Home
User Guide
What's in a MalaCard Search Guide Our Sources
Analysis Tools
GeneCards GeneAnalytics GeneAlaCart PathCards VarElect
News and Views Disease Lists/Categories
About
About MalaCards Datasets Our Publications Weizmann Institute LifeMap Discovery® Terms of Use MalaCards Team
CMM2
MCID: MLN067
MIFTS: 29

Melanoma, Cutaneous Malignant 2 (CMM2)

Categories: Cancer diseases, Genetic diseases, Nephrological diseases, Rare diseases, Skin diseases
Genes Variations Tissues Related diseases Publications Symptoms & Phenotypes
Sources

Aliases & Classifications for Melanoma, Cutaneous Malignant 2

About this section

MalaCards integrated aliases for Melanoma, Cutaneous Malignant 2:

Name: Melanoma, Cutaneous Malignant 2 57 73
Cutaneous Malignant Melanoma 2 73 29 6
Melanoma, Cutaneous Malignant, 2 57 13
Cmm2 57 73
Melanoma, Cutaneous, Malignant, Susceptibility to, Type 2 39
Melanoma, Cutaneous Malignant, Susceptibility to, 2 57

Characteristics:

OMIM®:

57 (Updated 05-Mar-2021)
Inheritance:
autosomal dominant


HPO:

31
melanoma, cutaneous malignant 2:
Inheritance autosomal dominant inheritance


Classifications:

MalaCards categories:
Global: Genetic diseases Rare diseases Cancer diseases
Anatomical: Skin diseases Nephrological diseases
See all MalaCards categories (disease lists)


External Ids:

OMIM® 57 155601
OMIM Phenotypic Series 57 PS155600
MeSH 44 D008545
MedGen 41 C1835044
SNOMED-CT via HPO 68 2092003 263681008 372244006
Sources

Summaries for Melanoma, Cutaneous Malignant 2

About this section
OMIM® : 57 Malignant melanoma is a neoplasm of pigment-producing cells called melanocytes that occurs most often in the skin, but may also occur in the eyes, ears, gastrointestinal tract, leptomeninges, and oral and genital mucous membranes (summary by Habif, 2010). For a discussion of genetic heterogeneity of cutaneous malignant melanoma, see CMM1 (155600). (155601) (Updated 05-Mar-2021)

MalaCards based summary : Melanoma, Cutaneous Malignant 2, also known as cutaneous malignant melanoma 2, is related to lentigines and nodular malignant melanoma. An important gene associated with Melanoma, Cutaneous Malignant 2 is CDKN2A (Cyclin Dependent Kinase Inhibitor 2A). Affiliated tissues include skin and prostate, and related phenotype is cutaneous melanoma.

UniProtKB/Swiss-Prot : 73 Melanoma, cutaneous malignant 2: A malignant neoplasm of melanocytes, arising de novo or from a pre- existing benign nevus, which occurs most often in the skin but also may involve other sites.

Sources

Related Diseases for Melanoma, Cutaneous Malignant 2

About this section

Diseases in the Melanoma, Cutaneous Malignant 1 family:

Melanoma, Cutaneous Malignant 2 Melanoma, Cutaneous Malignant 4
Melanoma, Cutaneous Malignant 3 Melanoma, Cutaneous Malignant 7
Melanoma, Cutaneous Malignant 5 Melanoma, Cutaneous Malignant 6
Melanoma, Cutaneous Malignant 8 Melanoma, Cutaneous Malignant 9
Melanoma, Cutaneous Malignant 10

Diseases related to Melanoma, Cutaneous Malignant 2 via text searches within MalaCards or GeneCards Suite gene sharing:

# Related Disease Score Top Affiliating Genes
1 lentigines 10.0
2 nodular malignant melanoma 10.0
3 melanoma 10.0
4 acral lentiginous melanoma 10.0
5 lentigo maligna melanoma 10.0
6 superficial spreading melanoma 10.0

