CMM2
MCID: MLN067
MIFTS: 29

Melanoma, Cutaneous Malignant 2 (CMM2)

Categories: Cancer diseases, Genetic diseases, Nephrological diseases, Rare diseases, Skin diseases

Aliases & Classifications for Melanoma, Cutaneous Malignant 2

MalaCards integrated aliases for Melanoma, Cutaneous Malignant 2:

Name: Melanoma, Cutaneous Malignant 2 57 74
Cutaneous Malignant Melanoma 2 74 29 6
Melanoma, Cutaneous Malignant, 2 57 13
Cmm2 57 74
Melanoma, Cutaneous, Malignant, Susceptibility to, Type 2 40
Melanoma, Cutaneous Malignant, Susceptibility to, 2 57

Characteristics:

OMIM:

57
Inheritance:
autosomal dominant


HPO:

32
melanoma, cutaneous malignant 2:
Inheritance autosomal dominant inheritance


Classifications:



External Ids:

MeSH 44 D008545
MedGen 42 C1835044

Summaries for Melanoma, Cutaneous Malignant 2

OMIM : 57 Malignant melanoma is a neoplasm of pigment-producing cells called melanocytes that occurs most often in the skin, but may also occur in the eyes, ears, gastrointestinal tract, leptomeninges, and oral and genital mucous membranes (summary by Habif, 2010). For a discussion of genetic heterogeneity of cutaneous malignant melanoma, see CMM1 (155600). (155601)

MalaCards based summary : Melanoma, Cutaneous Malignant 2, also known as cutaneous malignant melanoma 2, is related to lentigines and nodular malignant melanoma. An important gene associated with Melanoma, Cutaneous Malignant 2 is CDKN2A (Cyclin Dependent Kinase Inhibitor 2A). Affiliated tissues include skin, eye and prostate, and related phenotype is cutaneous melanoma.

UniProtKB/Swiss-Prot : 74 Melanoma, cutaneous malignant 2: A malignant neoplasm of melanocytes, arising de novo or from a pre- existing benign nevus, which occurs most often in the skin but also may involve other sites.

Related Diseases for Melanoma, Cutaneous Malignant 2

Diseases in the Melanoma, Cutaneous Malignant 1 family:

Melanoma, Cutaneous Malignant 2 Melanoma, Cutaneous Malignant 4
Melanoma, Cutaneous Malignant 3 Melanoma, Cutaneous Malignant 7
Melanoma, Cutaneous Malignant 5 Melanoma, Cutaneous Malignant 6
Melanoma, Cutaneous Malignant 8 Melanoma, Cutaneous Malignant 9
Melanoma, Cutaneous Malignant 10

Diseases related to Melanoma, Cutaneous Malignant 2 via text searches within MalaCards or GeneCards Suite gene sharing:

# Related Disease Score Top Affiliating Genes
1 lentigines 9.9
2 nodular malignant melanoma 9.9
3 acral lentiginous melanoma 9.9
4 lentigo maligna melanoma 9.9
5 superficial spreading melanoma 9.9

Graphical network of the top 20 diseases related to Melanoma, Cutaneous Malignant 2:



Diseases related to Melanoma, Cutaneous Malignant 2

Symptoms & Phenotypes for Melanoma, Cutaneous Malignant 2

Human phenotypes related to Melanoma, Cutaneous Malignant 2:

32
# Description HPO Frequency HPO Source Accession
1 cutaneous melanoma 32 HP:0012056

Symptoms via clinical synopsis from OMIM:

57
Neoplasia:
malignant melanoma

Laboratory Abnormalities:
frequent deletions of chromosome 9 in melanoma

Clinical features from OMIM:

155601

Drugs & Therapeutics for Melanoma, Cutaneous Malignant 2

Search Clinical Trials , NIH Clinical Center for Melanoma, Cutaneous Malignant 2

Genetic Tests for Melanoma, Cutaneous Malignant 2

Genetic tests related to Melanoma, Cutaneous Malignant 2:

# Genetic test Affiliating Genes
1 Cutaneous Malignant Melanoma 2 29 CDKN2A

Anatomical Context for Melanoma, Cutaneous Malignant 2

MalaCards organs/tissues related to Melanoma, Cutaneous Malignant 2:

41
Skin, Eye, Prostate

Publications for Melanoma, Cutaneous Malignant 2

Articles related to Melanoma, Cutaneous Malignant 2:

(show top 50) (show all 72)
# Title Authors PMID Year
1
Novel and recurrent p14 mutations in Italian familial melanoma. 8 71
20132244 2010
2
New founder germline mutations of CDKN2A in melanoma-prone families and multiple primary melanoma development in a patient receiving levodopa treatment. 8 71
17492760 2007
3
A cell cycle regulator potentially involved in genesis of many tumor types. 8 71
8153634 1994
4
American Society of Clinical Oncology Expert Statement: collection and use of a cancer family history for oncology providers. 71
24493721 2014
5
Indication for CDKN2A-mutation analysis in familial pancreatic cancer families without melanomas. 71
22636603 2012
6
Melanoma risk for CDKN2A mutation carriers who are relatives of population-based case carriers in Australia and the UK. 8
21325014 2011
7
Predicting functional significance of cancer-associated p16(INK4a) mutations in CDKN2A. 71
20340136 2010
8
Genome-wide association study identifies three loci associated with melanoma risk. 8
19578364 2009
9
Genome-wide association study identifies variants at 9p21 and 22q13 associated with development of cutaneous nevi. 8
19578365 2009
10
New common variants affecting susceptibility to basal cell carcinoma. 71
19578363 2009
11
SLC45A2: a novel malignant melanoma-associated gene. 71
18563784 2008
12
Variants of the MATP/SLC45A2 gene are protective for melanoma in the French population. 71
18683857 2008
13
CDKN2A mutations and melanoma risk in the Icelandic population. 71
18178632 2008
14
A genomewide association study of skin pigmentation in a South Asian population. 71
17999355 2007
15
Distribution of the F374 allele of the SLC45A2 (MATP) gene and founder-haplotype analysis. 71
17044855 2006
16
Melanoma. 8
16822996 2006
17
Familial melanoma, pancreatic cancer and germline CDKN2A mutations. 71
15146471 2004
18
A single Mediterranean, possibly Jewish, origin for the Val59Gly CDKN2A mutation in four melanoma-prone families. 71
12700603 2003
19
Hereditary p16-Leiden mutation in a patient with multiple head and neck tumors. 71
12549483 2003
20
Germline mutation of ARF in a melanoma kindred. 71
12019208 2002
21
High prevalence of the G101W germline mutation in the CDKN2A (P16(ink4a)) gene in 62 Italian malignant melanoma families. 71
11807902 2002
22
Sporadic multiple primary melanoma cases: CDKN2A germline mutations with a founder effect. 71
11579459 2001
23
A deep intronic mutation in CDKN2A is associated with disease in a subset of melanoma pedigrees. 71
11726555 2001
24
A common founder for the V126D CDKN2A mutation in seven North American melanoma-prone families. 71
11506491 2001
25
Haplotype analysis and age estimation of the 113insR CDKN2A founder mutation in Swedish melanoma families. 71
11319798 2001
26
Risk of developing pancreatic cancer in families with familial atypical multiple mole melanoma associated with a specific 19 deletion of p16 (p16-Leiden). 71
10956390 2000
27
A single genetic origin for the G101W CDKN2A mutation in 20 melanoma-prone families. 71
10869234 2000
28
CDKN2A mutations in Spanish cutaneous malignant melanoma families and patients with multiple melanomas and other neoplasia. 71
10874641 1999
29
A locus linked to p16 modifies melanoma risk in Dutch familial atypical multiple mole melanoma (FAMMM) syndrome families. 71
10400925 1999
30
Mutation of the CDKN2A 5' UTR creates an aberrant initiation codon and predisposes to melanoma. 71
9916806 1999
31
CDKN2A germline mutations in U.K. patients with familial melanoma and multiple primary melanomas. 71
9699728 1998
32
CDKN2A mutations in multiple primary melanomas. 71
9516223 1998
33
Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France. The French Familial Melanoma Study Group. 71
9425228 1998
34
Haplotype analysis of two recurrent CDKN2A mutations in 10 melanoma families: evidence for common founders and independent mutations. 71
9603434 1998
35
Analysis of the CDKN2A, CDKN2B and CDK4 genes in 48 Australian melanoma kindreds. 71
9416844 1997
36
Germline mutations of the CDKN2 gene in UK melanoma families. 71
9328469 1997
37
Novel germline p16 mutation in familial malignant melanoma in southern Sweden. 71
8653684 1996
38
Two-locus linkage analysis of cutaneous malignant melanoma/dysplastic nevi. 8
8651266 1996
39
The current situation with regard to human melanoma and genetic inferences. 71
8727306 1996
40
Familial melanoma and pancreatic cancer. Ligurian Skin Tumor Study Group. 71
8552158 1996
41
Analysis of the p16 gene, CDKN2, in 17 Australian melanoma kindreds. 71
8570179 1995
42
Mutations of the CDKN2/p16INK4 gene in Australian melanoma kindreds. 71
8595405 1995
43
Brief report: a familial syndrome of pancreatic cancer and melanoma with a mutation in the CDKN2 tumor-suppressor gene. 71
7666917 1995
44
Chromosome 9p deletions in cutaneous malignant melanoma tumors: the minimal deleted region involves markers outside the p16 (CDKN2) gene. 8
7668266 1995
45
Homozygotes for CDKN2 (p16) germline mutation in Dutch familial melanoma kindreds. 71
7670475 1995
46
Mutational analysis of CDKN2 (CDK4I/MTS1) gene in tissues and cell lines of human prostate cancer. 71
7559077 1995
47
Germline p16INK4A mutation and protein dysfunction in a family with inherited melanoma. 71
7624155 1995
48
Genetic heterogeneity in familial malignant melanoma. 71
7881419 1994
49
Genetics of seven Dutch familial atypical multiple mole-melanoma syndrome families: a review of linkage results including chromosomes 1 and 9. 8
7963673 1994
50
Localization of the 9p melanoma susceptibility locus (MLM) to a 2-cM region between D9S736 and D9S171. 8
7829086 1994

