MCID: INH032
MIFTS: 24

Inherited Human Prion Disease

Categories: Genetic diseases, Mental diseases, Neuronal diseases, Rare diseases

Aliases & Classifications for Inherited Human Prion Disease

MalaCards integrated aliases for Inherited Human Prion Disease:

Name: Inherited Human Prion Disease 58
Genetic Prion Diseases 29 6
Genetic Human Prion Disease 58
Familial Prion Disease 58

Classifications:

Orphanet: 58  
Rare neurological diseases


External Ids:

ICD10 via Orphanet 33 A81.8
Orphanet 58 ORPHA280400

Summaries for Inherited Human Prion Disease

MalaCards based summary : Inherited Human Prion Disease, also known as genetic prion diseases, is related to prion disease and fatal familial insomnia. An important gene associated with Inherited Human Prion Disease is PRNP (Prion Protein). Affiliated tissues include brain and testes.

Related Diseases for Inherited Human Prion Disease

Diseases in the Prion Disease family:

Inherited Human Prion Disease Sporadic Human Prion Disease
Acquired Human Prion Disease

Diseases related to Inherited Human Prion Disease via text searches within MalaCards or GeneCards Suite gene sharing:

(show all 29)
# Related Disease Score Top Affiliating Genes
1 prion disease 10.2
2 fatal familial insomnia 10.1
3 ataxia and polyneuropathy, adult-onset 10.1
4 scrapie 10.1
5 creutzfeldt-jakob disease 10.1
6 peripheral nervous system disease 10.0
7 sensory peripheral neuropathy 10.0
8 gerstmann-straussler disease 9.9
9 encephalopathy 9.9
10 cerebral amyloid angiopathy, cst3-related 9.8
11 kuru 9.8
12 aphasia 9.8
13 diarrhea 9.8
14 amyloidosis 9.8
15 encephalitis 9.8
16 allergic encephalomyelitis 9.8
17 dysautonomia 9.8
18 dysphagia 9.8
19 myoclonus 9.8
20 alzheimer disease 9.8
21 huntington disease 9.8
22 huntington disease-like 1 9.8
23 spongiform encephalopathy with neuropsychiatric features 9.8
24 spinocerebellar ataxia 17 9.8
25 dementia 9.8
26 polyneuropathy 9.8
27 myopathy 9.8
28 neuroblastoma 9.8
29 neuropathy 9.8

Graphical network of the top 20 diseases related to Inherited Human Prion Disease:



Diseases related to Inherited Human Prion Disease

Symptoms & Phenotypes for Inherited Human Prion Disease

Drugs & Therapeutics for Inherited Human Prion Disease

Search Clinical Trials , NIH Clinical Center for Inherited Human Prion Disease

Genetic Tests for Inherited Human Prion Disease

Genetic tests related to Inherited Human Prion Disease:

# Genetic test Affiliating Genes
1 Genetic Prion Diseases 29

Anatomical Context for Inherited Human Prion Disease

MalaCards organs/tissues related to Inherited Human Prion Disease:

40
Brain, Testes

Publications for Inherited Human Prion Disease

Articles related to Inherited Human Prion Disease:

(show top 50) (show all 70)
# Title Authors PMID Year
1
Genetic Prion Diseases – ARCHIVED CHAPTER, FOR HISTORICAL REFERENCE ONLY 6 61
20301407 2003
2
Genetic Creutzfeldt-Jakob disease in Sardinia: a case series linked to the PRNP R208H mutation due to a single founder effect. 61
32458274 2020
3
Plasma total prion protein as a potential biomarker for neurodegenerative dementia: diagnostic accuracy in the spectrum of prion diseases. 61
31216593 2020
4
New paradigms of clinical trial design for genetic prion diseases. 61
32199088 2020
5
Mitochondrial dysfunction in preclinical genetic prion disease: A target for preventive treatment? 61
30423473 2019
6
Cerebrospinal Fluid Total Prion Protein in the Spectrum of Prion Diseases. 61
30062673 2019
7
The genetic Creutzfeldt-Jakob disease with E200K mutation: analysis of clinical, genetic and laboratory features of 30 Chinese patients. 61
30755683 2019
8
Profiles of 14-3-3 and Total Tau in CSF Samples of Chinese Patients of Different Genetic Prion Diseases. 61
31551692 2019
9
Genetic Testing in Prion Disease: Psychological Consequences of the Decisions to Know or Not to Know. 61
31616476 2019
10
Cerebrospinal fluid neurofilament light levels in neurodegenerative dementia: Evaluation of diagnostic accuracy in the differential diagnosis of prion diseases. 61
29391125 2018
11
Genetic PrP Prion Diseases. 61
28778873 2018
12
Genetic Creutzfeldt-Jakob disease. 61
29887139 2018
13
Prion disease. 61
29478593 2018
14
Familial Creutzfeldt-Jakob Disease Cluster Among an African American Family. 61
27997483 2017
15
YKL-40 in the brain and cerebrospinal fluid of neurodegenerative dementias. 61
29126445 2017
16
Genetic human prion disease modelled in PrP transgenic Drosophila. 61
28814578 2017
17
Hereditary Human Prion Diseases: an Update. 61
27324792 2017
18
Atypical BSE: Current Knowledge and Knowledge Gaps. 61
32231923 2017
19
Understanding the Effect of Disease-Related Mutations on Human Prion Protein Structure: Insights From NMR Spectroscopy. 61
28838676 2017
20
Genetic prion disease: Experience of a rapidly progressive dementia center in the United States and a review of the literature. 61
27943639 2017
21
Diagnostic and prognostic value of human prion detection in cerebrospinal fluid. 61
27893164 2017
22
Towards authentic transgenic mouse models of heritable PrP prion diseases. 61
27350609 2016
23
Transgenic mice recapitulate the phenotypic heterogeneity of genetic prion diseases without developing prion infectivity: Role of intracellular PrP retention in neurotoxicity. 61
26864450 2016
24
Clinical findings and diagnosis in genetic prion diseases in Germany. 61
26076917 2016
25
Prion Diseases. 61
26633779 2015
26
The Features of Genetic Prion Diseases Based on Chinese Surveillance Program. 61
26488179 2015
27
Iatrogenic and sporadic Creutzfeldt-Jakob disease in 2 sisters without mutation in the prion protein gene. 61
26634863 2015
28
Genetic prion disease: no role for the immune system in disease pathogenesis? 61
24667414 2014
29
Pomegranate seed oil nanoemulsions for the prevention and treatment of neurodegenerative diseases: the case of genetic CJD. 61
24704590 2014
30
Mouse models for studying the formation and propagation of prions. 61
24860095 2014
31
Clinical features of genetic Creutzfeldt-Jakob disease with V180I mutation in the prion protein gene. 61
24838726 2014
32
Creutzfeldt-Jakob disease associated with a V203I homozygous mutation in the prion protein gene. 61
25495585 2014
33
Epitope scanning indicates structural differences in brain-derived monomeric and aggregated mutant prion proteins related to genetic prion diseases. 61
23808898 2013
34
Prion diseases. 61
24234356 2013
35
Multiparameter MR imaging in the 6-OPRI variant of inherited prion disease. 61
23538406 2013
36
Brain microglia were activated in sporadic CJD but almost unchanged in fatal familial insomnia and G114V genetic CJD. 61
23816234 2013
37
Early detection of abnormal prion protein in genetic human prion diseases now possible using real-time QUIC assay. 61
23372790 2013
38
Relationships between clinicopathological features and cerebrospinal fluid biomarkers in Japanese patients with genetic prion diseases. 61
23555862 2013
39
[Review of basic knowledge, surveillance and infectious control of prion disease]. 61
24291944 2013
40
[Clinical manifestations and epidemiology of prion diseases in Japan]. 61
24291945 2013
41
Disease-associated mutations in the prion protein impair laminin-induced process outgrowth and survival. 61
23132868 2012
42
Divergent clinical and neuropathological phenotype in a Gerstmann-Sträussler-Scheinker P102L family. 61
22211828 2012
43
Activation of the macroautophagic system in scrapie-infected experimental animals and human genetic prion diseases. 61
22874564 2012
44
Mutant PrP suppresses glutamatergic neurotransmission in cerebellar granule neurons by impairing membrane delivery of VGCC α(2)δ-1 Subunit. 61
22542184 2012
45
Copper is toxic to PrP-ablated mice and exacerbates disease in a mouse model of E200K genetic prion disease. 61
22198568 2012
46
Distinct neuropsychological profiles correspond to distribution of cortical thinning in inherited prion disease caused by insertional mutation. 61
21849340 2012
47
Fatal prion disease in a mouse model of genetic E200K Creutzfeldt-Jakob disease. 61
22072968 2011
48
Expression of mutant or cytosolic PrP in transgenic mice and cells is not associated with endoplasmic reticulum stress or proteasome dysfunction. 61
21559407 2011
49
Familial CJD associated PrP mutants within transmembrane region induced Ctm-PrP retention in ER and triggered apoptosis by ER stress in SH-SY5Y cells. 61
21298055 2011
50
Instability of the octarepeat region of the human prion protein gene. 61
22028931 2011

