MCID: LTN022
MIFTS: 26

Late-Onset Distal Myopathy, Markesbery-Griggs Type

Categories: Rare diseases

Aliases & Classifications for Late-Onset Distal Myopathy, Markesbery-Griggs Type

MalaCards integrated aliases for Late-Onset Distal Myopathy, Markesbery-Griggs Type:

Name: Late-Onset Distal Myopathy, Markesbery-Griggs Type 20
Myofibrillar Myopathy, Zasp-Related 29 6
Myopathy, Myofibrillar, Zasp-Related 39
Zasp-Related Myofibrillar Myopathy 20

Classifications:



Summaries for Late-Onset Distal Myopathy, Markesbery-Griggs Type

GARD : 20 The following summary is from Orphanet, a European reference portal for information on rare diseases and orphan drugs. Orpha Number: 98912 Definition A rare, genetic, non-dystrophic myofibrillar myopathy disorder characterized by late-adult onset of distal and/or proximal limb muscle weakness with initial involvement of posterior lower leg muscles, medial gastrocnemius and soleus. Patients present with ankle weakness followed by weakness of finger and wrist extensors and later on of proximal muscles. Ambulation is usually preserved. Late-onset associated cardiomyopathy and/or neuropathy has been reported in a minority of cases.

MalaCards based summary : Late-Onset Distal Myopathy, Markesbery-Griggs Type, also known as myofibrillar myopathy, zasp-related, is related to myopathy, myofibrillar, 4 and myopathy. An important gene associated with Late-Onset Distal Myopathy, Markesbery-Griggs Type is LDB3 (LIM Domain Binding 3). Affiliated tissues include heart and skeletal muscle, and related phenotypes are progressive proximal muscle weakness and intrinsic hand muscle atrophy

Related Diseases for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Graphical network of the top 20 diseases related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:



Diseases related to Late-Onset Distal Myopathy, Markesbery-Griggs Type

Symptoms & Phenotypes for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Human phenotypes related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:

31 (showing 19, show less)
# Description HPO Frequency HPO Source Accession
1 progressive proximal muscle weakness 31 frequent (33%) HP:0009073
2 intrinsic hand muscle atrophy 31 frequent (33%) HP:0008954
3 fatigable weakness of distal limb muscles 31 frequent (33%) HP:0030198
4 wrist drop 31 occasional (7.5%) HP:0031189
5 weakness of long finger extensor muscles 31 occasional (7.5%) HP:0009077
6 leg muscle stiffness 31 occasional (7.5%) HP:0008969
7 ankle weakness 31 occasional (7.5%) HP:0031374
8 weakness of the intrinsic hand muscles 31 occasional (7.5%) HP:0009005
9 gait disturbance 31 very rare (1%) HP:0001288
10 proximal muscle weakness in upper limbs 31 very rare (1%) HP:0008997
11 peripheral neuropathy 31 very rare (1%) HP:0009830
12 cardiomyopathy 31 very rare (1%) HP:0001638
13 heart block 31 very rare (1%) HP:0012722
14 generalized muscle weakness 31 very rare (1%) HP:0003324
15 foot dorsiflexor weakness 31 very rare (1%) HP:0009027
16 limb-girdle muscle weakness 31 very rare (1%) HP:0003325
17 decreased achilles reflex 31 very rare (1%) HP:0009072
18 decreased patellar reflex 31 very rare (1%) HP:0011808
19 abnormal left ventricular function 31 very rare (1%) HP:0005162

Drugs & Therapeutics for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Search Clinical Trials , NIH Clinical Center for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Genetic Tests for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Genetic tests related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:

# Genetic test Affiliating Genes
1 Myofibrillar Myopathy, Zasp-Related 29 LDB3

Anatomical Context for Late-Onset Distal Myopathy, Markesbery-Griggs Type

MalaCards organs/tissues related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:

40
Heart, Skeletal Muscle

Publications for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Articles related to Late-Onset Distal Myopathy, Markesbery-Griggs Type:

(showing 6, show less)
# Title Authors PMID Year
1
Unusual multisystemic involvement and a novel BAG3 mutation revealed by NGS screening in a large cohort of myofibrillar myopathies. 6
25208129 2014
2
Z-disc-associated, alternatively spliced, PDZ motif-containing protein (ZASP) mutations in the actin-binding domain cause disruption of skeletal muscle actin filaments in myofibrillar myopathy. 6
24668811 2014
3
ZASP interacts with the mechanosensing protein Ankrd2 and p53 in the signalling network of striated muscle. 6
24647531 2014
4
[Myofibrillary myopathy due to the ZASP mutation Ala147Thr : two cases with exclusively distal leg involvement]. 6
23263837 2013
5
Mutations in ZASP define a novel form of muscular dystrophy in humans. 6
15668942 2005
6
A novel mutation in the PDZ-like motif of ZASP causes distal ZASP-related myofibrillar myopathy. 61
27546599 2017

Variations for Late-Onset Distal Myopathy, Markesbery-Griggs Type

ClinVar genetic disease variations for Late-Onset Distal Myopathy, Markesbery-Griggs Type:

6 (showing 353, show less)
# Gene Name Type Significance ClinVarId dbSNP ID Position
1 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4732C>T SNV Pathogenic 41040 rs281865143 GRCh37: 10:88446921-88446921
GRCh38: 10:86687164-86687164
2 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4733G>A SNV Pathogenic 4727 rs121908333 GRCh37: 10:88446920-88446920
GRCh38: 10:86687163-86687163
3 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4678C>T SNV Pathogenic 4728 rs121908334 GRCh37: 10:88446975-88446975
GRCh38: 10:86687218-86687218
4 LDB3 NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) SNV Conflicting interpretations of pathogenicity 45527 rs138951890 GRCh37: 10:88476387-88476387
GRCh38: 10:86716630-86716630
5 LDB3 NM_007078.3(LDB3):c.690-4A>G SNV Conflicting interpretations of pathogenicity 36448 rs45529531 GRCh37: 10:88451649-88451649
GRCh38: 10:86691892-86691892
6 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4661G>A SNV Conflicting interpretations of pathogenicity 163835 rs373632943 GRCh37: 10:88446992-88446992
GRCh38: 10:86687235-86687235
7 LDB3 NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) SNV Conflicting interpretations of pathogenicity 222687 rs200796750 GRCh37: 10:88466440-88466440
GRCh38: 10:86706683-86706683
8 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4716G>A SNV Conflicting interpretations of pathogenicity 179019 rs371708921 GRCh37: 10:88446937-88446937
GRCh38: 10:86687180-86687180
9 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4626T>C SNV Conflicting interpretations of pathogenicity 43880 rs71473272 GRCh37: 10:88447027-88447027
GRCh38: 10:86687270-86687270
10 LDB3 NM_007078.3(LDB3):c.715G>A (p.Val239Ile) SNV Uncertain significance 191697 rs201417512 GRCh37: 10:88451678-88451678
GRCh38: 10:86691921-86691921
11 LDB3 NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) SNV Uncertain significance 201854 rs747523570 GRCh37: 10:88477843-88477843
GRCh38: 10:86718086-86718086
12 LDB3 NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) SNV Uncertain significance 163829 rs727503123 GRCh37: 10:88441526-88441526
GRCh38: 10:86681769-86681769
13 LDB3 NM_007078.3(LDB3):c.955G>A (p.Ala319Thr) SNV Uncertain significance 201844 rs151219713 GRCh37: 10:88466346-88466346
GRCh38: 10:86706589-86706589
14 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4767C>G SNV Uncertain significance 406811 rs928294708 GRCh37: 10:88446886-88446886
GRCh38: 10:86687129-86687129
15 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4619_690-4618delinsTA Indel Uncertain significance 406800 rs1060501314 GRCh37: 10:88447034-88447035
GRCh38: 10:86687277-86687278
16 LDB3 NM_007078.3(LDB3):c.1667A>G (p.Asn556Ser) SNV Uncertain significance 383595 rs372583830 GRCh37: 10:88476519-88476519
GRCh38: 10:86716762-86716762
17 LDB3 , LOC110121486 NM_007078.3(LDB3):c.689+3877G>A SNV Uncertain significance 532927 rs397516556 GRCh37: 10:88445437-88445437
GRCh38: 10:86685680-86685680
18 LDB3 NM_007078.3(LDB3):c.826C>T (p.Arg276Cys) SNV Uncertain significance 45556 rs397517226 GRCh37: 10:88451789-88451789
GRCh38: 10:86692032-86692032
19 LDB3 NM_007078.3(LDB3):c.2123C>T (p.Pro708Leu) SNV Uncertain significance 571805 rs774815578 GRCh37: 10:88492672-88492672
GRCh38: 10:86732915-86732915
20 LDB3 NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) SNV Uncertain significance 45519 rs397517214 GRCh37: 10:88476305-88476305
GRCh38: 10:86716548-86716548
21 LDB3 NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) SNV Uncertain significance 45555 rs45521338 GRCh37: 10:88451756-88451756
GRCh38: 10:86691999-86691999
22 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4811C>T SNV Uncertain significance 658316 rs750606592 GRCh37: 10:88446842-88446842
GRCh38: 10:86687085-86687085
23 LDB3 , LOC110121486 NM_007078.3(LDB3):c.689+3886C>G SNV Uncertain significance 665826 rs369470035 GRCh37: 10:88445446-88445446
GRCh38: 10:86685689-86685689
24 LDB3 NM_007078.3(LDB3):c.796C>T (p.Arg266Cys) SNV Uncertain significance 845719 GRCh37: 10:88451759-88451759
GRCh38: 10:86692002-86692002
25 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4661G>T SNV Uncertain significance 856952 GRCh37: 10:88446992-88446992
GRCh38: 10:86687235-86687235
26 LDB3 NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) SNV Uncertain significance 45536 rs141569007 GRCh37: 10:88478536-88478536
GRCh38: 10:86718779-86718779
27 LDB3 NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) SNV Uncertain significance 509273 rs113817827 GRCh37: 10:88476458-88476458
GRCh38: 10:86716701-86716701
28 LDB3 NM_007078.3(LDB3):c.54G>T (p.Gln18His) SNV Uncertain significance 201856 rs149348427 GRCh37: 10:88428502-88428502
GRCh38: 10:86668745-86668745
29 LDB3 NM_007078.3(LDB3):c.1752G>C (p.Leu584=) SNV Uncertain significance 640229 rs1589676711 GRCh37: 10:88477796-88477796
GRCh38: 10:86718039-86718039
30 LDB3 NM_007078.3(LDB3):c.80T>C (p.Leu27Pro) SNV Uncertain significance 372570 rs1057517864 GRCh37: 10:88428528-88428528
GRCh38: 10:86668771-86668771
31 LDB3 NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) SNV Uncertain significance 201848 rs368888118 GRCh37: 10:88476108-88476108
GRCh38: 10:86716351-86716351
32 LDB3 NM_007078.3(LDB3):c.356C>T (p.Ala119Val) SNV Uncertain significance 45545 rs397517223 GRCh37: 10:88441227-88441227
GRCh38: 10:86681470-86681470
33 LDB3 NM_007078.3(LDB3):c.54G>T (p.Gln18His) SNV Uncertain significance 201856 rs149348427 GRCh37: 10:88428502-88428502
GRCh38: 10:86668745-86668745
34 LDB3 NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) SNV Uncertain significance 45532 rs372331627 GRCh37: 10:88476524-88476524
GRCh38: 10:86716767-86716767
35 LDB3 NM_007078.3(LDB3):c.89C>A (p.Ser30Tyr) SNV Uncertain significance 934126 GRCh37: 10:88428537-88428537
GRCh38: 10:86668780-86668780
36 LDB3 NM_007078.3(LDB3):c.896+6753C>G SNV Uncertain significance 941415 GRCh37: 10:88459081-88459081
GRCh38: 10:86699324-86699324
37 LDB3 NM_007078.3(LDB3):c.167A>G (p.Asn56Ser) SNV Uncertain significance 944161 GRCh37: 10:88439197-88439197
GRCh38: 10:86679440-86679440
38 LDB3 NM_007078.3(LDB3):c.778G>A (p.Ala260Thr) SNV Uncertain significance 691843 rs777637914 GRCh37: 10:88451741-88451741
GRCh38: 10:86691984-86691984
39 LDB3 NM_007078.3(LDB3):c.269C>G (p.Ser90Cys) SNV Uncertain significance 955368 GRCh37: 10:88439862-88439862
GRCh38: 10:86680105-86680105
40 LDB3 NM_007078.3(LDB3):c.115G>C (p.Ala39Pro) SNV Uncertain significance 959579 GRCh37: 10:88439145-88439145
GRCh38: 10:86679388-86679388
41 LDB3 NM_007078.3(LDB3):c.2142C>A (p.Asp714Glu) SNV Uncertain significance 964653 GRCh37: 10:88492691-88492691
GRCh38: 10:86732934-86732934
42 LDB3 NM_007078.3(LDB3):c.1690G>A (p.Val564Ile) SNV Uncertain significance 964703 GRCh37: 10:88477734-88477734
GRCh38: 10:86717977-86717977
43 LDB3 NM_007078.3(LDB3):c.1677G>A (p.Arg559=) SNV Uncertain significance 965530 GRCh37: 10:88477721-88477721
GRCh38: 10:86717964-86717964
44 LDB3 NM_007078.3(LDB3):c.55G>C (p.Gly19Arg) SNV Uncertain significance 967392 GRCh37: 10:88428503-88428503
GRCh38: 10:86668746-86668746
45 LDB3 NM_007078.3(LDB3):c.1403A>G (p.Asn468Ser) SNV Uncertain significance 180401 rs730880129 GRCh37: 10:88476255-88476255
GRCh38: 10:86716498-86716498
46 LDB3 NM_007078.3(LDB3):c.897-1_897del Deletion Uncertain significance 967716 GRCh37: 10:88466287-88466288
GRCh38: 10:86706530-86706531
47 LDB3 NM_007078.3(LDB3):c.1805A>C (p.Tyr602Ser) SNV Uncertain significance 929206 GRCh37: 10:88477849-88477849
GRCh38: 10:86718092-86718092
48 LDB3 NM_007078.3(LDB3):c.2136del (p.Lys713fs) Deletion Uncertain significance 970249 GRCh37: 10:88492685-88492685
GRCh38: 10:86732928-86732928