Variations for Melanoma, Cutaneous Malignant 2

ClinVar genetic disease variations for Melanoma, Cutaneous Malignant 2:

6 (show all 36)
# Gene Variation Type Significance SNP ID GRCh37 Pos GRCh38 Pos
1 CDKN2A NM_000077.4(CDKN2A): c.238C> T (p.Arg80Ter) single nucleotide variant Likely pathogenic,risk factor rs121913388 9:21971120-21971120 9:21971121-21971121
2 CDKN2A NM_000077.4(CDKN2A): c.226_244del (p.Ala76fs) deletion Pathogenic,risk factor rs587776716 9:21971114-21971132 9:21971115-21971133
3 CDKN2A NM_000077.4(CDKN2A): c.159G> C (p.Met53Ile) single nucleotide variant Pathogenic rs104894095 9:21971199-21971199 9:21971200-21971200
4 CDKN2A NM_000077.4(CDKN2A): c.377T> A (p.Val126Asp) single nucleotide variant Pathogenic rs104894098 9:21970981-21970981 9:21970982-21970982
5 CDKN2A NM_000077.4(CDKN2A): c.339_340delGCinsCT (p.Pro114Ser) indel Pathogenic rs387906410 9:21971018-21971019 9:21971019-21971020
6 CDKN2A NM_000077.4(CDKN2A): c.-34G> T single nucleotide variant Pathogenic rs1800586 9:21974860-21974860 9:21974861-21974861
7 CDKN2A NM_000077.4(CDKN2A): c.260G> C (p.Arg87Pro) single nucleotide variant Pathogenic rs878853647 9:21971098-21971098 9:21971099-21971099
8 CDKN2A NM_000077.4(CDKN2A): c.176T> G (p.Val59Gly) single nucleotide variant Pathogenic/Likely pathogenic rs104894099 9:21971182-21971182 9:21971183-21971183
9 CDKN2A NM_000077.4(CDKN2A): c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) short repeat Pathogenic/Likely pathogenic rs587780668 9:21974795-21974818 9:21974796-21974819
10 CDKN2A NM_000077.4(CDKN2A): c.167G> T (p.Ser56Ile) single nucleotide variant Pathogenic/Likely pathogenic rs104894109 9:21971191-21971191 9:21971192-21971192
11 CDKN2A NM_000077.4(CDKN2A): c.71G> C (p.Arg24Pro) single nucleotide variant Pathogenic/Likely pathogenic rs104894097 9:21974756-21974756 9:21974757-21974757
12 CDKN2A CDKN2A, -34G-T single nucleotide variant risk factor
13 CDKN2A NM_000077.4(CDKN2A): c.265G> A (p.Gly89Ser) single nucleotide variant risk factor rs137854597 9:21971093-21971093 9:21971094-21971094
14 CDKN2A NM_058195.3(CDKN2A): c.184_186AGA[3] (p.Arg63dup) short repeat risk factor 9:21994142-21994144 9:21994143-21994145
15 CDKN2A CDKN2A, IVS2, A-G, -105 single nucleotide variant risk factor
16 CDKN2A NM_000077.4(CDKN2A): c.364G> C (p.Gly122Arg) single nucleotide variant risk factor rs113798404 9:21970994-21970994 9:21970995-21970995
17 CDKN2A CDKN2A, 6-BP DEL, NT363 deletion risk factor
18 CDKN2A CDKN2A, IVS1BDS, A-G, +1 single nucleotide variant risk factor
19 CDKN2A CDKN2A, ARG54HIS single nucleotide variant risk factor
20 CDKN2A NM_000077.4(CDKN2A): c.150+37G> C single nucleotide variant Conflicting interpretations of pathogenicity rs45456595 9:21974640-21974640 9:21974641-21974641
