Melanoma, Cutaneous Malignant 2 (CMM2)

Categories: Cancer diseases, Genetic diseases, Nephrological diseases, Rare diseases, Skin diseases

Aliases & Classifications for Melanoma, Cutaneous Malignant 2

MalaCards integrated aliases for Melanoma, Cutaneous Malignant 2:

Name: Melanoma, Cutaneous Malignant 2 56 73
Cutaneous Malignant Melanoma 2 73 29 6
Melanoma, Cutaneous Malignant, 2 56 13
Cmm2 56 73
Melanoma, Cutaneous, Malignant, Susceptibility to, Type 2 39
Melanoma, Cutaneous Malignant, Susceptibility to, 2 56



autosomal dominant


melanoma, cutaneous malignant 2:
Inheritance autosomal dominant inheritance


External Ids:

OMIM 56 155601
OMIM Phenotypic Series 56 PS155600
MeSH 43 D008545
MedGen 41 C1835044
SNOMED-CT via HPO 68 2092003 263681008 372244006

Summaries for Melanoma, Cutaneous Malignant 2

OMIM : 56 Malignant melanoma is a neoplasm of pigment-producing cells called melanocytes that occurs most often in the skin, but may also occur in the eyes, ears, gastrointestinal tract, leptomeninges, and oral and genital mucous membranes (summary by Habif, 2010). For a discussion of genetic heterogeneity of cutaneous malignant melanoma, see CMM1 (155600). (155601)

MalaCards based summary : Melanoma, Cutaneous Malignant 2, also known as cutaneous malignant melanoma 2, is related to lentigines and nodular malignant melanoma. An important gene associated with Melanoma, Cutaneous Malignant 2 is CDKN2A (Cyclin Dependent Kinase Inhibitor 2A). Affiliated tissues include skin, eye and prostate, and related phenotype is cutaneous melanoma.

UniProtKB/Swiss-Prot : 73 Melanoma, cutaneous malignant 2: A malignant neoplasm of melanocytes, arising de novo or from a pre- existing benign nevus, which occurs most often in the skin but also may involve other sites.

Related Diseases for Melanoma, Cutaneous Malignant 2

Diseases in the Melanoma, Cutaneous Malignant 1 family:

Melanoma, Cutaneous Malignant 2 Melanoma, Cutaneous Malignant 4
Melanoma, Cutaneous Malignant 3 Melanoma, Cutaneous Malignant 7
Melanoma, Cutaneous Malignant 5 Melanoma, Cutaneous Malignant 6
Melanoma, Cutaneous Malignant 8 Melanoma, Cutaneous Malignant 9
Melanoma, Cutaneous Malignant 10

Diseases related to Melanoma, Cutaneous Malignant 2 via text searches within MalaCards or GeneCards Suite gene sharing:

# Related Disease Score Top Affiliating Genes
1 lentigines 9.9
2 nodular malignant melanoma 9.9
3 acral lentiginous melanoma 9.9
4 lentigo maligna melanoma 9.9
5 superficial spreading melanoma 9.9

Graphical network of the top 20 diseases related to Melanoma, Cutaneous Malignant 2:

Diseases related to Melanoma, Cutaneous Malignant 2

Symptoms & Phenotypes for Melanoma, Cutaneous Malignant 2

Human phenotypes related to Melanoma, Cutaneous Malignant 2:

# Description HPO Frequency HPO Source Accession
1 cutaneous melanoma 31 HP:0012056

Symptoms via clinical synopsis from OMIM:

malignant melanoma

Laboratory Abnormalities:
frequent deletions of chromosome 9 in melanoma

Clinical features from OMIM:


Drugs & Therapeutics for Melanoma, Cutaneous Malignant 2

Search Clinical Trials , NIH Clinical Center for Melanoma, Cutaneous Malignant 2

Genetic Tests for Melanoma, Cutaneous Malignant 2

Genetic tests related to Melanoma, Cutaneous Malignant 2:

# Genetic test Affiliating Genes
1 Cutaneous Malignant Melanoma 2 29 CDKN2A

Anatomical Context for Melanoma, Cutaneous Malignant 2

MalaCards organs/tissues related to Melanoma, Cutaneous Malignant 2:

Skin, Eye, Prostate

Publications for Melanoma, Cutaneous Malignant 2

Articles related to Melanoma, Cutaneous Malignant 2:

(show top 50) (show all 72)
# Title Authors PMID Year
Novel and recurrent p14 mutations in Italian familial melanoma. 56 6
20132244 2010
New founder germline mutations of CDKN2A in melanoma-prone families and multiple primary melanoma development in a patient receiving levodopa treatment. 56 6
17492760 2007
A cell cycle regulator potentially involved in genesis of many tumor types. 56 6
8153634 1994
American Society of Clinical Oncology Expert Statement: collection and use of a cancer family history for oncology providers. 6
24493721 2014
Indication for CDKN2A-mutation analysis in familial pancreatic cancer families without melanomas. 6
22636603 2012
Melanoma risk for CDKN2A mutation carriers who are relatives of population-based case carriers in Australia and the UK. 56
21325014 2011
Predicting functional significance of cancer-associated p16(INK4a) mutations in CDKN2A. 6
20340136 2010
Genome-wide association study identifies three loci associated with melanoma risk. 56
19578364 2009
Genome-wide association study identifies variants at 9p21 and 22q13 associated with development of cutaneous nevi. 56
19578365 2009
New common variants affecting susceptibility to basal cell carcinoma. 6
19578363 2009
SLC45A2: a novel malignant melanoma-associated gene. 6
18563784 2008
Variants of the MATP/SLC45A2 gene are protective for melanoma in the French population. 6
18683857 2008
CDKN2A mutations and melanoma risk in the Icelandic population. 6
18178632 2008
A genomewide association study of skin pigmentation in a South Asian population. 6
17999355 2007
Distribution of the F374 allele of the SLC45A2 (MATP) gene and founder-haplotype analysis. 6
17044855 2006
Melanoma. 56
16822996 2006
Familial melanoma, pancreatic cancer and germline CDKN2A mutations. 6
15146471 2004
A single Mediterranean, possibly Jewish, origin for the Val59Gly CDKN2A mutation in four melanoma-prone families. 6
12700603 2003
Hereditary p16-Leiden mutation in a patient with multiple head and neck tumors. 6
12549483 2003
Germline mutation of ARF in a melanoma kindred. 6
12019208 2002
High prevalence of the G101W germline mutation in the CDKN2A (P16(ink4a)) gene in 62 Italian malignant melanoma families. 6
11807902 2002
Sporadic multiple primary melanoma cases: CDKN2A germline mutations with a founder effect. 6
11579459 2001
A deep intronic mutation in CDKN2A is associated with disease in a subset of melanoma pedigrees. 6
11726555 2001
A common founder for the V126D CDKN2A mutation in seven North American melanoma-prone families. 6
11506491 2001
Haplotype analysis and age estimation of the 113insR CDKN2A founder mutation in Swedish melanoma families. 6
11319798 2001
Risk of developing pancreatic cancer in families with familial atypical multiple mole melanoma associated with a specific 19 deletion of p16 (p16-Leiden). 6
10956390 2000
A single genetic origin for the G101W CDKN2A mutation in 20 melanoma-prone families. 6
10869234 2000
CDKN2A mutations in Spanish cutaneous malignant melanoma families and patients with multiple melanomas and other neoplasia. 6
10874641 1999
A locus linked to p16 modifies melanoma risk in Dutch familial atypical multiple mole melanoma (FAMMM) syndrome families. 6
10400925 1999
Mutation of the CDKN2A 5' UTR creates an aberrant initiation codon and predisposes to melanoma. 6
9916806 1999
CDKN2A germline mutations in U.K. patients with familial melanoma and multiple primary melanomas. 6
9699728 1998
CDKN2A mutations in multiple primary melanomas. 6
9516223 1998
Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France. The French Familial Melanoma Study Group. 6
9425228 1998
Haplotype analysis of two recurrent CDKN2A mutations in 10 melanoma families: evidence for common founders and independent mutations. 6
9603434 1998
Analysis of the CDKN2A, CDKN2B and CDK4 genes in 48 Australian melanoma kindreds. 6
9416844 1997
Germline mutations of the CDKN2 gene in UK melanoma families. 6
9328469 1997
Novel germline p16 mutation in familial malignant melanoma in southern Sweden. 6
8653684 1996
Two-locus linkage analysis of cutaneous malignant melanoma/dysplastic nevi. 56
8651266 1996
The current situation with regard to human melanoma and genetic inferences. 6
8727306 1996
Familial melanoma and pancreatic cancer. Ligurian Skin Tumor Study Group. 6
8552158 1996
Analysis of the p16 gene, CDKN2, in 17 Australian melanoma kindreds. 6
8570179 1995
Mutations of the CDKN2/p16INK4 gene in Australian melanoma kindreds. 6
8595405 1995
Brief report: a familial syndrome of pancreatic cancer and melanoma with a mutation in the CDKN2 tumor-suppressor gene. 6
7666917 1995
Chromosome 9p deletions in cutaneous malignant melanoma tumors: the minimal deleted region involves markers outside the p16 (CDKN2) gene. 56
7668266 1995
Germline p16INK4A mutation and protein dysfunction in a family with inherited melanoma. 6
7624155 1995
Mutational analysis of CDKN2 (CDK4I/MTS1) gene in tissues and cell lines of human prostate cancer. 6
7559077 1995
Homozygotes for CDKN2 (p16) germline mutation in Dutch familial melanoma kindreds. 6
7670475 1995
Genetic heterogeneity in familial malignant melanoma. 6
7881419 1994
Genetics of seven Dutch familial atypical multiple mole-melanoma syndrome families: a review of linkage results including chromosomes 1 and 9. 56
7963673 1994
Analysis of the p16 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. 56
7987388 1994