49 LDB3 NM_007078.3(LDB3):c.1547G>A (p.Arg516Gln) SNV Uncertain significance 970543 GRCh37: 10:88476399-88476399
GRCh38: 10:86716642-86716642
50 LDB3 NM_007078.3(LDB3):c.1639C>T (p.Arg547Trp) SNV Uncertain significance 201853 rs374426474 GRCh37: 10:88476491-88476491
GRCh38: 10:86716734-86716734
51 LDB3 NM_007078.3(LDB3):c.608C>T (p.Ser203Leu) SNV Uncertain significance 970872 GRCh37: 10:88441479-88441479
GRCh38: 10:86681722-86681722
52 LDB3 NM_007078.3(LDB3):c.1153A>G (p.Ser385Gly) SNV Uncertain significance 228793 rs777547764 GRCh37: 10:88469729-88469729
GRCh38: 10:86709972-86709972
53 LDB3 NM_007078.3(LDB3):c.1599G>C (p.Arg533Ser) SNV Uncertain significance 972156 GRCh37: 10:88476451-88476451
GRCh38: 10:86716694-86716694
54 LDB3 NM_007078.3(LDB3):c.390AGGCACCCC[1] (p.131GTP[1]) Microsatellite Uncertain significance 972381 GRCh37: 10:88441258-88441266
GRCh38: 10:86681501-86681509
55 LDB3 NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) SNV Uncertain significance 4731 rs45487699 GRCh37: 10:88441437-88441437
GRCh38: 10:86681680-86681680
56 LDB3 NM_007078.3(LDB3):c.1676G>A (p.Arg559Gln) SNV Uncertain significance 464285 rs763908636 GRCh37: 10:88476528-88476528
GRCh38: 10:86716771-86716771
57 LDB3 NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) SNV Uncertain significance 45533 rs145983824 GRCh37: 10:88477867-88477867
GRCh38: 10:86718110-86718110
58 LDB3 NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) SNV Uncertain significance 179653 rs530979771 GRCh37: 10:88441527-88441527
GRCh38: 10:86681770-86681770
59 LDB3 NM_007078.3(LDB3):c.160G>A (p.Gly54Ser) SNV Uncertain significance 93526 rs201786090 GRCh37: 10:88439190-88439190
GRCh38: 10:86679433-86679433
60 LDB3 NM_007078.3(LDB3):c.304G>A (p.Val102Met) SNV Uncertain significance 1034674 GRCh37: 10:88439897-88439897
GRCh38: 10:86680140-86680140
61 LDB3 NM_007078.3(LDB3):c.172G>A (p.Asp58Asn) SNV Uncertain significance 180398 rs730880127 GRCh37: 10:88439202-88439202
GRCh38: 10:86679445-86679445
62 LDB3 NM_007078.3(LDB3):c.1418C>A (p.Pro473His) SNV Uncertain significance 1036031 GRCh37: 10:88476270-88476270
GRCh38: 10:86716513-86716513
63 LDB3 NM_007078.3(LDB3):c.2177A>G (p.Asn726Ser) SNV Uncertain significance 1038576 GRCh37: 10:88492726-88492726
GRCh38: 10:86732969-86732969
64 LDB3 NM_007078.3(LDB3):c.2056C>G (p.Leu686Val) SNV Uncertain significance 1039920 GRCh37: 10:88485971-88485971
GRCh38: 10:86726214-86726214
65 LDB3 NM_007078.3(LDB3):c.1231G>C (p.Val411Leu) SNV Uncertain significance 1040330 GRCh37: 10:88469807-88469807
GRCh38: 10:86710050-86710050
66 LDB3 NM_007078.3(LDB3):c.2094+3A>G SNV Uncertain significance 1040447 GRCh37: 10:88486012-88486012
GRCh38: 10:86726255-86726255
67 LDB3 NM_007078.3(LDB3):c.897-7T>A SNV Uncertain significance 1040955 GRCh37: 10:88466281-88466281
GRCh38: 10:86706524-86706524
68 LDB3 NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) SNV Uncertain significance 228797 rs749520121 GRCh37: 10:88466382-88466382
GRCh38: 10:86706625-86706625
69 LDB3 NM_007078.3(LDB3):c.1472T>A (p.Val491Glu) SNV Uncertain significance 45522 rs139709036 GRCh37: 10:88476324-88476324
GRCh38: 10:86716567-86716567
70 LDB3 NM_007078.3(LDB3):c.1654G>A (p.Gly552Ser) SNV Uncertain significance 1042070 GRCh37: 10:88476506-88476506
GRCh38: 10:86716749-86716749
71 LDB3 NM_007078.3(LDB3):c.896+6730A>T SNV Uncertain significance 1043059 GRCh37: 10:88459058-88459058
GRCh38: 10:86699301-86699301
72 LDB3 NM_007078.3(LDB3):c.91C>G (p.Arg31Gly) SNV Uncertain significance 1043754 GRCh37: 10:88428539-88428539
GRCh38: 10:86668782-86668782
73 LDB3 NM_007078.3(LDB3):c.992C>T (p.Ala331Val) SNV Uncertain significance 1043971 GRCh37: 10:88466383-88466383
GRCh38: 10:86706626-86706626
74 LDB3 NM_007078.3(LDB3):c.1904T>A (p.Val635Asp) SNV Uncertain significance 1047110 GRCh37: 10:88478530-88478530
GRCh38: 10:86718773-86718773
75 LDB3 NM_007078.3(LDB3):c.368G>A (p.Ser123Asn) SNV Uncertain significance 1047143 GRCh37: 10:88441239-88441239
GRCh38: 10:86681482-86681482
76 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4819A>C SNV Uncertain significance 1042362 GRCh37: 10:88446834-88446834
GRCh38: 10:86687077-86687077
77 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4700A>G SNV Uncertain significance 1000429 GRCh37: 10:88446953-88446953
GRCh38: 10:86687196-86687196
78 LDB3 NM_007078.3(LDB3):c.896+6761G>A SNV Uncertain significance 1001715 GRCh37: 10:88459089-88459089
GRCh38: 10:86699332-86699332
79 LDB3 NM_007078.3(LDB3):c.2037C>T (p.Gly679=) SNV Uncertain significance 1002404 GRCh37: 10:88485952-88485952
GRCh38: 10:86726195-86726195
80 LDB3 NM_007078.3(LDB3):c.2050G>A (p.Glu684Lys) SNV Uncertain significance 1004178 GRCh37: 10:88485965-88485965
GRCh38: 10:86726208-86726208
81 LDB3 NM_007078.3(LDB3):c.1858-3C>A SNV Uncertain significance 1004983 GRCh37: 10:88478481-88478481
GRCh38: 10:86718724-86718724
82 LDB3 NM_007078.3(LDB3):c.1253C>T (p.Pro418Leu) SNV Uncertain significance 518695 rs141870580 GRCh37: 10:88476105-88476105
GRCh38: 10:86716348-86716348
83 LDB3 NM_007078.3(LDB3):c.940A>G (p.Thr314Ala) SNV Uncertain significance 1006545 GRCh37: 10:88466331-88466331
GRCh38: 10:86706574-86706574
84 LDB3 NM_007078.3(LDB3):c.31G>A (p.Gly11Arg) SNV Uncertain significance 1007871 GRCh37: 10:88428479-88428479
GRCh38: 10:86668722-86668722
85 LDB3 NM_007078.3(LDB3):c.833T>G (p.Leu278Arg) SNV Uncertain significance 1008504 GRCh37: 10:88451796-88451796
GRCh38: 10:86692039-86692039
86 LDB3 NM_007078.3(LDB3):c.149T>C (p.Val50Ala) SNV Uncertain significance 1008827 GRCh37: 10:88439179-88439179
GRCh38: 10:86679422-86679422
87 LDB3 NM_007078.3(LDB3):c.465C>A (p.Leu155=) SNV Uncertain significance 1009362 GRCh37: 10:88441336-88441336
GRCh38: 10:86681579-86681579
88 LDB3 NM_007078.3(LDB3):c.944C>T (p.Pro315Leu) SNV Uncertain significance 1009580 GRCh37: 10:88466335-88466335
GRCh38: 10:86706578-86706578
89 LDB3 NM_007078.3(LDB3):c.1763G>A (p.Cys588Tyr) SNV Uncertain significance 1010214 GRCh37: 10:88477807-88477807
GRCh38: 10:86718050-86718050
90 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4808T>A SNV Uncertain significance 1010493 GRCh37: 10:88446845-88446845
GRCh38: 10:86687088-86687088
91 LDB3 NM_007078.3(LDB3):c.1812A>G (p.Gln604=) SNV Uncertain significance 1011083 GRCh37: 10:88477856-88477856
GRCh38: 10:86718099-86718099
92 LDB3 NM_007078.3(LDB3):c.896+6739G>A SNV Uncertain significance 1011881 GRCh37: 10:88459067-88459067
GRCh38: 10:86699310-86699310
93 LDB3 NM_007078.3(LDB3):c.1253C>G (p.Pro418Arg) SNV Uncertain significance 406810 rs141870580 GRCh37: 10:88476105-88476105
GRCh38: 10:86716348-86716348
94 LDB3 NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) SNV Uncertain significance 36446 rs45577134 GRCh37: 10:88486007-88486007
GRCh38: 10:86726250-86726250
95 LDB3 NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) Microsatellite Uncertain significance 45514 rs397517209 GRCh37: 10:88476135-88476158
GRCh38: 10:86716378-86716401
96 LDB3 NM_007078.3(LDB3):c.2174T>A (p.Ile725Asn) SNV Uncertain significance 532921 rs748399477 GRCh37: 10:88492723-88492723
GRCh38: 10:86732966-86732966
97 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4692G>A SNV Uncertain significance 532924 rs1413446799 GRCh37: 10:88446961-88446961
GRCh38: 10:86687204-86687204
98 LDB3 NM_007078.3(LDB3):c.242del (p.Gln81fs) Deletion Uncertain significance 532929 rs1554849133 GRCh37: 10:88439272-88439272
GRCh38: 10:86679515-86679515
99 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4739G>A SNV Uncertain significance 518946 rs376489385 GRCh37: 10:88446914-88446914
GRCh38: 10:86687157-86687157
100 LDB3 NM_007078.3(LDB3):c.530C>T (p.Ala177Val) SNV Uncertain significance 178834 rs397517224 GRCh37: 10:88441401-88441401