21 CDKN2A NM_000077.4(CDKN2A): c.369T> A (p.His123Gln) single nucleotide variant Conflicting interpretations of pathogenicity rs6413463 9:21970989-21970989 9:21970990-21970990
22 CDKN2A NM_000077.4(CDKN2A): c.301G> T (p.Gly101Trp) single nucleotide variant Conflicting interpretations of pathogenicity rs104894094 9:21971057-21971057 9:21971058-21971058
23 CDKN2A NM_000077.4(CDKN2A): c.-34G> A single nucleotide variant Conflicting interpretations of pathogenicity rs1800586 9:21974860-21974860 9:21974861-21974861
24 CDKN2A NM_000077.4(CDKN2A): c.266G> A (p.Gly89Asp) single nucleotide variant Conflicting interpretations of pathogenicity rs137854599 9:21971092-21971092 9:21971093-21971093
25 CDKN2A NM_000077.4(CDKN2A): c.315C> A (p.Asp105Glu) single nucleotide variant Uncertain significance rs763269347 9:21971043-21971043 9:21971044-21971044
26 CDKN2A NM_000077.4(CDKN2A): c.294C> T (p.His98=) single nucleotide variant Uncertain significance rs752685118 9:21971064-21971064 9:21971065-21971065
27 CDKN2A NM_000077.4(CDKN2A): c.170C> A (p.Ala57Asp) single nucleotide variant Uncertain significance rs372266620 9:21971188-21971188 9:21971189-21971189
28 CDKN2A NM_058195.3(CDKN2A): c.160C> A (p.Arg54Ser) single nucleotide variant Uncertain significance rs896054565 9:21994171-21994171 9:21994172-21994172
29 CDKN2A NM_000077.4(CDKN2A): c.122C> A (p.Pro41Gln) single nucleotide variant Uncertain significance rs373407950 9:21974705-21974705 9:21974706-21974706
30 CDKN2A NM_000077.4(CDKN2A): c.365G> T (p.Gly122Val) single nucleotide variant Uncertain significance rs373291490 9:21970993-21970993 9:21970994-21970994
31 CDKN2A NM_000077.4(CDKN2A): c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) short repeat Uncertain significance rs587780668 9:21974795-21974818 9:21974796-21974819
32 CDKN2A NM_000077.4(CDKN2A): c.150+82A> G single nucleotide variant Uncertain significance 9:21974595-21974595 9:21974596-21974596
33 CDKN2A NM_000077.4(CDKN2A): c.148C> A (p.Gln50Lys) single nucleotide variant Uncertain significance 9:21974679-21974679 9:21974680-21974680
34 CDKN2A NM_000077.4(CDKN2A): c.32C> T (p.Pro11Leu) single nucleotide variant Uncertain significance 9:21974795-21974795 9:21974796-21974796
35 CDKN2A NM_000077.4(CDKN2A): c.160A> C (p.Met54Leu) single nucleotide variant Uncertain significance rs201314211 9:21971198-21971198 9:21971199-21971199
36 CDKN2A NM_058195.3(CDKN2A): c.35G> A (p.Arg12Gln) single nucleotide variant Uncertain significance 9:21994296-21994296 9:21994297-21994297

UniProtKB/Swiss-Prot genetic disease variations for Melanoma, Cutaneous Malignant 2:

74 (show all 35)
# Symbol AA change Variation ID SNP ID
1 CDKN2A p.Arg24Cys VAR_001413
2 CDKN2A p.Arg24Pro VAR_001414 rs104894097
3 CDKN2A p.Leu32Pro VAR_001416 rs878853650
4 CDKN2A p.Gly35Ala VAR_001418 rs746834149
5 CDKN2A p.Gly35Glu VAR_001419 rs746834149
6 CDKN2A p.Pro48Leu VAR_001420
7 CDKN2A p.Gln50Arg VAR_001423 rs587778189
8 CDKN2A p.Met53Ile VAR_001424 rs104894095
9 CDKN2A p.Val59Gly VAR_001427 rs104894099
10 CDKN2A p.Leu62Pro VAR_001430
11 CDKN2A p.Ala68Leu VAR_001432 rs876658534
12 CDKN2A p.Asn71Lys VAR_001437
13 CDKN2A p.Asp84Tyr VAR_001449 rs11552822
14 CDKN2A p.Arg87Pro VAR_001451 rs878853647
15 CDKN2A p.Gly89Asp VAR_001453 rs137854599
16 CDKN2A p.Gly89Ser VAR_001454 rs137854597
17 CDKN2A p.Leu97Arg VAR_001457
18 CDKN2A p.His98Pro VAR_001458
19 CDKN2A p.His98Gln VAR_001459
20 CDKN2A p.Arg99Pro VAR_001460
21 CDKN2A p.Ala100Leu VAR_001462
22 CDKN2A p.Gly101Trp VAR_001464 rs104894094
23 CDKN2A p.Arg107Cys VAR_001466
24 CDKN2A p.Leu117Met VAR_001471
25 CDKN2A p.Ala118Thr VAR_001472 rs155465396
26 CDKN2A p.Val126Asp VAR_001479 rs104894098
27 CDKN2A p.Arg87Trp VAR_012317 rs749714198
28 CDKN2A p.Leu94Gln VAR_023604
29 CDKN2A p.Gly122Arg VAR_035069 rs113798404
30 CDKN2A p.Gly35Val VAR_058551 rs746834149
31 CDKN2A p.Gly67Arg VAR_058553 rs758389471
32 CDKN2A p.Asp74Tyr VAR_058555 rs760640852
33 CDKN2A p.Thr77Pro VAR_058556
34 CDKN2A p.Arg80Pro VAR_058557 rs105751988
35 CDKN2A p.Pro81Thr VAR_058558

Cosmic variations for Melanoma, Cutaneous Malignant 2:

9 (show all 14)
# Cosmic Mut ID Gene Symbol COSMIC Disease Classification
(Primary site, Site subtype, Primary histology, Histology subtype)
Mutation CDS Mutation AA GRCh38 Location Conf
1 COSM580 NRAS skin,ear,malignant melanoma,NS c.181C>A p.Q61K 1:114713909-114713909 6
2 COSM5049807 NF1 skin,ear,malignant melanoma,NS c.3097C>T p.Q1033* 17:31230366-31230366 6
3 COSM5049808 NF1 skin,ear,malignant melanoma,NS c.3652C>T p.Q1218* 17:31233157-31233157 6
4 COSM1651647 KIT skin,eye,malignant melanoma,NS c.1459G>A p.G487S 4:54725969-54725969 6
5 COSM109660 GRIN2A skin,ear,malignant melanoma,NS c.4097C>T p.P1366L 16:9763447-9763447 6
6 COSM106626 GRIN2A skin,ear,malignant melanoma,NS c.1959G>A p.M653I 16:9829471-9829471 6
7 COSM110485 GRIN2A skin,ear,malignant melanoma,NS c.3217G>A p.E1073K 16:9764327-9764327 6
8 COSM141892 CNR1 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
9 COSM141856 CHRM3 skin,ear,malignant melanoma,NS c.1741T>A p.F581I 1:239909192-239909192 6
10 COSM471 BRAF skin,ear,malignant melanoma,NS c.1790T>G p.L597R 7:140753345-140753345 6
11 COSM27639 BRAF skin,ear,malignant melanoma,NS c.1780G>A p.D594N 7:140753355-140753355 6
12 COSM476 BRAF skin,ear,malignant melanoma,NS c.1799T>A p.V600E 7:140753336-140753336 6
13 COSM1125 BRAF skin,ear,malignant melanoma,NS c.1790T>A p.L597Q 7:140753345-140753345 6
14 COSM478 BRAF skin,ear,malignant melanoma,NS c.1801A>G p.K601E 7:140753334-140753334 6

Expression for Melanoma, Cutaneous Malignant 2

Search GEO for disease gene expression data for Melanoma, Cutaneous Malignant 2.

Pathways for Melanoma, Cutaneous Malignant 2

GO Terms for Melanoma, Cutaneous Malignant 2

Sources for Melanoma, Cutaneous Malignant 2

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HGMD
31 HMDB
32 HPO
33 ICD10
34 ICD10 via Orphanet
35 ICD9CM
36 IUPHAR
37 KEGG
38 LifeMap
40 LOVD
42 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
54 NINDS
55 Novoseek
57 OMIM
58 OMIM via Orphanet
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 TGDB
71 Tocris
72 UMLS
73 UMLS via Orphanet
Content
Loading form....