SCARB1 LPA LCAT CETP APOE APOB
3
Show member pathways
12.06 APOE APOB APOA2 APOA1
4
Show member pathways
11.99 SCARB1 APOE APOB APOA1 ABCA1
5
Show member pathways
11.72 SCARB1 APOE APOB APOA1
6
Show member pathways
11.35 SCARB1 LPA LCAT CETP APOE APOB
7
Show member pathways
11.1 SCARB1 APOB APOA1 ABCA1
8 10.92 SCARB1 APOB APOA1
9 10.91 APOA2 APOA1
10 10.86 CETP ABCA1
11 10.78 APOA2 APOA1 ABCA1

GO Terms for Huntington Disease-Like 1

Cellular components related to Huntington Disease-Like 1 according to GeneCards Suite gene sharing:

(show all 13)
# Name GO ID Score Top Affiliating Genes
1 extracellular exosome GO:0070062 10.06 SCARB1 PRNP LCAT ICOSLG CETP APOE
2 cell surface GO:0009986 9.91 SCARB1 PRNP CSF1R APOA1 ABCA1
3 endoplasmic reticulum lumen GO:0005788 9.8 APOE APOB APOA2 APOA1
4 early endosome GO:0005769 9.78 APOE APOB APOA2 APOA1
5 blood microparticle GO:0072562 9.7 APOE APOA2 APOA1
6 endocytic vesicle lumen GO:0071682 9.54 APOE APOB APOA1
7 low-density lipoprotein particle GO:0034362 9.5 APOE APOB APOA1
8 spherical high-density lipoprotein particle GO:0034366 9.46 APOA2 APOA1
9 very-low-density lipoprotein particle GO:0034361 9.46 APOE APOB APOA2 APOA1
10 discoidal high-density lipoprotein particle GO:0034365 9.43 APOE APOA1
11 intermediate-density lipoprotein particle GO:0034363 9.43 APOE APOB APOA1
12 chylomicron GO:0042627 9.26 APOE APOB APOA2 APOA1
13 high-density lipoprotein particle GO:0034364 9.1 LCAT CETP APOE APOB APOA2 APOA1

Biological processes related to Huntington Disease-Like 1 according to GeneCards Suite gene sharing:

(show top 50) (show all 56)
# Name GO ID Score Top Affiliating Genes
1 lipid metabolic process GO:0006629 10.15 LPA LCAT CETP APOE APOB APOA1
2 steroid metabolic process GO:0008202 10.03 LCAT CETP APOE APOB APOA1 ABCA1
3 post-translational protein modification GO:0043687 10.01 APOE APOB APOA2 APOA1
4 lipid transport GO:0006869 10.01 SCARB1 LPA CETP APOE APOB APOA2
5 cellular protein metabolic process GO:0044267 9.99 APOE APOB APOA2 APOA1
6 cholesterol metabolic process GO:0008203 9.98 LCAT CETP APOE APOB APOA2 APOA1
7 receptor-mediated endocytosis GO:0006898 9.96 SCARB1 APOE APOB APOA1
8 retinoid metabolic process GO:0001523 9.92 APOE APOB APOA2 APOA1
9 phospholipid transport GO:0015914 9.89 SCARB1 CETP APOA1 ABCA1
10 regulation of lipid metabolic process GO:0019216 9.88 APOA2 APOA1 ABCA1
11 triglyceride homeostasis GO:0070328 9.88 SCARB1 CETP APOE APOA1
12 lipoprotein metabolic process GO:0042157 9.88 APOE APOB APOA2 APOA1 ABCA1
13 high-density lipoprotein particle assembly GO:0034380 9.87 APOE APOA2 APOA1 ABCA1
14 phospholipid efflux GO:0033700 9.85 APOE APOA2 APOA1 ABCA1
15 low-density lipoprotein particle remodeling GO:0034374 9.85 LPA CETP APOE APOB APOA2
16 cholesterol efflux GO:0033344 9.85 SCARB1 APOE APOB APOA2 APOA1 ABCA1
17 high-density lipoprotein particle clearance GO:0034384 9.84 SCARB1 APOE APOA2 APOA1
18 chylomicron assembly GO:0034378 9.83 APOE APOB APOA2 APOA1
19 triglyceride metabolic process GO:0006641 9.81 CETP APOE APOA2
20 phosphatidylcholine biosynthetic process GO:0006656 9.81 LCAT APOA2 APOA1
21 very-low-density lipoprotein particle remodeling GO:0034372 9.81 LCAT CETP APOE APOA1
22 positive regulation of cholesterol efflux GO:0010875 9.8 APOE APOA1 ABCA1
23 phosphatidylcholine metabolic process GO:0046470 9.8 LCAT CETP APOA1
24 chylomicron remodeling GO:0034371 9.8 APOE APOB APOA2 APOA1
25 phospholipid homeostasis GO:0055091 9.79 CETP APOA1 ABCA1
26 positive regulation of cholesterol esterification GO:0010873 9.77 APOE APOA2 APOA1
27 regulation of Cdc42 protein signal transduction GO:0032489 9.76 APOE APOA1 ABCA1
28 cholesterol homeostasis GO:0042632 9.76 SCARB1 LCAT CETP APOE APOB APOA2
29 high-density lipoprotein particle remodeling GO:0034375 9.73 SCARB1 LCAT CETP APOE APOA2 APOA1
30 artery morphogenesis GO:0048844 9.72 APOE APOB
31 low-density lipoprotein particle clearance GO:0034383 9.72 SCARB1 APOB
32 positive regulation of nitric-oxide synthase activity GO:0051000 9.72 SCARB1 APOE
33 lipoprotein biosynthetic process GO:0042158 9.72 LCAT APOE APOB APOA1 ABCA1
34 regulation of neuronal synaptic plasticity GO:0048168 9.71 JPH3 APOE
35 endothelial cell proliferation GO:0001935 9.71 SCARB1 APOA1
36 negative regulation of amyloid-beta formation GO:1902430 9.71 PRNP APOE
37 negative regulation of long-term synaptic potentiation GO:1900272 9.71 PRNP APOE
38 negative regulation of macrophage derived foam cell differentiation GO:0010745 9.7 CETP ABCA1
39 cholesterol catabolic process GO:0006707 9.7 SCARB1 APOE
40 blood vessel endothelial cell migration GO:0043534 9.7 SCARB1 APOA1
41 chylomicron remnant clearance GO:0034382 9.69 APOE APOB
42 positive regulation by host of viral process GO:0044794 9.69 CSF1R APOE
43 positive regulation of cholesterol storage GO:0010886 9.69 SCARB1 APOB
44 cholesterol import GO:0070508 9.68 SCARB1 APOA1
45 very-low-density lipoprotein particle clearance GO:0034447 9.68 APOE APOB
46 peptidyl-methionine modification GO:0018206 9.68 APOA2 APOA1
47 negative regulation of cytokine secretion involved in immune response GO:0002740 9.67 APOA2 APOA1
48 lipoprotein catabolic process GO:0042159 9.67 APOE APOB
49 regulation of intestinal cholesterol absorption GO:0030300 9.67 APOA2 APOA1
50 protein oxidation GO:0018158 9.66 APOA2 APOA1

Molecular functions related to Huntington Disease-Like 1 according to GeneCards Suite gene sharing:

(show all 19)
# Name GO ID Score Top Affiliating Genes
1 signaling receptor binding GO:0005102 9.93 ICOSLG APOE APOA2 APOA1 ABCA1
2 lipid binding GO:0008289 9.88 CETP APOE APOA2 APOA1
3 heparin binding GO:0008201 9.85 PRNP LPA APOE APOB
4 phospholipid binding GO:0005543 9.8 APOE APOB APOA2 APOA1
5 amyloid-beta binding GO:0001540 9.76 SCARB1 PRNP APOE APOA1
6 cholesterol binding GO:0015485 9.71 CETP APOA2 APOA1 ABCA1
7 phospholipid transporter activity GO:0005548 9.65 CETP APOA1 ABCA1
8 apolipoprotein binding GO:0034185 9.61 SCARB1 LPA ABCA1
9 low-density lipoprotein particle receptor binding GO:0050750 9.58 APOE APOB
10 lipoprotein particle binding GO:0071813 9.57 APOE APOA1
11 lipase inhibitor activity GO:0055102 9.56 APOA2 APOA1
12 phosphatidylcholine binding GO:0031210 9.56 CETP APOA2 APOA1 ABCA1
13 phosphatidylcholine-sterol O-acyltransferase activator activity GO:0060228 9.54 APOE APOA2 APOA1
14 high-density lipoprotein particle receptor binding GO:0070653 9.52 APOA2 APOA1
15 apolipoprotein receptor binding GO:0034190 9.51 APOA2 APOA1
16 apolipoprotein A-I binding GO:0034186 9.5 SCARB1 LCAT ABCA1
17 high-density lipoprotein particle binding GO:0008035 9.46 SCARB1 APOA2 APOA1 ABCA1
18 lipid transporter activity GO:0005319 9.43 CETP APOE APOB APOA2 APOA1 ABCA1
19 intermembrane cholesterol transfer activity GO:0120020 9.1 CETP APOE APOB APOA2 APOA1 ABCA1

Sources for Huntington Disease-Like 1

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....