GRCh38: 10:86681644-86681644
101 LDB3 NM_007078.3(LDB3):c.1664A>G (p.Asn555Ser) SNV Uncertain significance 650424 rs760635362 GRCh37: 10:88476516-88476516
GRCh38: 10:86716759-86716759
102 LDB3 NM_007078.3(LDB3):c.1885T>C (p.Trp629Arg) SNV Uncertain significance 651386 rs773554501 GRCh37: 10:88478511-88478511
GRCh38: 10:86718754-86718754
103 LDB3 NM_007078.3(LDB3):c.1773del (p.Glu592fs) Deletion Uncertain significance 666190 rs776530913 GRCh37: 10:88477816-88477816
GRCh38: 10:86718059-86718059
104 LDB3 NM_007078.3(LDB3):c.896+6754G>A SNV Uncertain significance 836699 GRCh37: 10:88459082-88459082
GRCh38: 10:86699325-86699325
105 LDB3 NM_007078.3(LDB3):c.784G>A (p.Glu262Lys) SNV Uncertain significance 839351 GRCh37: 10:88451747-88451747
GRCh38: 10:86691990-86691990
106 LDB3 NM_007078.3(LDB3):c.145G>C (p.Val49Leu) SNV Uncertain significance 864365 GRCh37: 10:88439175-88439175
GRCh38: 10:86679418-86679418
107 LDB3 NM_007078.3(LDB3):c.818G>A (p.Arg273His) SNV Uncertain significance 880174 GRCh37: 10:88451781-88451781
GRCh38: 10:86692024-86692024
108 LDB3 NM_007078.3(LDB3):c.914C>A (p.Ala305Glu) SNV Uncertain significance 965576 GRCh37: 10:88466305-88466305
GRCh38: 10:86706548-86706548
109 LDB3 NM_007078.3(LDB3):c.1904T>G (p.Val635Gly) SNV Uncertain significance 965704 GRCh37: 10:88478530-88478530
GRCh38: 10:86718773-86718773
110 LDB3 NM_007078.3(LDB3):c.2164G>A (p.Ala722Thr) SNV Uncertain significance 179788 rs727505129 GRCh37: 10:88492713-88492713
GRCh38: 10:86732956-86732956
111 LDB3 NM_007078.3(LDB3):c.626A>T (p.Glu209Val) SNV Uncertain significance 966501 GRCh37: 10:88441497-88441497
GRCh38: 10:86681740-86681740
112 LDB3 NM_007078.3(LDB3):c.1351C>G (p.Pro451Ala) SNV Uncertain significance 967764 GRCh37: 10:88476203-88476203
GRCh38: 10:86716446-86716446
113 LDB3 NM_007078.3(LDB3):c.1094C>T (p.Ala365Val) SNV Uncertain significance 968601 GRCh37: 10:88469670-88469670
GRCh38: 10:86709913-86709913
114 LDB3 NM_007078.3(LDB3):c.47G>A (p.Arg16His) SNV Uncertain significance 969485 GRCh37: 10:88428495-88428495
GRCh38: 10:86668738-86668738
115 LDB3 NM_007078.3(LDB3):c.1435G>A (p.Gly479Arg) SNV Uncertain significance 807925 rs370521488 GRCh37: 10:88476287-88476287
GRCh38: 10:86716530-86716530
116 LDB3 NM_007078.3(LDB3):c.1147A>G (p.Ser383Gly) SNV Uncertain significance 970025 GRCh37: 10:88469723-88469723
GRCh38: 10:86709966-86709966
117 LDB3 NM_007078.3(LDB3):c.2066C>G (p.Thr689Ser) SNV Uncertain significance 970355 GRCh37: 10:88485981-88485981
GRCh38: 10:86726224-86726224
118 LDB3 NM_007078.3(LDB3):c.896+6730A>G SNV Uncertain significance 970860 GRCh37: 10:88459058-88459058
GRCh38: 10:86699301-86699301
119 LDB3 NM_007078.3(LDB3):c.2150T>G (p.Leu717Arg) SNV Uncertain significance 970930 GRCh37: 10:88492699-88492699
GRCh38: 10:86732942-86732942
120 LDB3 NM_007078.3(LDB3):c.2128T>C (p.Tyr710His) SNV Uncertain significance 972153 GRCh37: 10:88492677-88492677
GRCh38: 10:86732920-86732920
121 LDB3 NM_007078.3(LDB3):c.2074G>A (p.Asp692Asn) SNV Uncertain significance 972216 GRCh37: 10:88485989-88485989
GRCh38: 10:86726232-86726232
122 LDB3 NM_007078.3(LDB3):c.494G>A (p.Arg165Gln) SNV Uncertain significance 222686 rs61857115 GRCh37: 10:88441365-88441365
GRCh38: 10:86681608-86681608
123 LDB3 NM_007078.3(LDB3):c.1502C>T (p.Ala501Val) SNV Uncertain significance 426972 rs755362259 GRCh37: 10:88476354-88476354
GRCh38: 10:86716597-86716597
124 LDB3 NM_007078.3(LDB3):c.1978+2_1978+5del Deletion Uncertain significance 503909 rs1554864768 GRCh37: 10:88478603-88478606
GRCh38: 10:86718846-86718849
125 LDB3 NC_000010.10:g.(?_88428443)_(88428547_?)dup Duplication Uncertain significance 1015629 GRCh37: 10:88428443-88428547
GRCh38:
126 LDB3 NC_000010.10:g.88469652-?_88492743+?dup Duplication Uncertain significance 1018562 GRCh37: 10:88469652-88469652
GRCh38:
127 LDB3 NM_007078.3(LDB3):c.1502C>T (p.Ala501Val) SNV Uncertain significance 426972 rs755362259 GRCh37: 10:88476354-88476354
GRCh38: 10:86716597-86716597
128 LDB3 NM_007078.3(LDB3):c.953C>A (p.Pro318His) SNV Uncertain significance 1022592 GRCh37: 10:88466344-88466344
GRCh38: 10:86706587-86706587
129 LDB3 NM_007078.3(LDB3):c.1337C>T (p.Thr446Ile) SNV Uncertain significance 1023461 GRCh37: 10:88476189-88476189
GRCh38: 10:86716432-86716432
130 LDB3 NM_007078.3(LDB3):c.733G>A (p.Val245Ile) SNV Uncertain significance 179323 rs573061464 GRCh37: 10:88451696-88451696
GRCh38: 10:86691939-86691939
131 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4826G>A SNV Uncertain significance 191696 rs200458194 GRCh37: 10:88446827-88446827
GRCh38: 10:86687070-86687070
132 LDB3 NM_007078.3(LDB3):c.1535A>G (p.Gln512Arg) SNV Uncertain significance 1024979 GRCh37: 10:88476387-88476387
GRCh38: 10:86716630-86716630
133 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4717C>A SNV Uncertain significance 1026419 GRCh37: 10:88446936-88446936
GRCh38: 10:86687179-86687179
134 LDB3 NM_007078.3(LDB3):c.145G>A (p.Val49Met) SNV Uncertain significance 1026525 GRCh37: 10:88439175-88439175
GRCh38: 10:86679418-86679418
135 LDB3 NM_007078.3(LDB3):c.1361C>T (p.Thr454Ile) SNV Uncertain significance 1027025 GRCh37: 10:88476213-88476213
GRCh38: 10:86716456-86716456
136 LDB3 NM_007078.3(LDB3):c.592C>T (p.Pro198Ser) SNV Uncertain significance 406808 rs1060501318 GRCh37: 10:88441463-88441463
GRCh38: 10:86681706-86681706
137 LDB3 NM_007078.3(LDB3):c.91C>T (p.Arg31Trp) SNV Uncertain significance 201857 rs367792378 GRCh37: 10:88428539-88428539
GRCh38: 10:86668782-86668782
138 LDB3 NM_007078.3(LDB3):c.1487T>C (p.Phe496Ser) SNV Uncertain significance 201849 rs147072071 GRCh37: 10:88476339-88476339
GRCh38: 10:86716582-86716582
139 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4802C>A SNV Uncertain significance 201860 rs755513516 GRCh37: 10:88446851-88446851
GRCh38: 10:86687094-86687094
140 LDB3 NM_007078.3(LDB3):c.896+6768G>A SNV Uncertain significance 532930 rs771037817 GRCh37: 10:88459096-88459096
GRCh38: 10:86699339-86699339
141 LDB3 NM_007078.3(LDB3):c.1957G>C (p.Gly653Arg) SNV Uncertain significance 565522 rs149945820 GRCh37: 10:88478583-88478583
GRCh38: 10:86718826-86718826
142 LDB3 NM_007078.3(LDB3):c.1520C>A (p.Thr507Asn) SNV Uncertain significance 565990 rs150188572 GRCh37: 10:88476372-88476372
GRCh38: 10:86716615-86716615
143 LDB3 NM_007078.3(LDB3):c.72C>A (p.Asn24Lys) SNV Uncertain significance 567732 rs1323002546 GRCh37: 10:88428520-88428520
GRCh38: 10:86668763-86668763
144 LDB3 NM_007078.3(LDB3):c.1312A>G (p.Thr438Ala) SNV Uncertain significance 568889 rs111941389 GRCh37: 10:88476164-88476164
GRCh38: 10:86716407-86716407
145 LDB3 NM_007078.3(LDB3):c.1972G>A (p.Glu658Lys) SNV Uncertain significance 582501 rs760563152 GRCh37: 10:88478598-88478598
GRCh38: 10:86718841-86718841
146 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4655C>A SNV Uncertain significance 641190 rs1220958570 GRCh37: 10:88446998-88446998
GRCh38: 10:86687241-86687241
147 LDB3 NM_007078.3(LDB3):c.1798C>T (p.Arg600Ter) SNV Uncertain significance 163853 rs727503132 GRCh37: 10:88477842-88477842
GRCh38: 10:86718085-86718085
148 LDB3 NM_007078.3(LDB3):c.1165G>A (p.Ala389Thr) SNV Uncertain significance 666120 rs924634578 GRCh37: 10:88469741-88469741
GRCh38: 10:86709984-86709984
149 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4827C>T SNV Uncertain significance 862142 GRCh37: 10:88446826-88446826
GRCh38: 10:86687069-86687069
150 LDB3 NM_007078.3(LDB3):c.-24+41G>A SNV Uncertain significance 301330 rs45578532 GRCh37: 10:88428368-88428368
GRCh38: 10:86668611-86668611
151 LDB3 NM_007078.3(LDB3):c.723C>T (p.Ser241=) SNV Uncertain significance 301336 rs200580597 GRCh37: 10:88451686-88451686
GRCh38: 10:86691929-86691929
152 LDB3 NM_007078.3(LDB3):c.897-6525T>C SNV Uncertain significance 301344 rs886047356 GRCh37: 10:88459763-88459763