Variations for Inherited Human Prion Disease

ClinVar genetic disease variations for Inherited Human Prion Disease:

6 (show top 50) (show all 72) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 PRNP NM_000311.5(PRNP):c.598G>A (p.Glu200Lys)SNV Pathogenic 13398 rs28933385 20:4680464-4680464 20:4699818-4699818
2 PRNP NM_000311.5(PRNP):c.532G>A (p.Asp178Asn)SNV Pathogenic 39359 rs74315403 20:4680398-4680398 20:4699752-4699752
3 PRNP NM_000311.5(PRNP):c.593T>C (p.Phe198Ser)SNV Pathogenic 13401 rs74315405 20:4680459-4680459 20:4699813-4699813
4 PRNP NM_000311.5(PRNP):c.650A>G (p.Gln217Arg)SNV Pathogenic 13402 rs74315406 20:4680516-4680516 20:4699870-4699870
5 PRNP NM_000311.5(PRNP):c.628G>A (p.Val210Ile)SNV Pathogenic 13403 rs74315407 20:4680494-4680494 20:4699848-4699848
6 PRNP NM_000311.5(PRNP):c.314C>T (p.Pro105Leu)SNV Pathogenic 13404 rs11538758 20:4680180-4680180 20:4699534-4699534
7 PRNP NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln)NT expansion Pathogenic 13394 rs193922906 20:4680026-4680049 20:4699379-4699380
8 PRNP NM_000311.5(PRNP):c.305C>T (p.Pro102Leu)SNV Pathogenic 13395 rs74315401 20:4680171-4680171 20:4699525-4699525
9 PRNP NM_000311.5(PRNP):c.350C>T (p.Ala117Val)SNV Pathogenic 13396 rs74315402 20:4680216-4680216 20:4699570-4699570
10 PRNP NM_000311.5(PRNP):c.547A>G (p.Thr183Ala)SNV Pathogenic 13407 rs74315411 20:4680413-4680413 20:4699767-4699767
11 PRNP NM_000311.5(PRNP):c.560A>G (p.His187Arg)SNV Pathogenic 13412 rs74315413 20:4680426-4680426 20:4699780-4699780
12 PRNP NM_000311.5(PRNP):c.313C>A (p.Pro105Thr)SNV Pathogenic 13413 rs74315414 20:4680179-4680179 20:4699533-4699533
13 PRNP NM_000311.5(PRNP):c.313C>T (p.Pro105Ser)SNV Pathogenic 13415 rs74315414 20:4680179-4680179 20:4699533-4699533
14 PRNP NM_000311.5(PRNP):c.435T>G (p.Tyr145Ter)SNV Pathogenic 21147 rs80356710 20:4680301-4680301 20:4699655-4699655
15 PRNP NM_000311.5(PRNP):c.478C>T (p.Gln160Ter)SNV Pathogenic 21148 rs80356711 20:4680344-4680344 20:4699698-4699698
16 PRNP NM_000311.5(PRNP):c.538G>A (p.Val180Ile)SNV Pathogenic/Likely pathogenic 13405 rs74315408 20:4680404-4680404 20:4699758-4699758
17 PRNP NM_000311.5(PRNP):c.623G>A (p.Arg208His)SNV Conflicting interpretations of pathogenicity 13411 rs74315412 20:4680489-4680489 20:4699843-4699843
18 PRNP NM_000311.5(PRNP):c.-22C>GSNV Uncertain significance 338642 rs886056741 20:4667147-4667147 20:4686501-4686501
19 PRNP NM_000311.5(PRNP):c.*1134T>ASNV Uncertain significance 895124 20:4681762-4681762 20:4701116-4701116
20 PRNP NM_000311.5(PRNP):c.*1328T>CSNV Uncertain significance 895125 20:4681956-4681956 20:4701310-4701310
21 PRNP NM_000311.5(PRNP):c.695T>G (p.Met232Arg)SNV Uncertain significance 13406 rs74315409 20:4680561-4680561 20:4699915-4699915
22 PRNP NM_000311.5(PRNP):c.143G>A (p.Arg48His)SNV Uncertain significance 895060 20:4680009-4680009 20:4699363-4699363
23 PRNP NM_000311.5(PRNP):c.497T>C (p.Met166Thr)SNV Uncertain significance 896503 20:4680363-4680363 20:4699717-4699717
24 PRNP NM_000311.5(PRNP):c.565G>A (p.Val189Ile)SNV Uncertain significance 896504 20:4680431-4680431 20:4699785-4699785
25 PRNP NM_000311.5(PRNP):c.76C>G (p.Pro26Ala)SNV Uncertain significance 899177 20:4679942-4679942 20:4699296-4699296
