Home
User Guide
What's in a MalaCard Search Guide Our Sources
Analysis Tools
GeneCards GeneAnalytics GeneAlaCart PathCards VarElect TGex
News and Views Disease Lists/Categories
About
About MalaCards Our Publications Weizmann Institute LifeMap Discovery® Terms of Use MalaCards Team
LCA6
MCID: LBR016
MIFTS: 31

Leber Congenital Amaurosis 6 (LCA6)

Categories: Eye diseases, Genetic diseases, Metabolic diseases, Neuronal diseases, Rare diseases
Genes Variations Tissues Related diseases Publications Pathways Symptoms & Phenotypes
Sources

Aliases & Classifications for Leber Congenital Amaurosis 6

About this section

MalaCards integrated aliases for Leber Congenital Amaurosis 6:

Name: Leber Congenital Amaurosis 6 58 12 54 76 30 13 6 15 74
Lca6 58 12 54 76
Leber Congenital Amaurosis, Type 6 41
Leber Congenital Amaurosis Type 6 54

Characteristics:

HPO:

33
leber congenital amaurosis 6:
Inheritance autosomal recessive inheritance


Classifications:

MalaCards categories:
Global: Genetic diseases Rare diseases Metabolic diseases
Anatomical: Eye diseases Neuronal diseases
See all MalaCards categories (disease lists)
ICD10: 34


External Ids:

Disease Ontology 12 DOID:0110329
OMIM 58 613826
MeSH 45 D057130
ICD10 34 H35.5
MedGen 43 C1854260
UMLS 74 C1854260
Sources

Summaries for Leber Congenital Amaurosis 6

About this section
OMIM : 58 Leber congenital amaurosis comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Electroretinogram (ERG) responses are usually nonrecordable. Other clinical findings may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus (summary by Chung and Traboulsi, 2009). For a general description and a discussion of genetic heterogeneity of LCA, see 204000. (613826)

MalaCards based summary : Leber Congenital Amaurosis 6, also known as lca6, is related to cone-rod dystrophy 13 and photokeratitis. An important gene associated with Leber Congenital Amaurosis 6 is RPGRIP1 (RPGR Interacting Protein 1), and among its related pathways/superpathways are Spinal Cord Injury and Amphetamine addiction. Affiliated tissues include retina and eye, and related phenotypes are cataract and photophobia

Disease Ontology : 12 A Leber congenital amaurosis that is characterized by early photophobia, hypermetropia less than +7 diopters, and visual acuity in the range of 20/400 to count fingers and has material basis in mutation in the RPGRIP1 gene on chromosome 14q11.

UniProtKB/Swiss-Prot : 76 Leber congenital amaurosis 6: A severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.

Sources

Related Diseases for Leber Congenital Amaurosis 6

About this section

Diseases in the Leber Congenital Amaurosis family:

Leber Congenital Amaurosis 1 Leber Congenital Amaurosis 2
Leber Congenital Amaurosis 3 Leber Congenital Amaurosis 4
Leber Congenital Amaurosis 5 Leber Congenital Amaurosis 9
Leber Congenital Amaurosis 12 Leber Congenital Amaurosis 10
Leber Congenital Amaurosis 13 Leber Congenital Amaurosis 14
Leber Congenital Amaurosis 6 Leber Congenital Amaurosis 7
Leber Congenital Amaurosis 8 Leber Congenital Amaurosis 11
Leber Congenital Amaurosis 15 Leber Congenital Amaurosis 16
Leber Congenital Amaurosis 17

Diseases related to Leber Congenital Amaurosis 6 via text searches within MalaCards or GeneCards Suite gene sharing:

# Related Disease Score Top Affiliating Genes
1 cone-rod dystrophy 13 10.0 RPGRIP1 SUPT16H
2 photokeratitis 9.7 FOS MIF
3 leber congenital amaurosis 9.6 CLTB RPGRIP1 SUPT16H