GRCh38: 10:86700006-86700006
153 LDB3 NM_007078.3(LDB3):c.897-6665C>T SNV Uncertain significance 301343 rs549156118 GRCh37: 10:88459623-88459623
GRCh38: 10:86699866-86699866
154 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4716G>T SNV Uncertain significance 43878 rs371708921 GRCh37: 10:88446937-88446937
GRCh38: 10:86687180-86687180
155 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4618C>A SNV Uncertain significance 301334 rs764620834 GRCh37: 10:88447035-88447035
GRCh38: 10:86687278-86687278
156 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4619G>T SNV Uncertain significance 301333 rs761090088 GRCh37: 10:88447034-88447034
GRCh38: 10:86687277-86687277
157 LDB3 NM_007078.3(LDB3):c.897-6834C>T SNV Uncertain significance 301340 rs185972751 GRCh37: 10:88459454-88459454
GRCh38: 10:86699697-86699697
158 LDB3 NM_007078.3(LDB3):c.896+6738C>T SNV Uncertain significance 198762 rs377201153 GRCh37: 10:88459066-88459066
GRCh38: 10:86699309-86699309
159 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4621A>G SNV Uncertain significance 518922 rs370053163 GRCh37: 10:88447032-88447032
GRCh38: 10:86687275-86687275
160 LDB3 NM_007078.3(LDB3):c.2155A>C (p.Lys719Gln) SNV Uncertain significance 519083 rs397517220 GRCh37: 10:88492704-88492704
GRCh38: 10:86732947-86732947
161 LDB3 NM_007078.3(LDB3):c.548del (p.Pro183fs) Deletion Uncertain significance 518778 rs1285270306 GRCh37: 10:88441417-88441417
GRCh38: 10:86681660-86681660
162 LDB3 and overlap with 1 gene(s) NC_000010.11:g.(?_86668564)_(86700053_?)del Deletion Uncertain significance 417392 GRCh37: 10:88428321-88459810
GRCh38: 10:86668564-86700053
163 LDB3 and overlap with 1 gene(s) NC_000010.11:g.(?_86668672)_(86710070_?)del Deletion Uncertain significance 532937 GRCh37: 10:88428429-88469827
GRCh38: 10:86668672-86710070
164 LDB3 NM_007078.3(LDB3):c.-23-32C>A SNV Uncertain significance 301331 rs34972863 GRCh37: 10:88428394-88428394
GRCh38: 10:86668637-86668637
165 LDB3 , LOC110121486 NM_007078.3(LDB3):c.689+3861C>T SNV Uncertain significance 227494 rs754704023 GRCh37: 10:88445421-88445421
GRCh38: 10:86685664-86685664
166 LDB3 NM_007078.3(LDB3):c.896+6957G>A SNV Uncertain significance 301337 rs886047354 GRCh37: 10:88459285-88459285
GRCh38: 10:86699528-86699528
167 LDB3 NM_007078.3(LDB3):c.30C>G (p.Pro10=) SNV Uncertain significance 301332 rs766817285 GRCh37: 10:88428478-88428478
GRCh38: 10:86668721-86668721
168 LDB3 NM_007078.3(LDB3):c.897-6707G>A SNV Uncertain significance 301342 rs537660741 GRCh37: 10:88459581-88459581
GRCh38: 10:86699824-86699824
169 LDB3 NM_007078.3(LDB3):c.897-6909G>A SNV Uncertain significance 301339 rs532856980 GRCh37: 10:88459379-88459379
GRCh38: 10:86699622-86699622
170 LDB3 NM_007078.3(LDB3):c.897-6831C>T SNV Uncertain significance 301341 rs886047355 GRCh37: 10:88459457-88459457
GRCh38: 10:86699700-86699700
171 LDB3 NM_007078.3(LDB3):c.290A>G (p.Gln97Arg) SNV Uncertain significance 217828 rs762580653 GRCh37: 10:88439883-88439883
GRCh38: 10:86680126-86680126
172 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4682G>C SNV Uncertain significance 532931 rs1000020884 GRCh37: 10:88446971-88446971
GRCh38: 10:86687214-86687214
173 LDB3 NM_007078.3(LDB3):c.896+6814G>A SNV Uncertain significance 877397 GRCh37: 10:88459142-88459142
GRCh38: 10:86699385-86699385
174 LDB3 NM_007078.3(LDB3):c.896+6872G>A SNV Uncertain significance 877398 GRCh37: 10:88459200-88459200
GRCh38: 10:86699443-86699443
175 LDB3 NM_007078.3(LDB3):c.897-6745C>T SNV Uncertain significance 877456 GRCh37: 10:88459543-88459543
GRCh38: 10:86699786-86699786
176 LDB3 NM_007078.3(LDB3):c.897-6719C>T SNV Uncertain significance 877457 GRCh37: 10:88459569-88459569
GRCh38: 10:86699812-86699812
177 LDB3 NM_007078.3(LDB3):c.897-6702C>G SNV Uncertain significance 878478 GRCh37: 10:88459586-88459586
GRCh38: 10:86699829-86699829
178 LDB3 NM_007078.3(LDB3):c.897-6700G>A SNV Uncertain significance 878479 GRCh37: 10:88459588-88459588
GRCh38: 10:86699831-86699831
179 LDB3 NM_007078.3(LDB3):c.897-6692C>T SNV Uncertain significance 878480 GRCh37: 10:88459596-88459596
GRCh38: 10:86699839-86699839
180 LDB3 NM_007078.3(LDB3):c.897-6861G>A SNV Uncertain significance 879009 GRCh37: 10:88459427-88459427
GRCh38: 10:86699670-86699670
181 LDB3 NM_007078.3(LDB3):c.897-6664G>A SNV Uncertain significance 879063 GRCh37: 10:88459624-88459624
GRCh38: 10:86699867-86699867
182 LDB3 NM_007078.3(LDB3):c.896+6695T>C SNV Uncertain significance 880175 GRCh37: 10:88459023-88459023
GRCh38: 10:86699266-86699266
183 LDB3 NM_007078.3(LDB3):c.1018G>C (p.Ala340Pro) SNV Uncertain significance 626501 rs755329877 GRCh37: 10:88466409-88466409
GRCh38: 10:86706652-86706652
184 LDB3 NM_007078.3(LDB3):c.1609del (p.Gln537fs) Deletion Uncertain significance 163850 rs727503129 GRCh37: 10:88476460-88476460
GRCh38: 10:86716703-86716703
185 LDB3 NM_007078.3(LDB3):c.529dup (p.Ala177fs) Duplication Uncertain significance 178668 rs730880345 GRCh37: 10:88441395-88441396
GRCh38: 10:86681638-86681639
186 LDB3 NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) SNV Uncertain significance 227498 rs375306400 GRCh37: 10:88441539-88441539
GRCh38: 10:86681782-86681782
187 LDB3 NM_007078.3(LDB3):c.1971C>T (p.Cys657=) SNV Uncertain significance 45537 rs140552419 GRCh37: 10:88478597-88478597
GRCh38: 10:86718840-86718840
188 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4617G>A SNV Uncertain significance 301335 rs754174632 GRCh37: 10:88447036-88447036
GRCh38: 10:86687279-86687279
189 LDB3 NM_007078.3(LDB3):c.287T>C (p.Val96Ala) SNV Uncertain significance 201834 rs794729056 GRCh37: 10:88439880-88439880
GRCh38: 10:86680123-86680123
190 LDB3 NM_007078.3(LDB3):c.2124G>A (p.Pro708=) SNV Uncertain significance 389706 rs759812655 GRCh37: 10:88492673-88492673
GRCh38: 10:86732916-86732916
191 LDB3 NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) SNV Uncertain significance 179553 rs727504944 GRCh37: 10:88477818-88477818
GRCh38: 10:86718061-86718061
192 LDB3 NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) SNV Uncertain significance 4735 rs45514002 GRCh37: 10:88485932-88485932
GRCh38: 10:86726175-86726175
193 LDB3 NM_007078.3(LDB3):c.896+6753C>T SNV Uncertain significance 4729 rs121908335 GRCh37: 10:88459081-88459081
GRCh38: 10:86699324-86699324
194 LDB3 NM_007078.3(LDB3):c.1703G>A (p.Arg568His) SNV Uncertain significance 464286 rs769156627 GRCh37: 10:88477747-88477747
GRCh38: 10:86717990-86717990
195 LDB3 NM_007078.3(LDB3):c.1696A>G (p.Met566Val) SNV Uncertain significance 646981 rs775232208 GRCh37: 10:88477740-88477740
GRCh38: 10:86717983-86717983
196 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4682G>C SNV Uncertain significance 532931 rs1000020884 GRCh37: 10:88446971-88446971
GRCh38: 10:86687214-86687214
197 LDB3 NM_007078.3(LDB3):c.139G>A (p.Asp47Asn) SNV Uncertain significance 45517 rs397517212 GRCh37: 10:88439169-88439169
GRCh38: 10:86679412-86679412
198 LDB3 NM_007078.3(LDB3):c.2119C>T (p.Gln707Ter) SNV Uncertain significance 658042 rs771316707 GRCh37: 10:88492668-88492668
GRCh38: 10:86732911-86732911
199 LDB3 NM_007078.3(LDB3):c.1505C>T (p.Pro502Leu) SNV Uncertain significance 639660 rs528611881 GRCh37: 10:88476357-88476357
GRCh38: 10:86716600-86716600
200 LDB3 NM_007078.3(LDB3):c.1903G>C (p.Val635Leu) SNV Uncertain significance 645903 rs45618633 GRCh37: 10:88478529-88478529
GRCh38: 10:86718772-86718772
201 LDB3 NM_007078.3(LDB3):c.1649T>C (p.Leu550Pro) SNV Uncertain significance 646726 rs1589675409 GRCh37: 10:88476501-88476501
GRCh38: 10:86716744-86716744
202 LDB3 NM_007078.3(LDB3):c.1468T>C (p.Trp490Arg) SNV Uncertain significance 651763 rs1589675054 GRCh37: 10:88476320-88476320