Variations for Melanoma, Cutaneous Malignant 2

ClinVar genetic disease variations for Melanoma, Cutaneous Malignant 2:

6 (show all 36) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 CDKN2A NM_000077.4(CDKN2A):c.238C>T (p.Arg80Ter)SNV Likely pathogenic,risk factor 9409 rs121913388 9:21971120-21971120 9:21971121-21971121
2 CDKN2A NM_000077.4(CDKN2A):c.226_244del (p.Ala76fs)deletion Pathogenic,risk factor 9410 rs587776716 9:21971114-21971132 9:21971115-21971133
3 CDKN2A NM_000077.4(CDKN2A):c.-34G>TSNV Pathogenic 182414 rs1800586 9:21974860-21974860 9:21974861-21974861
4 CDKN2A NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile)SNV Pathogenic 9414 rs104894095 9:21971199-21971199 9:21971200-21971200
5 CDKN2A NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp)SNV Pathogenic 9420 rs104894098 9:21970981-21970981 9:21970982-21970982
6 CDKN2A NM_000077.4(CDKN2A):c.339_340delGCinsCT (p.Pro114Ser)indel Pathogenic 9424 rs387906410 9:21971018-21971019 9:21971019-21971020
7 CDKN2A NM_000077.4(CDKN2A):c.260G>C (p.Arg87Pro)SNV Pathogenic 236984 rs878853647 9:21971098-21971098 9:21971099-21971099
8 CDKN2A NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup)short repeat Pathogenic/Likely pathogenic 135827 rs587780668 9:21974794-21974795 9:21974795-21974796
9 CDKN2A NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile)SNV Pathogenic/Likely pathogenic 9425 rs104894109 9:21971191-21971191 9:21971192-21971192
10 CDKN2A NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly)SNV Pathogenic/Likely pathogenic 9423 rs104894099 9:21971182-21971182 9:21971183-21971183
11 CDKN2A NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro)SNV Pathogenic/Likely pathogenic 9415 rs104894097 9:21974756-21974756 9:21974757-21974757
12 CDKN2A CDKN2A, -34G-TSNV risk factor 9417
13 CDKN2A CDKN2A, IVS2, A-G, -105SNV risk factor 9421
14 CDKN2A NM_000077.4(CDKN2A):c.364G>C (p.Gly122Arg)SNV risk factor 9422 rs113798404 9:21970994-21970994 9:21970995-21970995
15 CDKN2A NM_058195.3(CDKN2A):c.184_186AGA[3] (p.Arg63dup)short repeat risk factor 9413 rs1563902635 9:21994141-21994142 9:21994142-21994143
16 CDKN2A NM_000077.4(CDKN2A):c.265G>A (p.Gly89Ser)SNV risk factor 9408 rs137854597 9:21971093-21971093 9:21971094-21971094
17 CDKN2A CDKN2A, 6-BP DEL, NT363deletion risk factor 9411
18 CDKN2A CDKN2A, IVS1BDS, A-G, +1SNV risk factor 30043
19 CDKN2A NM_058195.3(CDKN2A):c.161G>A (p.Arg54His)SNV risk factor 30044 9:21994170-21994170 9:21994171-21994171