Sources

Symptoms & Phenotypes for Leber Congenital Amaurosis 6

About this section

Human phenotypes related to Leber Congenital Amaurosis 6:

33 (show all 8)
# Description HPO Frequency HPO Source Accession
1 cataract 33 HP:0000518
2 photophobia 33 HP:0000613
3 keratoconus 33 HP:0000563
4 severely reduced visual acuity 33 HP:0001141
5 attenuation of retinal blood vessels 33 HP:0007843
6 pendular nystagmus 33 HP:0012043
7 high hypermetropia 33 HP:0008499
8 undetectable electroretinogram 33 HP:0000550

Clinical features from OMIM:

613826
Sources

Drugs & Therapeutics for Leber Congenital Amaurosis 6

About this section

Search Clinical Trials , NIH Clinical Center for Leber Congenital Amaurosis 6

Sources

Genetic Tests for Leber Congenital Amaurosis 6

About this section

Genetic tests related to Leber Congenital Amaurosis 6:

# Genetic test Affiliating Genes
1 Leber Congenital Amaurosis 6 30 RPGRIP1
Sources

Anatomical Context for Leber Congenital Amaurosis 6

About this section

MalaCards organs/tissues related to Leber Congenital Amaurosis 6:

42
Retina, Eye
Sources

Publications for Leber Congenital Amaurosis 6

About this section

Articles related to Leber Congenital Amaurosis 6:

# Title Authors Year
1
Genetic analysis of strictly defined Leber congenital amaurosis with (and without) neurodevelopmental delay. ( 24997176 )
2014
2
Identification of a novel LCA6 mutation in an Emirati family. ( 23278760 )
2013
3
Clinical utility gene card for: Meckel syndrome. ( 21368913 )
2011
4
Limited proteolysis differentially modulates the stability and subcellular localization of domains of RPGRIP1 that are distinctly affected by mutations in Leber's congenital amaurosis. ( 15800011 )
2005
5
Null RPGRIP1 alleles in patients with Leber congenital amaurosis. ( 11283794 )
2001
6
Complete exon-intron structure of the RPGR-interacting protein (RPGRIP1) gene allows the identification of mutations underlying Leber congenital amaurosis. ( 11528500 )
2001
Sources

Variations for Leber Congenital Amaurosis 6

About this section

UniProtKB/Swiss-Prot genetic disease variations for Leber Congenital Amaurosis 6:

76
# Symbol AA change Variation ID SNP ID
1 RPGRIP1 p.Gly746Glu VAR_017833 rs61751268
2 RPGRIP1 p.Asp1114Gly VAR_017836 rs17103671
3 RPGRIP1 p.His631Pro VAR_067186
4 RPGRIP1 p.Val1211Glu VAR_076823

ClinVar genetic disease variations for Leber Congenital Amaurosis 6:

6 (show top 50) (show all 62)
# Gene Variation Type Significance SNP ID Assembly Location
1 RPGRIP1 RPGRIP1, 1-BP DEL, LYS342 deletion Pathogenic
2 RPGRIP1 RPGRIP1, 1-BP DEL, ASP1176 deletion Pathogenic
3 RPGRIP1 NM_020366.3(RPGRIP1): c.194G> A (p.Trp65Ter) single nucleotide variant Pathogenic rs137853124 GRCh37 Chromosome 14, 21762944: 21762944
4 RPGRIP1 NM_020366.3(RPGRIP1): c.194G> A (p.Trp65Ter) single nucleotide variant Pathogenic rs137853124 GRCh38 Chromosome 14, 21294785: 21294785
5 RPGRIP1 RPGRIP1, 1-BP INS, GLN893 insertion Pathogenic
6 RPGRIP1 NM_020366.3(RPGRIP1): c.3341A> G (p.Asp1114Gly) single nucleotide variant Conflicting interpretations of pathogenicity rs17103671 GRCh37 Chromosome 14, 21811196: 21811196
7 RPGRIP1 NM_020366.3(RPGRIP1): c.3341A> G (p.Asp1114Gly) single nucleotide variant Conflicting interpretations of pathogenicity rs17103671 GRCh38 Chromosome 14, 21343037: 21343037
8 RPGRIP1 RPGRIP1, 3-BP DEL, 3835GAG deletion Pathogenic
9 MKS1 NM_017777.3(MKS1): c.958G> A (p.Val320Ile) single nucleotide variant Conflicting interpretations of pathogenicity rs386834053 GRCh37 Chromosome 17, 56288341: 56288341
10 MKS1 NM_017777.3(MKS1): c.958G> A (p.Val320Ile) single nucleotide variant Conflicting interpretations of pathogenicity rs386834053 GRCh38 Chromosome 17, 58210980: 58210980
11 RPGRIP1 NM_020366.3(RPGRIP1): c.1103delA (p.Glu370Asnfs) deletion Pathogenic rs61751266 GRCh37 Chromosome 14, 21780617: 21780617
12 RPGRIP1 NM_020366.3(RPGRIP1): c.1103delA (p.Glu370Asnfs) deletion Pathogenic rs61751266 GRCh38 Chromosome 14, 21312458: 21312458
13 RPGRIP1 NM_020366.3(RPGRIP1): c.256C> T (p.Arg86Trp) single nucleotide variant Benign rs62646879 GRCh37 Chromosome 14, 21769162: 21769162
14 RPGRIP1 NM_020366.3(RPGRIP1): c.256C> T (p.Arg86Trp) single nucleotide variant Benign rs62646879 GRCh38 Chromosome 14, 21301003: 21301003
15 RPGRIP1 NM_020366.3(RPGRIP1): c.3546C> T (p.Asp1182=) single nucleotide variant Conflicting interpretations of pathogenicity rs34116882 GRCh37 Chromosome 14, 21813285: 21813285
16 RPGRIP1 NM_020366.3(RPGRIP1): c.3546C> T (p.Asp1182=) single nucleotide variant Conflicting interpretations of pathogenicity rs34116882 GRCh38 Chromosome 14, 21345126: 21345126
17 RPGRIP1 NM_020366.3(RPGRIP1): c.1892A> T (p.His631Leu) single nucleotide variant Pathogenic rs535922252 GRCh38 Chromosome 14, 21324747: 21324747
18 RPGRIP1 NM_020366.3(RPGRIP1): c.1892A> T (p.His631Leu) single nucleotide variant Pathogenic rs535922252 GRCh37 Chromosome 14, 21792906: 21792906
19 RPGRIP1 NM_020366.3(RPGRIP1): c.3565_3571delCGAAGGC (p.Arg1189Glyfs) deletion Pathogenic rs587783012 GRCh37 Chromosome 14, 21813304: 21813310
20 RPGRIP1 NM_020366.3(RPGRIP1): c.3565_3571delCGAAGGC (p.Arg1189Glyfs) deletion Pathogenic rs587783012 GRCh38 Chromosome 14, 21345145: 21345151
21 RPGRIP1 NM_020366.3(RPGRIP1): c.832C> T (p.Arg278Ter) single nucleotide variant Pathogenic rs587783018 GRCh37 Chromosome 14, 21775921: 21775921
22 RPGRIP1 NM_020366.3(RPGRIP1): c.832C> T (p.Arg278Ter) single nucleotide variant Pathogenic rs587783018 GRCh38 Chromosome 14, 21307762: 21307762
23 RPGRIP1 NM_020366.3(RPGRIP1): c.2356C> T (p.Gln786Ter) single nucleotide variant Pathogenic rs587783019 GRCh38 Chromosome 14, 21325372: 21325372
24 RPGRIP1 NM_020366.3(RPGRIP1): c.2356C> T (p.Gln786Ter) single nucleotide variant Pathogenic rs587783019 GRCh37 Chromosome 14, 21793531: 21793531
25 RPGRIP1 NM_020366.3(RPGRIP1): c.95T> A (p.Met32Lys) single nucleotide variant Uncertain significance rs200510462 GRCh37 Chromosome 14, 21762845: 21762845
26 RPGRIP1 NM_020366.3(RPGRIP1): c.95T> A (p.Met32Lys) single nucleotide variant Uncertain significance rs200510462 GRCh38 Chromosome 14, 21294686: 21294686