GRCh38: 10:86716563-86716563
203 LDB3 NM_007078.3(LDB3):c.1211G>A (p.Arg404Gln) SNV Uncertain significance 655105 rs150868546 GRCh37: 10:88469787-88469787
GRCh38: 10:86710030-86710030
204 LDB3 NM_007078.3(LDB3):c.1603_1605delinsTGCCACTCA (p.Thr535delinsCysHisSer) Indel Uncertain significance 659124 rs1589675306 GRCh37: 10:88476455-88476457
GRCh38: 10:86716698-86716700
205 LDB3 NM_007078.3(LDB3):c.1789T>A (p.Tyr597Asn) SNV Uncertain significance 406805 rs727503131 GRCh37: 10:88477833-88477833
GRCh38: 10:86718076-86718076
206 LDB3 NM_007078.3(LDB3):c.1321C>T (p.Pro441Ser) SNV Uncertain significance 429038 rs757728320 GRCh37: 10:88476173-88476173
GRCh38: 10:86716416-86716416
207 LDB3 NM_007078.3(LDB3):c.1497G>T (p.Lys499Asn) SNV Uncertain significance 565870 rs1278770988 GRCh37: 10:88476349-88476349
GRCh38: 10:86716592-86716592
208 LDB3 NM_007078.3(LDB3):c.1633A>G (p.Ser545Gly) SNV Uncertain significance 640656 rs1370639524 GRCh37: 10:88476485-88476485
GRCh38: 10:86716728-86716728
209 LDB3 NM_007078.3(LDB3):c.1459C>T (p.Arg487Cys) SNV Uncertain significance 967769 GRCh37: 10:88476311-88476311
GRCh38: 10:86716554-86716554
210 LDB3 NM_007078.3(LDB3):c.1857+3A>G SNV Uncertain significance 967875 GRCh37: 10:88477904-88477904
GRCh38: 10:86718147-86718147
211 LDB3 NM_007078.3(LDB3):c.998C>T (p.Ser333Leu) SNV Uncertain significance 968380 GRCh37: 10:88466389-88466389
GRCh38: 10:86706632-86706632
212 LDB3 NM_007078.3(LDB3):c.2173A>C (p.Ile725Leu) SNV Uncertain significance 970070 GRCh37: 10:88492722-88492722
GRCh38: 10:86732965-86732965
213 LDB3 NM_007078.3(LDB3):c.1745C>G (p.Thr582Ser) SNV Uncertain significance 972276 GRCh37: 10:88477789-88477789
GRCh38: 10:86718032-86718032
214 LDB3 NM_007078.3(LDB3):c.2104G>T (p.Val702Leu) SNV Uncertain significance 532922 rs773235586 GRCh37: 10:88492653-88492653
GRCh38: 10:86732896-86732896
215 LDB3 NM_007078.3(LDB3):c.1328C>T (p.Pro443Leu) SNV Uncertain significance 532925 rs1554863327 GRCh37: 10:88476180-88476180
GRCh38: 10:86716423-86716423
216 LDB3 NM_007078.3(LDB3):c.1902C>A (p.Phe634Leu) SNV Uncertain significance 532926 rs773904344 GRCh37: 10:88478528-88478528
GRCh38: 10:86718771-86718771
217 LDB3 NM_007078.3(LDB3):c.2173A>G (p.Ile725Val) SNV Uncertain significance 532928 rs1554870749 GRCh37: 10:88492722-88492722
GRCh38: 10:86732965-86732965
218 LDB3 NM_007078.3(LDB3):c.1640G>A (p.Arg547Gln) SNV Uncertain significance 532934 rs201968826 GRCh37: 10:88476492-88476492
GRCh38: 10:86716735-86716735
219 LDB3 NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp) SNV Uncertain significance 240718 rs145655904 GRCh37: 10:88476233-88476233
GRCh38: 10:86716476-86716476
220 LDB3 NM_007078.2(LDB3):c.-23-?_93+?dup Duplication Uncertain significance 254045 GRCh37:
GRCh38:
221 LDB3 NM_007078.3(LDB3):c.1313C>G (p.Thr438Ser) SNV Uncertain significance 406812 rs767914340 GRCh37: 10:88476165-88476165
GRCh38: 10:86716408-86716408
222 LDB3 NM_007078.3(LDB3):c.1445C>T (p.Ala482Val) SNV Uncertain significance 406802 rs774313535 GRCh37: 10:88476297-88476297
GRCh38: 10:86716540-86716540
223 LDB3 NM_007078.3(LDB3):c.1121C>T (p.Ala374Val) SNV Uncertain significance 464282 rs1554860812 GRCh37: 10:88469697-88469697
GRCh38: 10:86709940-86709940
224 LDB3 NM_007078.3(LDB3):c.1150T>A (p.Tyr384Asn) SNV Uncertain significance 464290 rs1554860857 GRCh37: 10:88469726-88469726
GRCh38: 10:86709969-86709969
225 LDB3 NM_007078.3(LDB3):c.1421C>T (p.Ser474Leu) SNV Uncertain significance 464283 rs1011836119 GRCh37: 10:88476273-88476273
GRCh38: 10:86716516-86716516
226 LDB3 NM_007078.3(LDB3):c.1894A>G (p.Thr632Ala) SNV Uncertain significance 566525 rs770525232 GRCh37: 10:88478520-88478520
GRCh38: 10:86718763-86718763
227 LDB3 NM_007078.3(LDB3):c.1086-247_1231+2del Deletion Uncertain significance 568463 rs1564653469 GRCh37: 10:88469414-88469808
GRCh38: 10:86709657-86710051
228 LDB3 NM_007078.3(LDB3):c.1132C>T (p.Pro378Ser) SNV Uncertain significance 575047 rs373546361 GRCh37: 10:88469708-88469708
GRCh38: 10:86709951-86709951
229 LDB3 NM_007078.3(LDB3):c.1736A>G (p.Tyr579Cys) SNV Uncertain significance 191700 rs199749907 GRCh37: 10:88477780-88477780
GRCh38: 10:86718023-86718023
230 LDB3 NM_007078.3(LDB3):c.690-2A>G SNV Uncertain significance 406801 rs1060501315 GRCh37: 10:88451651-88451651
GRCh38: 10:86691894-86691894
231 LDB3 , LOC110121486 NM_007078.3(LDB3):c.689+3899T>C SNV Uncertain significance 464274 rs1264291601 GRCh37: 10:88445459-88445459
GRCh38: 10:86685702-86685702
232 LDB3 NM_007078.3(LDB3):c.897-6759C>G SNV Uncertain significance 464271 rs11594242 GRCh37: 10:88459529-88459529
GRCh38: 10:86699772-86699772
233 LDB3 NM_007078.3(LDB3):c.529del (p.Ala177fs) Deletion Uncertain significance 464289 rs730880345 GRCh37: 10:88441396-88441396
GRCh38: 10:86681639-86681639
234 LDB3 NM_007078.3(LDB3):c.99dup (p.Pro34fs) Duplication Uncertain significance 532923 rs1554849000 GRCh37: 10:88439128-88439129
GRCh38: 10:86679371-86679372
235 LDB3 NM_007078.3(LDB3):c.94-9T>C SNV Uncertain significance 571578 rs1282721488 GRCh37: 10:88439115-88439115
GRCh38: 10:86679358-86679358
236 LDB3 NM_007078.3(LDB3):c.1601_1602dup (p.Thr535fs) Duplication Uncertain significance 971105 GRCh37: 10:88476449-88476450
GRCh38: 10:86716692-86716693
237 LDB3 NM_007078.3(LDB3):c.886C>T (p.Arg296Ter) SNV Uncertain significance 406804 rs1060501316 GRCh37: 10:88452318-88452318
GRCh38: 10:86692561-86692561
238 LDB3 NM_007078.3(LDB3):c.23C>A (p.Thr8Asn) SNV Uncertain significance 406807 rs1060501317 GRCh37: 10:88428471-88428471
GRCh38: 10:86668714-86668714
239 LDB3 NM_007078.3(LDB3):c.896+6723G>C SNV Uncertain significance 406799 rs868365512 GRCh37: 10:88459051-88459051
GRCh38: 10:86699294-86699294
240 LDB3 NM_007078.3(LDB3):c.896+6721C>T SNV Uncertain significance 406809 rs375798002 GRCh37: 10:88459049-88459049
GRCh38: 10:86699292-86699292
241 LDB3 NM_007078.3(LDB3):c.196C>T (p.Gln66Ter) SNV Uncertain significance 532932 rs1554849100 GRCh37: 10:88439226-88439226
GRCh38: 10:86679469-86679469
242 LDB3 NM_007078.3(LDB3):c.272C>T (p.Thr91Met) SNV Uncertain significance 532933 rs769237367 GRCh37: 10:88439865-88439865
GRCh38: 10:86680108-86680108
243 LDB3 NM_007078.3(LDB3):c.4T>A (p.Ser2Thr) SNV Uncertain significance 567162 rs1564626023 GRCh37: 10:88428452-88428452
GRCh38: 10:86668695-86668695
244 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4817C>T SNV Uncertain significance 576453 rs1564639205 GRCh37: 10:88446836-88446836
GRCh38: 10:86687079-86687079
245 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4642A>G SNV Uncertain significance 581549 rs1310394018 GRCh37: 10:88447011-88447011
GRCh38: 10:86687254-86687254
246 LDB3 NM_007078.3(LDB3):c.827G>A (p.Arg276His) SNV Uncertain significance 640344 rs774519585 GRCh37: 10:88451790-88451790
GRCh38: 10:86692033-86692033
247 LDB3 NM_007078.3(LDB3):c.55G>T (p.Gly19Trp) SNV Uncertain significance 642479 rs777413488 GRCh37: 10:88428503-88428503
GRCh38: 10:86668746-86668746
248 LDB3 NM_007078.3(LDB3):c.55G>A (p.Gly19Arg) SNV Uncertain significance 651199 rs777413488 GRCh37: 10:88428503-88428503
GRCh38: 10:86668746-86668746
249 LDB3 NM_007078.3(LDB3):c.92G>A (p.Arg31Gln) SNV Uncertain significance 652580 rs1410128172 GRCh37: 10:88428540-88428540
GRCh38: 10:86668783-86668783
250 LDB3 NM_007078.3(LDB3):c.896+6781A>C SNV Uncertain significance 665148 rs1589656313 GRCh37: 10:88459109-88459109
GRCh38: 10:86699352-86699352
251 LDB3 NM_007078.3(LDB3):c.281C>T (p.Pro94Leu) SNV Uncertain significance 853598 GRCh37: 10:88439874-88439874
GRCh38: 10:86680117-86680117
252 LDB3 NM_007078.3(LDB3):c.56G>A (p.Gly19Glu) SNV Uncertain significance 936330 GRCh37: 10:88428504-88428504
GRCh38: 10:86668747-86668747