26 PRNP NM_000311.5(PRNP):c.*460G>TSNV Uncertain significance 898128 20:4681088-4681088 20:4700442-4700442
27 PRNP NM_000311.5(PRNP):c.*994C>TSNV Uncertain significance 338668 rs886056746 20:4681622-4681622 20:4700976-4700976
28 PRNP NM_000311.5(PRNP):c.*1588C>TSNV Uncertain significance 338675 rs886056750 20:4682216-4682216 20:4701570-4701570
29 PRNP NM_000311.4(PRNP):c.-211G>ASNV Uncertain significance 338640 rs886056739 20:4666958-4666958 20:4686312-4686312
30 PRNP NM_000311.4(PRNP):c.-310T>ASNV Uncertain significance 338638 rs765471807 20:4666859-4666859 20:4686213-4686213
31 PRNP NM_000311.5(PRNP):c.-21G>TSNV Uncertain significance 338643 rs886056742 20:4667148-4667148 20:4686502-4686502
32 PRNP NM_000311.5(PRNP):c.*358C>ASNV Uncertain significance 338659 rs886056744 20:4680986-4680986 20:4700340-4700340
33 PRNP NM_000311.5(PRNP):c.*874C>TSNV Uncertain significance 338666 rs760516358 20:4681502-4681502 20:4700856-4700856
34 PRNP NM_000311.5(PRNP):c.*1193G>ASNV Uncertain significance 338671 rs886056748 20:4681821-4681821 20:4701175-4701175
35 PRNP NM_000311.4(PRNP):c.-206C>GSNV Uncertain significance 338641 rs886056740 20:4666963-4666963 20:4686317-4686317
36 PRNP NM_000311.5(PRNP):c.*1035T>GSNV Uncertain significance 338669 rs886056747 20:4681663-4681663 20:4701017-4701017
37 PRNP NM_000311.5(PRNP):c.*1281A>GSNV Uncertain significance 338672 rs540167431 20:4681909-4681909 20:4701263-4701263
38 PRNP NM_000311.5(PRNP):c.*1466G>CSNV Uncertain significance 338674 rs886056749 20:4682094-4682094 20:4701448-4701448
39 PRNP NM_000311.5(PRNP):c.*216G>ASNV Uncertain significance 338658 rs748532463 20:4680844-4680844 20:4700198-4700198
40 PRNP NM_000311.5(PRNP):c.*407T>GSNV Uncertain significance 338660 rs886056745 20:4681035-4681035 20:4700389-4700389
41 PRNP NM_000311.5(PRNP):c.*115G>ASNV Uncertain significance 338656 rs746943389 20:4680743-4680743 20:4700097-4700097
42 PRNP NM_000311.5(PRNP):c.*98_*100TCT[1]short repeat Likely benign 338655 rs570683075 20:4680725-4680727 20:4700079-4700081
43 PRNP NM_000311.5(PRNP):c.160G>A (p.Gly54Ser)SNV Likely benign 338646 rs763524380 20:4680026-4680026 20:4699380-4699380
44 PRNP NM_000311.5(PRNP):c.654C>T (p.Tyr218=)SNV Likely benign 896505 20:4680520-4680520 20:4699874-4699874
45 PRNP NM_000311.5(PRNP):c.5C>T (p.Ala2Val)SNV Likely benign 899176 20:4679871-4679871 20:4699225-4699225
46 PRNP NM_000311.3(PRNP):c.204_227del24 (p.Pro84_Gln91del)short repeat Likely benign 65494 rs193922906 20:4680026-4680049 20:4699380-4699403
47 PRNP NM_000311.5(PRNP):c.228C>T (p.Pro76=)SNV Benign/Likely benign 218578 rs112637437 20:4680094-4680094 20:4699448-4699448
48 PRNP NM_000311.5(PRNP):c.159C>T (p.Gly53=)SNV Benign/Likely benign 338645 rs776188950 20:4680025-4680025 20:4699379-4699379
49 PRNP NM_000311.5(PRNP):c.424G>A (p.Gly142Ser)SNV Benign/Likely benign 338652 rs150351644 20:4680290-4680290 20:4699644-4699644
50 PRNP NM_000311.5(PRNP):c.*70G>ASNV Benign 338654 rs116970629 20:4680698-4680698 20:4700052-4700052

Expression for Inherited Human Prion Disease

Search GEO for disease gene expression data for Inherited Human Prion Disease.

Pathways for Inherited Human Prion Disease

GO Terms for Inherited Human Prion Disease

Sources for Inherited Human Prion Disease

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....