27 RPGRIP1 NM_020366.3(RPGRIP1): c.900_906+14delTCAAGAGGTGAGTTGCCATCA deletion Likely pathogenic rs886039911 GRCh38 Chromosome 14, 21307830: 21307850
28 RPGRIP1 NM_020366.3(RPGRIP1): c.900_906+14delTCAAGAGGTGAGTTGCCATCA deletion Likely pathogenic rs886039911 GRCh37 Chromosome 14, 21775989: 21776009
29 RPGRIP1 NM_020366.3(RPGRIP1): c.1753C> T (p.Pro585Ser) single nucleotide variant Uncertain significance rs147586703 GRCh37 Chromosome 14, 21790154: 21790154
30 RPGRIP1 NM_020366.3(RPGRIP1): c.1753C> T (p.Pro585Ser) single nucleotide variant Uncertain significance rs147586703 GRCh38 Chromosome 14, 21321995: 21321995
31 RPGRIP1 NM_020366.3(RPGRIP1): c.2284C> T (p.Leu762=) single nucleotide variant Conflicting interpretations of pathogenicity rs145896974 GRCh37 Chromosome 14, 21793459: 21793459
32 RPGRIP1 NM_020366.3(RPGRIP1): c.2284C> T (p.Leu762=) single nucleotide variant Conflicting interpretations of pathogenicity rs145896974 GRCh38 Chromosome 14, 21325300: 21325300
33 RPGRIP1 NM_020366.3(RPGRIP1): c.3719G> A (p.Gly1240Glu) single nucleotide variant Benign/Likely benign rs34725281 GRCh38 Chromosome 14, 21348273: 21348273
34 RPGRIP1 NM_020366.3(RPGRIP1): c.3719G> A (p.Gly1240Glu) single nucleotide variant Benign/Likely benign rs34725281 GRCh37 Chromosome 14, 21816432: 21816432
35 RPGRIP1 NM_020366.3(RPGRIP1): c.2292G> A (p.Ala764=) single nucleotide variant Benign rs35207255 GRCh37 Chromosome 14, 21793467: 21793467
36 RPGRIP1 NM_020366.3(RPGRIP1): c.2292G> A (p.Ala764=) single nucleotide variant Benign rs35207255 GRCh38 Chromosome 14, 21325308: 21325308
37 RPGRIP1 NM_020366.3(RPGRIP1): c.3467_3468insCT (p.Glu1157Terfs) insertion Pathogenic rs776698746 GRCh38 Chromosome 14, 21343163: 21343164
38 RPGRIP1 NM_020366.3(RPGRIP1): c.3467_3468insCT (p.Glu1157Terfs) insertion Pathogenic rs776698746 GRCh37 Chromosome 14, 21811322: 21811323
39 RPGRIP1 NM_020366.3(RPGRIP1): c.2878G> C (p.Ala960Pro) single nucleotide variant Benign rs35810926 GRCh37 Chromosome 14, 21795949: 21795949
40 RPGRIP1 NM_020366.3(RPGRIP1): c.2878G> C (p.Ala960Pro) single nucleotide variant Benign rs35810926 GRCh38 Chromosome 14, 21327790: 21327790
41 RPGRIP1 NM_020366.3(RPGRIP1): c.3766C> G (p.Leu1256Val) single nucleotide variant Uncertain significance rs1405508889 GRCh37 Chromosome 14, 21819280: 21819280
42 RPGRIP1 NM_020366.3(RPGRIP1): c.3766C> G (p.Leu1256Val) single nucleotide variant Uncertain significance rs1405508889 GRCh38 Chromosome 14, 21351121: 21351121
43 RPGRIP1 NM_020366.3(RPGRIP1): c.799C> T (p.Arg267Ter) single nucleotide variant Pathogenic GRCh38 Chromosome 14, 21303542: 21303542
44 RPGRIP1 NM_020366.3(RPGRIP1): c.799C> T (p.Arg267Ter) single nucleotide variant Pathogenic GRCh37 Chromosome 14, 21771701: 21771701
45 RPGRIP1 NM_020366.3(RPGRIP1): c.2718dup (p.Asn907Terfs) duplication Pathogenic GRCh38 Chromosome 14, 21327630: 21327630
46 RPGRIP1 NM_020366.3(RPGRIP1): c.2718dup (p.Asn907Terfs) duplication Pathogenic GRCh37 Chromosome 14, 21795789: 21795789
47 RPGRIP1 NM_020366.3(RPGRIP1): c.2017C> T (p.Gln673Ter) single nucleotide variant Pathogenic GRCh37 Chromosome 14, 21793031: 21793031
48 RPGRIP1 NM_020366.3(RPGRIP1): c.2017C> T (p.Gln673Ter) single nucleotide variant Pathogenic GRCh38 Chromosome 14, 21324872: 21324872
49 RPGRIP1 NM_020366.3(RPGRIP1): c.938G> A (p.Gly313Glu) single nucleotide variant Uncertain significance GRCh37 Chromosome 14, 21779990: 21779990
50 RPGRIP1 NM_020366.3(RPGRIP1): c.938G> A (p.Gly313Glu) single nucleotide variant Uncertain significance GRCh38 Chromosome 14, 21311831: 21311831
Sources