20 CDKN2A NM_000077.4(CDKN2A):c.150+37G>CSNV Conflicting interpretations of pathogenicity 41573 rs45456595 9:21974640-21974640 9:21974641-21974641
21 CDKN2A NM_000077.4(CDKN2A):c.369T>A (p.His123Gln)SNV Conflicting interpretations of pathogenicity 127526 rs6413463 9:21970989-21970989 9:21970990-21970990
22 CDKN2A NM_000077.4(CDKN2A):c.-34G>ASNV Conflicting interpretations of pathogenicity 379882 rs1800586 9:21974860-21974860 9:21974861-21974861
23 CDKN2A NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp)SNV Conflicting interpretations of pathogenicity 9412 rs104894094 9:21971057-21971057 9:21971058-21971058
24 CDKN2A NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp)SNV Conflicting interpretations of pathogenicity 9426 rs137854599 9:21971092-21971092 9:21971093-21971093
25 CDKN2A NM_000077.4(CDKN2A):c.365G>T (p.Gly122Val)SNV Uncertain significance 182419 rs373291490 9:21970993-21970993 9:21970994-21970994
26 CDKN2A NM_058195.3(CDKN2A):c.194-3611_194-3588delshort repeat Uncertain significance 216277 rs587780668 9:21974795-21974818 9:21974796-21974819
27 CDKN2A NM_000077.4(CDKN2A):c.315C>A (p.Asp105Glu)SNV Uncertain significance 406702 rs763269347 9:21971043-21971043 9:21971044-21971044
28 CDKN2A NM_000077.4(CDKN2A):c.160A>C (p.Met54Leu)SNV Uncertain significance 463486 rs201314211 9:21971198-21971198 9:21971199-21971199
29 CDKN2A NM_000077.4(CDKN2A):c.294C>T (p.His98=)SNV Uncertain significance 463515 rs752685118 9:21971064-21971064 9:21971065-21971065
30 CDKN2A NM_000077.4(CDKN2A):c.170C>A (p.Ala57Asp)SNV Uncertain significance 483325 rs372266620 9:21971188-21971188 9:21971189-21971189
31 CDKN2A NM_058195.3(CDKN2A):c.160C>A (p.Arg54Ser)SNV Uncertain significance 487012 rs896054565 9:21994171-21994171 9:21994172-21994172
32 CDKN2A NM_000077.4(CDKN2A):c.150+82A>GSNV Uncertain significance 584731 rs1231900408 9:21974595-21974595 9:21974596-21974596
33 CDKN2A NM_000077.4(CDKN2A):c.148C>A (p.Gln50Lys)SNV Uncertain significance 584732 rs864622636 9:21974679-21974679 9:21974680-21974680
34 CDKN2A NM_000077.4(CDKN2A):c.32C>T (p.Pro11Leu)SNV Uncertain significance 584734 rs1374664673 9:21974795-21974795 9:21974796-21974796
35 CDKN2A NM_058195.3(CDKN2A):c.35G>A (p.Arg12Gln)SNV Uncertain significance 584735 rs201877069 9:21994296-21994296 9:21994297-21994297
36 CDKN2A NM_000077.4(CDKN2A):c.122C>A (p.Pro41Gln)SNV Uncertain significance 141111 rs373407950 9:21974705-21974705 9:21974706-21974706

UniProtKB/Swiss-Prot genetic disease variations for Melanoma, Cutaneous Malignant 2:

73 (show all 35)
# Symbol AA change Variation ID SNP ID
1 CDKN2A p.Arg24Cys VAR_001413
2 CDKN2A p.Arg24Pro VAR_001414 rs104894097
3 CDKN2A p.Leu32Pro VAR_001416 rs878853650
4 CDKN2A p.Gly35Ala VAR_001418 rs746834149
5 CDKN2A p.Gly35Glu VAR_001419 rs746834149
6 CDKN2A p.Pro48Leu VAR_001420
7 CDKN2A p.Gln50Arg VAR_001423 rs587778189
8 CDKN2A p.Met53Ile VAR_001424 rs104894095
9 CDKN2A p.Val59Gly VAR_001427 rs104894099
10 CDKN2A p.Leu62Pro VAR_001430
11 CDKN2A p.Ala68Leu VAR_001432 rs876658534
12 CDKN2A p.Asn71Lys VAR_001437
13 CDKN2A p.Asp84Tyr VAR_001449 rs11552822
14 CDKN2A p.Arg87Pro VAR_001451 rs878853647
15 CDKN2A p.Gly89Asp VAR_001453 rs137854599
16 CDKN2A p.Gly89Ser VAR_001454 rs137854597
17 CDKN2A p.Leu97Arg VAR_001457
18 CDKN2A p.His98Pro VAR_001458
19 CDKN2A p.His98Gln VAR_001459
20 CDKN2A p.Arg99Pro VAR_001460
21 CDKN2A p.Ala100Leu VAR_001462
22 CDKN2A p.Gly101Trp VAR_001464 rs104894094
23 CDKN2A p.Arg107Cys VAR_001466
24 CDKN2A p.Leu117Met VAR_001471
25 CDKN2A p.Ala118Thr VAR_001472 rs155465396
26 CDKN2A p.Val126Asp VAR_001479 rs104894098
27 CDKN2A p.Arg87Trp VAR_012317 rs749714198
28 CDKN2A p.Leu94Gln VAR_023604
29 CDKN2A p.Gly122Arg VAR_035069 rs113798404
30 CDKN2A p.Gly35Val VAR_058551 rs746834149
31 CDKN2A p.Gly67Arg VAR_058553 rs758389471
32 CDKN2A p.Asp74Tyr VAR_058555 rs760640852
33 CDKN2A p.Thr77Pro VAR_058556
34 CDKN2A p.Arg80Pro VAR_058557 rs105751988
35 CDKN2A p.Pro81Thr VAR_058558

Cosmic variations for Melanoma, Cutaneous Malignant 2:

9 (show all 46)
# Cosmic Mut ID Gene Symbol COSMIC Disease Classification
(Primary site, Site subtype, Primary histology, Histology subtype)
Mutation CDS Mutation AA GRCh38 Location Conf
1 COSM97107326 NRAS skin,ear,malignant melanoma,NS c.181C>A p.Q61K 1:114713909-114713909 6
2 COSM93665204 NF1 skin,ear,malignant melanoma,NS c.3652C>T p.Q1218* 17:31233157-31233157 6
3 COSM93692305 NF1 skin,ear,malignant melanoma,NS c.3097C>T p.Q1033* 17:31230366-31230366 6
4 COSM88321369 KIT skin,eye,malignant melanoma,NS c.1459G>A p.G487S 4:54725969-54725969 6
5 COSM99100400 GRIN2A skin,ear,malignant melanoma,NS c.3217G>A p.E1073K 16:9764327-9764327 6
6 COSM99100596 GRIN2A skin,ear,malignant melanoma,NS c.1959G>A p.M653I 16:9829471-9829471 6
7 COSM99112008 GRIN2A skin,ear,malignant melanoma,NS c.4097C>T p.P1366L 16:9763447-9763447 6
8 COSM96990932 CNR1 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
9 COSM87493313 CHRM3 skin,ear,malignant melanoma,NS c.1741T>A p.F581I 1:239909192-239909192 6
10 COSM150563774 BRAF skin,ear,malignant melanoma,NS c.1799T>A p.V600E 7:140753336-140753336 6
11 COSM150564452 BRAF skin,ear,malignant melanoma,NS c.1801A>G p.K601E 7:140753334-140753334 6
12 COSM150570620 BRAF skin,ear,malignant melanoma,NS c.1790T>A p.L597Q 7:140753345-140753345 6
13 COSM150565869 BRAF skin,ear,malignant melanoma,NS c.1780G>A p.D594N 7:140753355-140753355 6
14 COSM150585368 BRAF skin,ear,malignant melanoma,NS c.1790T>G p.L597R 7:140753345-140753345 6
15 COSM149414554 skin,ear,malignant melanoma,NS c.1910T>G p.L637R 7:140753345-140753345 6
16 COSM88812698 skin,ear,malignant melanoma,NS c.1910T>A p.L637Q 7:140753345-140753345 6
17 COSM118795694 skin,ear,malignant melanoma,NS c.1790T>A p.L597Q 7:140753345-140753345 6
18 COSM88803061 skin,ear,malignant melanoma,NS c.1919T>A p.V640E 7:140753336-140753336 6
19 COSM97223158 skin,ear,malignant melanoma,NS c.103+42C>T p.? 6:88145130-88145130 6
20 COSM118813778 skin,ear,malignant melanoma,NS c.1790T>G p.L597R 7:140753345-140753345 6
21 COSM88806346 skin,ear,malignant melanoma,NS c.1900G>A p.D634N 7:140753355-140753355 6
22 COSM118790577 skin,ear,malignant melanoma,NS c.1780G>A p.D594N 7:140753355-140753355 6
23 COSM89609735 skin,ear,malignant melanoma,NS c.1959G>A p.M653I 16:9829471-9829471 6
24 COSM144455643 skin,ear,malignant melanoma,NS c.1741T>A p.F581I 1:239909192-239909192 6
25 COSM152018575 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
26 COSM93539965 skin,ear,malignant melanoma,NS c.3097C>T p.Q1033* 17:31230366-31230366 6
27 COSM118787231 skin,ear,malignant melanoma,NS c.1799T>A p.V600E 7:140753336-140753336 6
28 COSM108059286 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
29 COSM135206415 skin,ear,malignant melanoma,NS c.3217G>A p.E1073K 16:9764327-9764327 6
30 COSM117327995 skin,ear,malignant melanoma,NS c.63-17C>T p.? 6:88145130-88145130 6
31 COSM135217389 skin,ear,malignant melanoma,NS c.3773-19C>T p.? 16:9763447-9763447 6
32 COSM131440106 skin,ear,malignant melanoma,NS c.1548G>A p.M516I 16:9829471-9829471 6
33 COSM89609531 skin,ear,malignant melanoma,NS c.3217G>A p.E1073K 16:9764327-9764327 6
34 COSM135206628 skin,ear,malignant melanoma,NS c.1959G>A p.M653I 16:9829471-9829471 6
35 COSM149385292 skin,ear,malignant melanoma,NS c.1919T>A p.V640E 7:140753336-140753336 6
36 COSM96983478 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
37 COSM149386940 skin,ear,malignant melanoma,NS c.1921A>G p.K641E 7:140753334-140753334 6
38 COSM89621238 skin,ear,malignant melanoma,NS c.4097C>T p.P1366L 16:9763447-9763447 6
39 COSM149388933 skin,ear,malignant melanoma,NS c.1900G>A p.D634N 7:140753355-140753355 6
40 COSM88834639 skin,ear,malignant melanoma,NS c.1910T>G p.L637R 7:140753345-140753345 6
41 COSM118788384 skin,ear,malignant melanoma,NS c.1801A>G p.K601E 7:140753334-140753334 6
42 COSM131447592 skin,ear,malignant melanoma,NS c.3362-19C>T p.? 16:9763447-9763447 6
43 COSM93519256 skin,ear,malignant melanoma,NS c.3652C>T p.Q1218* 17:31233157-31233157 6
44 COSM149394818 skin,ear,malignant melanoma,NS c.1910T>A p.L637Q 7:140753345-140753345 6
45 COSM88804430 skin,ear,malignant melanoma,NS c.1921A>G p.K641E 7:140753334-140753334 6
46 COSM131440017 skin,ear,malignant melanoma,NS c.2806G>A p.E936K 16:9764327-9764327 6

Expression for Melanoma, Cutaneous Malignant 2

Search GEO for disease gene expression data for Melanoma, Cutaneous Malignant 2.

Pathways for Melanoma, Cutaneous Malignant 2

GO Terms for Melanoma, Cutaneous Malignant 2

Sources for Melanoma, Cutaneous Malignant 2

9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
31 HPO
32 ICD10
33 ICD10 via Orphanet
37 LifeMap
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
54 Novoseek
57 OMIM via Orphanet
61 PubMed
70 Tocris
72 UMLS via Orphanet
Loading form....