253 LDB3 , LOC110121486 NM_007078.3(LDB3):c.689+3885A>G SNV Uncertain significance 951123 GRCh37: 10:88445445-88445445
GRCh38: 10:86685688-86685688
254 LDB3 NM_007078.3(LDB3):c.892T>G (p.Ser298Ala) SNV Uncertain significance 951365 GRCh37: 10:88452324-88452324
GRCh38: 10:86692567-86692567
255 LDB3 NM_007078.3(LDB3):c.896+5G>A SNV Uncertain significance 959812 GRCh37: 10:88452333-88452333
GRCh38: 10:86692576-86692576
256 LDB3 NM_007078.3(LDB3):c.724G>A (p.Ala242Thr) SNV Uncertain significance 960651 GRCh37: 10:88451687-88451687
GRCh38: 10:86691930-86691930
257 LDB3 NM_007078.3(LDB3):c.769G>C (p.Glu257Gln) SNV Uncertain significance 972169 GRCh37: 10:88451732-88451732
GRCh38: 10:86691975-86691975
258 LDB3 NM_007078.3(LDB3):c.1289C>A (p.Thr430Asn) SNV Uncertain significance 406798 rs746183666 GRCh37: 10:88476141-88476141
GRCh38: 10:86716384-86716384
259 LDB3 NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[3] (p.434_441APAYTPSP[3]) Microsatellite Uncertain significance 45515 rs397517209 GRCh37: 10:88476134-88476135
GRCh38: 10:86716377-86716378
260 LDB3 NM_007078.3(LDB3):c.858C>T (p.Phe286=) SNV Uncertain significance 464279 rs764056994 GRCh37: 10:88451821-88451821
GRCh38: 10:86692064-86692064
261 LDB3 NM_007078.3(LDB3):c.891G>T (p.Arg297Ser) SNV Uncertain significance 464280 rs374336814 GRCh37: 10:88452323-88452323
GRCh38: 10:86692566-86692566
262 LDB3 NM_007078.3(LDB3):c.1565C>A (p.Thr522Asn) SNV Uncertain significance 965639 GRCh37: 10:88476417-88476417
GRCh38: 10:86716660-86716660
263 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4705C>T SNV Uncertain significance 464276 rs778658354 GRCh37: 10:88446948-88446948
GRCh38: 10:86687191-86687191
264 LDB3 NM_007078.3(LDB3):c.782A>C (p.Asp261Ala) SNV Uncertain significance 464278 rs1285921374 GRCh37: 10:88451745-88451745
GRCh38: 10:86691988-86691988
265 LDB3 NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) SNV Uncertain significance 45516 rs397517211 GRCh37: 10:88476191-88476191
GRCh38: 10:86716434-86716434
266 LDB3 NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) SNV Uncertain significance 45535 rs397517218 GRCh37: 10:88478533-88478533
GRCh38: 10:86718776-86718776
267 LDB3 NM_007078.3(LDB3):c.887G>A (p.Arg296Gln) SNV Uncertain significance 191699 rs201689564 GRCh37: 10:88452319-88452319
GRCh38: 10:86692562-86692562
268 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4742G>A SNV Uncertain significance 522902 rs915830221 GRCh37: 10:88446911-88446911
GRCh38: 10:86687154-86687154
269 LDB3 NM_007078.3(LDB3):c.1225C>A (p.Gln409Lys) SNV Uncertain significance 279835 rs139104492 GRCh37: 10:88469801-88469801
GRCh38: 10:86710044-86710044
270 LDB3 NM_007078.3(LDB3):c.1675C>T (p.Arg559Trp) SNV Uncertain significance 464284 rs142947567 GRCh37: 10:88476527-88476527
GRCh38: 10:86716770-86716770
271 LDB3 NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) SNV Uncertain significance 45551 rs139922045 GRCh37: 10:88441535-88441535
GRCh38: 10:86681778-86681778
272 LDB3 NM_007078.3(LDB3):c.896+6717G>A SNV Uncertain significance 940001 GRCh37: 10:88459045-88459045
GRCh38: 10:86699288-86699288
273 LDB3 NM_007078.3(LDB3):c.892T>C (p.Ser298Pro) SNV Uncertain significance 943493 GRCh37: 10:88452324-88452324
GRCh38: 10:86692567-86692567
274 LDB3 NM_007078.3(LDB3):c.1071T>A (p.Pro357=) SNV Uncertain significance 178060 rs143823978 GRCh37: 10:88466462-88466462
GRCh38: 10:86706705-86706705
275 LDB3 NM_007078.3(LDB3):c.1631C>A (p.Ala544Asp) SNV Uncertain significance 966599 GRCh37: 10:88476483-88476483
GRCh38: 10:86716726-86716726
276 LDB3 NM_007078.3(LDB3):c.1426G>T (p.Ala476Ser) SNV Uncertain significance 968436 GRCh37: 10:88476278-88476278
GRCh38: 10:86716521-86716521
277 LDB3 NM_007078.3(LDB3):c.1978+6A>G SNV Uncertain significance 970133 GRCh37: 10:88478610-88478610
GRCh38: 10:86718853-86718853
278 LDB3 NM_007078.3(LDB3):c.1457dup (p.Ser486fs) Duplication Uncertain significance 972383 GRCh37: 10:88476308-88476309
GRCh38: 10:86716551-86716552
279 LDB3 NM_007078.3(LDB3):c.1556C>A (p.Pro519Gln) SNV Uncertain significance 1046280 GRCh37: 10:88476408-88476408
GRCh38: 10:86716651-86716651
280 LDB3 NM_007078.3(LDB3):c.1956C>T (p.Asp652=) SNV Likely benign 163854 rs139213290 GRCh37: 10:88478582-88478582
GRCh38: 10:86718825-86718825
281 LDB3 NM_007078.3(LDB3):c.1728C>T (p.Thr576=) SNV Likely benign 382044 rs749988944 GRCh37: 10:88477772-88477772
GRCh38: 10:86718015-86718015
282 LDB3 NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) SNV Likely benign 45551 rs139922045 GRCh37: 10:88441535-88441535
GRCh38: 10:86681778-86681778
283 LDB3 NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) SNV Likely benign 36942 rs138251566 GRCh37: 10:88466442-88466442
GRCh38: 10:86706685-86706685
284 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4803C>T SNV Likely benign 464275 rs751576160 GRCh37: 10:88446850-88446850
GRCh38: 10:86687093-86687093
285 LDB3 NM_007078.3(LDB3):c.1119C>T (p.Ala373=) SNV Likely benign 464281 rs773647394 GRCh37: 10:88469695-88469695
GRCh38: 10:86709938-86709938
286 LDB3 NM_007078.3(LDB3):c.1572G>A (p.Ala524=) SNV Likely benign 45528 rs149423035 GRCh37: 10:88476424-88476424
GRCh38: 10:86716667-86716667
287 LDB3 NM_007078.3(LDB3):c.404C>A (p.Thr135Asn) SNV Likely benign 702008 rs1004651681 GRCh37: 10:88441275-88441275
GRCh38: 10:86681518-86681518
288 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4707C>T SNV Likely benign 702697 rs200462775 GRCh37: 10:88446946-88446946
GRCh38: 10:86687189-86687189
289 LDB3 NM_007078.3(LDB3):c.30C>T (p.Pro10=) SNV Likely benign 706487 rs766817285 GRCh37: 10:88428478-88428478
GRCh38: 10:86668721-86668721
290 LDB3 NM_007078.3(LDB3):c.525G>C (p.Glu175Asp) SNV Likely benign 761489 rs757099637 GRCh37: 10:88441396-88441396
GRCh38: 10:86681639-86681639
291 LDB3 NM_007078.3(LDB3):c.399A>T (p.Pro133=) SNV Likely benign 770038 rs769713715 GRCh37: 10:88441270-88441270
GRCh38: 10:86681513-86681513
292 LDB3 NM_007078.3(LDB3):c.492G>A (p.Pro164=) SNV Likely benign 414133 rs368407147 GRCh37: 10:88441363-88441363
GRCh38: 10:86681606-86681606
293 LDB3 NM_007078.3(LDB3):c.1962G>A (p.Glu654=) SNV Likely benign 406803 rs201063130 GRCh37: 10:88478588-88478588
GRCh38: 10:86718831-86718831
294 LDB3 NM_007078.3(LDB3):c.1442C>G (p.Pro481Arg) SNV Likely benign 406806 rs12761754 GRCh37: 10:88476294-88476294
GRCh38: 10:86716537-86716537
295 LDB3 NM_007078.3(LDB3):c.2010T>C (p.His670=) SNV Likely benign 464287 rs759857527 GRCh37: 10:88485925-88485925
GRCh38: 10:86726168-86726168
296 LDB3 NM_007078.3(LDB3):c.2073C>T (p.His691=) SNV Likely benign 464288 rs45486293 GRCh37: 10:88485988-88485988
GRCh38: 10:86726231-86726231
297 LDB3 NM_007078.3(LDB3):c.897-6479C>T SNV Likely benign 532935 rs1554857593 GRCh37: 10:88459809-88459809
GRCh38: 10:86700052-86700052
298 LDB3 NM_007078.3(LDB3):c.543C>T (p.Leu181=) SNV Likely benign 697255 rs148324530 GRCh37: 10:88441414-88441414
GRCh38: 10:86681657-86681657
299 LDB3 NM_007078.3(LDB3):c.610G>A (p.Ala204Thr) SNV Likely benign 626705 rs774976112 GRCh37: 10:88441481-88441481
GRCh38: 10:86681724-86681724
300 LDB3 NM_007078.3(LDB3):c.689+10G>A SNV Likely benign 45552 rs45563234 GRCh37: 10:88441570-88441570
GRCh38: 10:86681813-86681813
301 LDB3 NM_007078.3(LDB3):c.1075G>A (p.Asp359Asn) SNV Likely benign 201845 rs557956141 GRCh37: 10:88466466-88466466
GRCh38: 10:86706709-86706709
302 LDB3 NM_007078.3(LDB3):c.689+9C>T SNV Likely benign 163831 rs727503124 GRCh37: 10:88441569-88441569
GRCh38: 10:86681812-86681812
303 LDB3 NM_007078.3(LDB3):c.714C>T (p.Ala238=) SNV Likely benign 163836 rs727503125 GRCh37: 10:88451677-88451677
GRCh38: 10:86691920-86691920
304 LDB3 NM_007078.3(LDB3):c.-24+8T>C SNV Likely benign 138106 rs2803558 GRCh37: 10:88428335-88428335
