MCID: LTN022
MIFTS: 23

Late-Onset Distal Myopathy, Markesbery-Griggs Type

Categories: Rare diseases

Aliases & Classifications for Late-Onset Distal Myopathy, Markesbery-Griggs Type

MalaCards integrated aliases for Late-Onset Distal Myopathy, Markesbery-Griggs Type:

Name: Late-Onset Distal Myopathy, Markesbery-Griggs Type 20
Myofibrillar Myopathy, Zasp-Related 29 6
Myopathy, Myofibrillar, Zasp-Related 39
Zasp-Related Myofibrillar Myopathy 20

Classifications:



Summaries for Late-Onset Distal Myopathy, Markesbery-Griggs Type

GARD : 20 The following summary is from Orphanet, a European reference portal for information on rare diseases and orphan drugs.Orpha Number: 98912DefinitionA rare, genetic, non-dystrophic myofibrillar myopathy disorder characterized by late-adult onset of distal and/or proximal limb muscle weakness with initial involvement of posterior lower leg muscles, medial gastrocnemius and soleus. Patients present with ankle weakness followed by weakness of finger and wrist extensors and later on of proximal muscles. Ambulation is usually preserved. Late-onset associated cardiomyopathy and/or neuropathy has been reported in a minority of cases.Visit the Orphanet disease page for more resources.

MalaCards based summary : Late-Onset Distal Myopathy, Markesbery-Griggs Type, also known as myofibrillar myopathy, zasp-related, is related to myopathy, myofibrillar, 4 and miyoshi muscular dystrophy. An important gene associated with Late-Onset Distal Myopathy, Markesbery-Griggs Type is LDB3 (LIM Domain Binding 3). Affiliated tissues include heart, and related phenotypes are progressive proximal muscle weakness and intrinsic hand muscle atrophy

Related Diseases for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Diseases related to Late-Onset Distal Myopathy, Markesbery-Griggs Type via text searches within MalaCards or GeneCards Suite gene sharing:

# Related Disease Score Top Affiliating Genes
1 myopathy, myofibrillar, 4 11.6
2 miyoshi muscular dystrophy 10.2
3 myofibrillar myopathy 10.2
4 myopathy 10.2

Symptoms & Phenotypes for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Human phenotypes related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:

31 (show all 19)
# Description HPO Frequency HPO Source Accession
1 progressive proximal muscle weakness 31 frequent (33%) HP:0009073
2 intrinsic hand muscle atrophy 31 frequent (33%) HP:0008954
3 fatigable weakness of distal limb muscles 31 frequent (33%) HP:0030198
4 wrist drop 31 occasional (7.5%) HP:0031189
5 weakness of long finger extensor muscles 31 occasional (7.5%) HP:0009077
6 leg muscle stiffness 31 occasional (7.5%) HP:0008969
7 ankle weakness 31 occasional (7.5%) HP:0031374
8 weakness of the intrinsic hand muscles 31 occasional (7.5%) HP:0009005
9 gait disturbance 31 very rare (1%) HP:0001288
10 proximal muscle weakness in upper limbs 31 very rare (1%) HP:0008997
11 peripheral neuropathy 31 very rare (1%) HP:0009830
12 cardiomyopathy 31 very rare (1%) HP:0001638
13 heart block 31 very rare (1%) HP:0012722
14 generalized muscle weakness 31 very rare (1%) HP:0003324
15 foot dorsiflexor weakness 31 very rare (1%) HP:0009027
16 limb-girdle muscle weakness 31 very rare (1%) HP:0003325
17 decreased achilles reflex 31 very rare (1%) HP:0009072
18 decreased patellar reflex 31 very rare (1%) HP:0011808
19 abnormal left ventricular function 31 very rare (1%) HP:0005162

Drugs & Therapeutics for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Search Clinical Trials , NIH Clinical Center for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Genetic Tests for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Genetic tests related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:

# Genetic test Affiliating Genes
1 Myofibrillar Myopathy, Zasp-Related 29 LDB3

Anatomical Context for Late-Onset Distal Myopathy, Markesbery-Griggs Type

MalaCards organs/tissues related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:

40
Heart

Publications for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Articles related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:

# Title Authors PMID Year
1
Mutations in ZASP define a novel form of muscular dystrophy in humans. 6
15668942 2005
2
A novel mutation in the PDZ-like motif of ZASP causes distal ZASP-related myofibrillar myopathy. 61
27546599 2017

Variations for Late-Onset Distal Myopathy, Markesbery-Griggs Type

ClinVar genetic disease variations for Late-Onset Distal Myopathy, Markesbery-Griggs Type:

6 (show top 50) (show all 307)
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 LDB3 NM_007078.3(LDB3):c.690-4678C>T SNV Pathogenic 4728 rs121908334 10:88446975-88446975 10:86687218-86687218
2 LDB3 NM_007078.3(LDB3):c.690-4732C>T SNV Pathogenic 41040 rs281865143 10:88446921-88446921 10:86687164-86687164
3 LDB3 NM_007078.3(LDB3):c.690-4733G>A SNV Pathogenic 4727 rs121908333 10:88446920-88446920 10:86687163-86687163
4 LDB3 NM_007078.3(LDB3):c.690-4626T>C SNV Conflicting interpretations of pathogenicity 43880 rs71473272 10:88447027-88447027 10:86687270-86687270
5 LDB3 NM_007078.3(LDB3):c.690-4A>G SNV Conflicting interpretations of pathogenicity 36448 rs45529531 10:88451649-88451649 10:86691892-86691892
6 LDB3 NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) SNV Conflicting interpretations of pathogenicity 222687 rs200796750 10:88466440-88466440 10:86706683-86706683
7 LDB3 NM_007078.3(LDB3):c.690-4716G>A SNV Conflicting interpretations of pathogenicity 179019 rs371708921 10:88446937-88446937 10:86687180-86687180
8 LDB3 NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) SNV Conflicting interpretations of pathogenicity 45527 rs138951890 10:88476387-88476387 10:86716630-86716630
9 LDB3 NM_007078.3(LDB3):c.690-4661G>A SNV Conflicting interpretations of pathogenicity 163835 rs373632943 10:88446992-88446992 10:86687235-86687235
10 LDB3 NM_007078.3(LDB3):c.690-4739G>A SNV Uncertain significance 518946 rs376489385 10:88446914-88446914 10:86687157-86687157
11 LDB3 NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) SNV Uncertain significance 45536 rs141569007 10:88478536-88478536 10:86718779-86718779
12 LDB3 NM_007078.3(LDB3):c.690-4621A>G SNV Uncertain significance 518922 rs370053163 10:88447032-88447032 10:86687275-86687275
13 LDB3 NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) SNV Uncertain significance 509273 rs113817827 10:88476458-88476458 10:86716701-86716701
14 LDB3 NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) SNV Uncertain significance 201848 rs368888118 10:88476108-88476108 10:86716351-86716351
15 LDB3 NM_007078.3(LDB3):c.1547G>A (p.Arg516Gln) SNV Uncertain significance 970543 10:88476399-88476399 10:86716642-86716642
16 LDB3 NM_007078.3(LDB3):c.1703G>A (p.Arg568His) SNV Uncertain significance 464286 rs769156627 10:88477747-88477747 10:86717990-86717990
17 LDB3 NM_007078.3(LDB3):c.896+6738C>T SNV Uncertain significance 198762 rs377201153 10:88459066-88459066 10:86699309-86699309
18 LDB3 NM_007078.3(LDB3):c.1971C>T (p.Cys657=) SNV Uncertain significance 45537 rs140552419 10:88478597-88478597 10:86718840-86718840
19 LDB3 NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) SNV Uncertain significance 227498 rs375306400 10:88441539-88441539 10:86681782-86681782
20 LDB3 NM_007078.3(LDB3):c.529dup (p.Ala177fs) Duplication Uncertain significance 178668 rs730880345 10:88441395-88441396 10:86681638-86681639
21 LDB3 NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[3] (p.434_441APAYTPSP[3]) Microsatellite Uncertain significance 45515 rs397517209 10:88476134-88476135 10:86716377-86716378
22 LDB3 NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) SNV Uncertain significance 179553 rs727504944 10:88477818-88477818 10:86718061-86718061
23 LDB3 NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) SNV Uncertain significance 45519 rs397517214 10:88476305-88476305 10:86716548-86716548
24 LDB3 NM_007078.3(LDB3):c.1798C>T (p.Arg600Ter) SNV Uncertain significance 163853 rs727503132 10:88477842-88477842 10:86718085-86718085
25 LDB3 NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) SNV Uncertain significance 45555 rs45521338 10:88451756-88451756 10:86691999-86691999
26 LDB3 NM_007078.3(LDB3):c.356C>T (p.Ala119Val) SNV Uncertain significance 45545 rs397517223 10:88441227-88441227 10:86681470-86681470