Expression for Leber Congenital Amaurosis 6

About this section
Search GEO for disease gene expression data for Leber Congenital Amaurosis 6.
Sources

Pathways for Leber Congenital Amaurosis 6

About this section

Pathways related to Leber Congenital Amaurosis 6 according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1
Spinal Cord Injury 1
11.4 FOS MIF
2
Amphetamine addiction 38
Show member pathways
 11.32 FOS TH
3
Photodynamic therapy-induced NF-kB survival signaling 1
Show member pathways
 10.96 FOS MIF
4
ATF-2 transcription factor network 1
10.7 FOS TH
5
MIF Action Through Endocytic Pathway 65
9.7 FOS MIF
Sources

GO Terms for Leber Congenital Amaurosis 6

About this section

Biological processes related to Leber Congenital Amaurosis 6 according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 response to nutrient levels GO:0031667 9.32 MAP1LC3A TH
2 response to light stimulus GO:0009416 9.26 FOS TH
3 response to immobilization stress GO:0035902 9.16 FOS TH
4 response to corticosterone GO:0051412 8.96 FOS TH
5 eye photoreceptor cell development GO:0042462 8.62 RPGRIP1 TH

Molecular functions related to Leber Congenital Amaurosis 6 according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 protein binding GO:0005515 9.23 CLTB DNAL1 FOS MAP1LC3A MIF RPGRIP1
Sources

Sources for Leber Congenital Amaurosis 6

About this section
3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
20 FMA
29 GO
30 GTR
31 HGMD
32 HMDB
33 HPO
34 ICD10
35 ICD10 via Orphanet
36 ICD9CM
37 IUPHAR
38 KEGG
39 LifeMap
41 LOVD
43 MedGen
45 MeSH
46 MESH via Orphanet
47 MGI
50 NCI
51 NCIt
52 NDF-RT
55 NINDS
56 Novoseek
58 OMIM
59 OMIM via Orphanet
63 PubMed
65 QIAGEN
70 SNOMED-CT via HPO
71 SNOMED-CT via Orphanet
72 TGDB
73 Tocris
74 UMLS
75 UMLS via Orphanet
The MalaCards human disease database index: 1-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Content
Loading form....