GRCh38: 10:86668578-86668578
305 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4842G>A SNV Likely benign 43875 rs113445294 GRCh37: 10:88446811-88446811
GRCh38: 10:86687054-86687054
306 LDB3 NM_007078.3(LDB3):c.1653C>T (p.Cys551=) SNV Likely benign 45531 rs45581435 GRCh37: 10:88476505-88476505
GRCh38: 10:86716748-86716748
307 LDB3 NM_007078.3(LDB3):c.896+6959C>T SNV Likely benign 301338 rs139415121 GRCh37: 10:88459287-88459287
GRCh38: 10:86699530-86699530
308 LDB3 NM_007078.3(LDB3):c.338C>T (p.Thr113Met) SNV Likely benign 518772 rs563714303 GRCh37: 10:88441209-88441209
GRCh38: 10:86681452-86681452
309 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4757G>A SNV Likely benign 179926 rs374613600 GRCh37: 10:88446896-88446896
GRCh38: 10:86687139-86687139
310 LDB3 NM_007078.3(LDB3):c.1851T>C (p.Ile617=) SNV Likely benign 240719 rs145402041 GRCh37: 10:88477895-88477895
GRCh38: 10:86718138-86718138
311 LDB3 NM_007078.3(LDB3):c.1111G>A (p.Ala371Thr) SNV Likely benign 45511 rs45539535 GRCh37: 10:88469687-88469687
GRCh38: 10:86709930-86709930
312 LDB3 NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) SNV Likely benign 201852 rs143764931 GRCh37: 10:88476446-88476446
GRCh38: 10:86716689-86716689
313 LDB3 NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) SNV Likely benign 235003 rs774886148 GRCh37: 10:88441421-88441421
GRCh38: 10:86681664-86681664
314 LDB3 NM_007078.3(LDB3):c.1911G>A (p.Ala637=) SNV Likely benign 506985 rs150710377 GRCh37: 10:88478537-88478537
GRCh38: 10:86718780-86718780
315 LDB3 NM_007078.3(LDB3):c.398C>T (p.Pro133Leu) SNV Likely benign 201837 rs200239096 GRCh37: 10:88441269-88441269
GRCh38: 10:86681512-86681512
316 LDB3 NM_007078.3(LDB3):c.891G>A (p.Arg297=) SNV Likely benign 516314 rs374336814 GRCh37: 10:88452323-88452323
GRCh38: 10:86692566-86692566
317 LDB3 NM_007078.3(LDB3):c.646A>T (p.Met216Leu) SNV Likely benign 379172 rs765199175 GRCh37: 10:88441517-88441517
GRCh38: 10:86681760-86681760
318 LDB3 NM_007078.3(LDB3):c.1200T>G (p.Thr400=) SNV Likely benign 513818 rs1447980981 GRCh37: 10:88469776-88469776
GRCh38: 10:86710019-86710019
319 LDB3 NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) SNV Benign/Likely benign 36449 rs34423165 GRCh37: 10:88451715-88451715
GRCh38: 10:86691958-86691958
320 LDB3 NM_007078.3(LDB3):c.163G>A (p.Val55Ile) SNV Benign/Likely benign 45530 rs3740343 GRCh37: 10:88439193-88439193
GRCh38: 10:86679436-86679436
321 LDB3 NM_007078.3(LDB3):c.302C>T (p.Pro101Leu) SNV Benign/Likely benign 36447 rs45592139 GRCh37: 10:88439895-88439895
GRCh38: 10:86680138-86680138
322 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4668T>C SNV Benign/Likely benign 43879 rs76615432 GRCh37: 10:88446985-88446985
GRCh38: 10:86687228-86687228
323 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4823G>A SNV Benign 4733 rs121908338 GRCh37: 10:88446830-88446830
GRCh38: 10:86687073-86687073
324 LDB3 NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) SNV Benign 138103 rs587781024 GRCh37: 10:88476187-88476187
GRCh38: 10:86716430-86716430
325 LDB3 NM_007078.3(LDB3):c.1903G>A (p.Val635Ile) SNV Benign 36445 rs45618633 GRCh37: 10:88478529-88478529
GRCh38: 10:86718772-86718772
326 LDB3 NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) SNV Benign 180399 rs200596619 GRCh37: 10:88441337-88441337
GRCh38: 10:86681580-86681580
327 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4782G>A SNV Benign 378080 rs568549202 GRCh37: 10:88446871-88446871
GRCh38: 10:86687114-86687114
328 LDB3 NM_007078.3(LDB3):c.1422G>A (p.Ser474=) SNV Benign 36444 rs142625982 GRCh37: 10:88476274-88476274
GRCh38: 10:86716517-86716517
329 LDB3 NM_007078.3(LDB3):c.1263G>A (p.Gly421=) SNV Benign 45512 rs139834701 GRCh37: 10:88476115-88476115
GRCh38: 10:86716358-86716358
330 LDB3 NM_007078.3(LDB3):c.993G>A (p.Ala331=) SNV Benign 45561 rs140347820 GRCh37: 10:88466384-88466384
GRCh38: 10:86706627-86706627
331 LDB3 NM_007078.3(LDB3):c.465C>T (p.Leu155=) SNV Benign 138100 rs45516997 GRCh37: 10:88441336-88441336
GRCh38: 10:86681579-86681579
332 LDB3 NM_007078.3(LDB3):c.352G>A (p.Val118Met) SNV Benign 45544 rs35507268 GRCh37: 10:88441223-88441223
GRCh38: 10:86681466-86681466
333 LDB3 NM_007078.3(LDB3):c.576G>T (p.Pro192=) SNV Benign 45548 rs45543741 GRCh37: 10:88441447-88441447
GRCh38: 10:86681690-86681690
334 LDB3 NM_007078.3(LDB3):c.2016C>T (p.Cys672=) SNV Benign 45538 rs45578640 GRCh37: 10:88485931-88485931
GRCh38: 10:86726174-86726174
335 LDB3 NM_007078.3(LDB3):c.1014A>G (p.Thr338=) SNV Benign 45509 rs150209221 GRCh37: 10:88466405-88466405
GRCh38: 10:86706648-86706648
336 LDB3 NM_007078.3(LDB3):c.609G>A (p.Ser203=) SNV Benign 45550 rs45531131 GRCh37: 10:88441480-88441480
GRCh38: 10:86681723-86681723
337 LDB3 NM_007078.3(LDB3):c.1506G>A (p.Pro502=) SNV Benign 45526 rs45579241 GRCh37: 10:88476358-88476358
GRCh38: 10:86716601-86716601
338 LDB3 NM_007078.3(LDB3):c.306G>A (p.Val102=) SNV Benign 532936 rs201715521 GRCh37: 10:88439899-88439899
GRCh38: 10:86680142-86680142
339 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4837C>T SNV Benign 414137 rs528725791 GRCh37: 10:88446816-88446816
GRCh38: 10:86687059-86687059
340 LDB3 NM_007078.3(LDB3):c.560C>T (p.Pro187Leu) SNV Benign 464273 rs149218167 GRCh37: 10:88441431-88441431
GRCh38: 10:86681674-86681674
341 LDB3 , LOC110121486 NM_007078.3(LDB3):c.690-4653G>A SNV Benign 464277 rs537783577 GRCh37: 10:88447000-88447000
GRCh38: 10:86687243-86687243
342 LDB3 NM_007078.3(LDB3):c.867C>T (p.Asp289=) SNV Benign 45557 rs397517227 GRCh37: 10:88452299-88452299
GRCh38: 10:86692542-86692542
343 LDB3 NM_007078.3(LDB3):c.1167C>T (p.Ala389=) SNV Benign 227496 rs768844187 GRCh37: 10:88469743-88469743
GRCh38: 10:86709986-86709986
344 LDB3 NM_007078.3(LDB3):c.1041C>A (p.Ser347=) SNV Benign 36442 rs45555240 GRCh37: 10:88466432-88466432
GRCh38: 10:86706675-86706675
345 LDB3 NM_007078.3(LDB3):c.1074C>T (p.Ala358=) SNV Benign 36443 rs45459491 GRCh37: 10:88466465-88466465
GRCh38: 10:86706708-86706708
346 LDB3 NM_007078.3(LDB3):c.273G>A (p.Thr91=) SNV Benign 45542 rs45613039 GRCh37: 10:88439866-88439866
GRCh38: 10:86680109-86680109
347 LDB3 NM_007078.3(LDB3):c.576G>A (p.Pro192=) SNV Benign 45547 rs45543741 GRCh37: 10:88441447-88441447
GRCh38: 10:86681690-86681690
348 LDB3 NM_007078.3(LDB3):c.896+6722G>A SNV Benign 43884 rs144445130 GRCh37: 10:88459050-88459050
GRCh38: 10:86699293-86699293
349 LDB3 NM_007078.3(LDB3):c.1460G>A (p.Arg487His) SNV Benign 45520 rs146265188 GRCh37: 10:88476312-88476312
GRCh38: 10:86716555-86716555
350 LDB3 NM_007078.3(LDB3):c.493C>T (p.Arg165Trp) SNV Benign 177802 rs45610637 GRCh37: 10:88441364-88441364
GRCh38: 10:86681607-86681607
351 LDB3 NM_007078.3(LDB3):c.147G>A (p.Val49=) SNV Benign 45524 rs45591834 GRCh37: 10:88439177-88439177
GRCh38: 10:86679420-86679420
352 LDB3 NM_007078.3(LDB3):c.896+6731C>T SNV Benign 138101 rs372789789 GRCh37: 10:88459059-88459059
GRCh38: 10:86699302-86699302
353 LDB3 NM_007078.3(LDB3):c.732C>T (p.Pro244=) SNV Benign 45554 rs144509718 GRCh37: 10:88451695-88451695
GRCh38: 10:86691938-86691938

Expression for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Search GEO for disease gene expression data for Late-Onset Distal Myopathy, Markesbery-Griggs Type.

Pathways for Late-Onset Distal Myopathy, Markesbery-Griggs Type

GO Terms for Late-Onset Distal Myopathy, Markesbery-Griggs Type

Sources for Late-Onset Distal Myopathy, Markesbery-Griggs Type

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
20 GARD
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
53 NINDS
54 Novoseek
56 OMIM via Orphanet
57 OMIM® (Updated 05-Apr-2021)
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 Tocris
70 UMLS
71 UMLS via Orphanet
Content
Loading form....