27 LDB3 NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) SNV Uncertain significance 45516 rs397517211 10:88476191-88476191 10:86716434-86716434
28 LDB3 NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) SNV Uncertain significance 45535 rs397517218 10:88478533-88478533 10:86718776-86718776
29 LDB3 NM_007078.3(LDB3):c.2164G>A (p.Ala722Thr) SNV Uncertain significance 179788 rs727505129 10:88492713-88492713 10:86732956-86732956
30 LDB3 NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) SNV Uncertain significance 201854 rs747523570 10:88477843-88477843 10:86718086-86718086
31 LDB3 NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) SNV Uncertain significance 163829 rs727503123 10:88441526-88441526 10:86681769-86681769
32 LDB3 NM_007078.3(LDB3):c.1153A>G (p.Ser385Gly) SNV Uncertain significance 228793 rs777547764 10:88469729-88469729 10:86709972-86709972
33 LDB3 NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) Microsatellite Uncertain significance 45514 rs397517209 10:88476135-88476158 10:86716378-86716401
34 LDB3 NM_007078.3(LDB3):c.287T>C (p.Val96Ala) SNV Uncertain significance 201834 rs794729056 10:88439880-88439880 10:86680123-86680123
35 LDB3 NM_007078.3(LDB3):c.2124G>A (p.Pro708=) SNV Uncertain significance 389706 rs759812655 10:88492673-88492673 10:86732916-86732916
36 LDB3 NM_007078.3(LDB3):c.690-4692G>A SNV Uncertain significance 532924 rs1413446799 10:88446961-88446961 10:86687204-86687204
37 LDB3 NM_007078.3(LDB3):c.689+3877G>A SNV Uncertain significance 532927 rs397516556 10:88445437-88445437 10:86685680-86685680
38 LDB3 NM_007078.3(LDB3):c.896+6768G>A SNV Uncertain significance 532930 rs771037817 10:88459096-88459096 10:86699339-86699339
39 LDB3 NM_007078.3(LDB3):c.196C>T (p.Gln66Ter) SNV Uncertain significance 532932 rs1554849100 10:88439226-88439226 10:86679469-86679469
40 LDB3 NM_007078.3(LDB3):c.272C>T (p.Thr91Met) SNV Uncertain significance 532933 rs769237367 10:88439865-88439865 10:86680108-86680108
41 LDB3 NM_007078.3(LDB3):c.4T>A (p.Ser2Thr) SNV Uncertain significance 567162 rs1564626023 10:88428452-88428452 10:86668695-86668695
42 LDB3 NM_007078.3(LDB3):c.72C>A (p.Asn24Lys) SNV Uncertain significance 567732 rs1323002546 10:88428520-88428520 10:86668763-86668763
43 LDB3 NM_007078.3(LDB3):c.690-4817C>T SNV Uncertain significance 576453 rs1564639205 10:88446836-88446836 10:86687079-86687079
44 LDB3 NM_007078.3(LDB3):c.690-4642A>G SNV Uncertain significance 581549 rs1310394018 10:88447011-88447011 10:86687254-86687254
45 LDB3 NM_007078.3(LDB3):c.827G>A (p.Arg276His) SNV Uncertain significance 640344 rs774519585 10:88451790-88451790 10:86692033-86692033
46 LDB3 NM_007078.3(LDB3):c.690-4655C>A SNV Uncertain significance 641190 rs1220958570 10:88446998-88446998 10:86687241-86687241
47 LDB3 NM_007078.3(LDB3):c.55G>T (p.Gly19Trp) SNV Uncertain significance 642479 rs777413488 10:88428503-88428503 10:86668746-86668746
48 LDB3 NM_007078.3(LDB3):c.80T>C (p.Leu27Pro) SNV Uncertain significance 372570 rs1057517864 10:88428528-88428528 10:86668771-86668771
49 LDB3 NM_007078.3(LDB3):c.55G>A (p.Gly19Arg) SNV Uncertain significance 651199 rs777413488 10:88428503-88428503 10:86668746-86668746
50 LDB3 NM_007078.3(LDB3):c.92G>A (p.Arg31Gln) SNV Uncertain significance 652580 rs1410128172 10:88428540-88428540 10:86668783-86668783

Expression for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Search GEO for disease gene expression data for Late-Onset Distal Myopathy, Markesbery-Griggs Type.

Pathways for Late-Onset Distal Myopathy, Markesbery-Griggs Type

GO Terms for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Sources for Late-Onset Distal Myopathy, Markesbery-Griggs Type

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
20 GARD
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
53 NINDS
54 Novoseek
56 OMIM via Orphanet
57 OMIM® (Updated 05-Mar-2021)
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....