Graphical network of the top 20 diseases related to Melanoma, Cutaneous Malignant 2:



Diseases related to Melanoma, Cutaneous Malignant 2
Sources

Symptoms & Phenotypes for Melanoma, Cutaneous Malignant 2

About this section

Human phenotypes related to Melanoma, Cutaneous Malignant 2:

31
# Description HPO Frequency HPO Source Accession
1 cutaneous melanoma 31 HP:0012056

Symptoms via clinical synopsis from OMIM®:

57 (Updated 05-Mar-2021)
Neoplasia:
malignant melanoma

Laboratory Abnormalities:
frequent deletions of chromosome 9 in melanoma

Clinical features from OMIM®:

155601 (Updated 05-Mar-2021)

Sources

Drugs & Therapeutics for Melanoma, Cutaneous Malignant 2

About this section

Search Clinical Trials , NIH Clinical Center for Melanoma, Cutaneous Malignant 2

Sources

Genetic Tests for Melanoma, Cutaneous Malignant 2

About this section

Genetic tests related to Melanoma, Cutaneous Malignant 2:

# Genetic test Affiliating Genes
1 Cutaneous Malignant Melanoma 2 29 CDKN2A
Sources

Anatomical Context for Melanoma, Cutaneous Malignant 2

About this section

MalaCards organs/tissues related to Melanoma, Cutaneous Malignant 2:

40
Skin, Prostate
Sources

Publications for Melanoma, Cutaneous Malignant 2

About this section

Articles related to Melanoma, Cutaneous Malignant 2:

(show top 50) (show all 65)
# Title Authors PMID Year
1
Novel and recurrent p14 mutations in Italian familial melanoma. 57 6
20132244 2010
2
New founder germline mutations of CDKN2A in melanoma-prone families and multiple primary melanoma development in a patient receiving levodopa treatment. 6 57
17492760 2007
3
A cell cycle regulator potentially involved in genesis of many tumor types. 6 57
8153634 1994
4
Indication for CDKN2A-mutation analysis in familial pancreatic cancer families without melanomas. 6
22636603 2012
5
Melanoma risk for CDKN2A mutation carriers who are relatives of population-based case carriers in Australia and the UK. 57
21325014 2011
6
Predicting functional significance of cancer-associated p16(INK4a) mutations in CDKN2A. 6
20340136 2010
7
Genome-wide association study identifies variants at 9p21 and 22q13 associated with development of cutaneous nevi. 57
19578365 2009
8
Genome-wide association study identifies three loci associated with melanoma risk. 57
19578364 2009
9
CDKN2A mutations and melanoma risk in the Icelandic population. 6
18178632 2008
10
Melanoma. 57
16822996 2006
11
Familial melanoma, pancreatic cancer and germline CDKN2A mutations. 6
15146471 2004
12
A single Mediterranean, possibly Jewish, origin for the Val59Gly CDKN2A mutation in four melanoma-prone families. 6
12700603 2003
13
Hereditary p16-Leiden mutation in a patient with multiple head and neck tumors. 6
12549483 2003
14
Germline mutation of ARF in a melanoma kindred. 6
12019208 2002
15
High prevalence of the G101W germline mutation in the CDKN2A (P16(ink4a)) gene in 62 Italian malignant melanoma families. 6
11807902 2002
16
Sporadic multiple primary melanoma cases: CDKN2A germline mutations with a founder effect. 6
11579459 2001
17
A deep intronic mutation in CDKN2A is associated with disease in a subset of melanoma pedigrees. 6
11726555 2001
18
A common founder for the V126D CDKN2A mutation in seven North American melanoma-prone families. 6
11506491 2001
19
Haplotype analysis and age estimation of the 113insR CDKN2A founder mutation in Swedish melanoma families. 6
11319798 2001
20
Risk of developing pancreatic cancer in families with familial atypical multiple mole melanoma associated with a specific 19 deletion of p16 (p16-Leiden). 6
10956390 2000
21
A single genetic origin for the G101W CDKN2A mutation in 20 melanoma-prone families. 6
10869234 2000
22
CDKN2A mutations in Spanish cutaneous malignant melanoma families and patients with multiple melanomas and other neoplasia. 6
10874641 1999
23
A locus linked to p16 modifies melanoma risk in Dutch familial atypical multiple mole melanoma (FAMMM) syndrome families. 6
10400925 1999
24
Mutation of the CDKN2A 5' UTR creates an aberrant initiation codon and predisposes to melanoma. 6
9916806 1999
25
CDKN2A germline mutations in U.K. patients with familial melanoma and multiple primary melanomas. 6
9699728 1998
26
CDKN2A mutations in multiple primary melanomas. 6
9516223 1998
27
Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France. The French Familial Melanoma Study Group. 6
9425228 1998
28
Haplotype analysis of two recurrent CDKN2A mutations in 10 melanoma families: evidence for common founders and independent mutations. 6
9603434 1998
29
Analysis of the CDKN2A, CDKN2B and CDK4 genes in 48 Australian melanoma kindreds. 6
9416844 1997
30
Germline mutations of the CDKN2 gene in UK melanoma families. 6
9328469 1997
31
Novel germline p16 mutation in familial malignant melanoma in southern Sweden. 6
8653684 1996
32
Two-locus linkage analysis of cutaneous malignant melanoma/dysplastic nevi. 57
8651266 1996
33
The current situation with regard to human melanoma and genetic inferences. 6
8727306 1996
34
Familial melanoma and pancreatic cancer. Ligurian Skin Tumor Study Group. 6
8552158 1996
35
Analysis of the p16 gene, CDKN2, in 17 Australian melanoma kindreds. 6
8570179 1995
36
Mutations of the CDKN2/p16INK4 gene in Australian melanoma kindreds. 6
8595405 1995
37
Brief report: a familial syndrome of pancreatic cancer and melanoma with a mutation in the CDKN2 tumor-suppressor gene. 6
7666917 1995
38
Chromosome 9p deletions in cutaneous malignant melanoma tumors: the minimal deleted region involves markers outside the p16 (CDKN2) gene. 57
7668266 1995
39
Germline p16INK4A mutation and protein dysfunction in a family with inherited melanoma. 6
7624155 1995
40
Mutational analysis of CDKN2 (CDK4I/MTS1) gene in tissues and cell lines of human prostate cancer. 6
7559077 1995
41
Homozygotes for CDKN2 (p16) germline mutation in Dutch familial melanoma kindreds. 6
7670475 1995
42
Genetic heterogeneity in familial malignant melanoma. 6
7881419 1994
43
Genetics of seven Dutch familial atypical multiple mole-melanoma syndrome families: a review of linkage results including chromosomes 1 and 9. 57
7963673 1994
44
Analysis of the p16 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. 57
7987388 1994
45
Localization of the 9p melanoma susceptibility locus (MLM) to a 2-cM region between D9S736 and D9S171. 57
7829086 1994
46
Localization of a putative tumor suppressor gene by using homozygous deletions in melanomas. 57
8052620 1994
47
Frequent somatic mutation of the MTS1/CDK4I (multiple tumor suppressor/cyclin-dependent kinase 4 inhibitor) gene in esophageal squamous cell carcinoma. 6
8012957 1994
48
Linkage of cutaneous malignant melanoma/dysplastic nevi to chromosome 9p, and evidence for genetic heterogeneity. 57
8116618 1994
49
Confirmation of chromosome 9p linkage in familial melanoma. 57
8213823 1993
50
Linkage analysis in Dutch familial atypical multiple mole-melanoma (FAMMM) syndrome families. Effect of naevus count. 57
8219760 1993
Sources

Variations for Melanoma, Cutaneous Malignant 2

About this section

ClinVar genetic disease variations for Melanoma, Cutaneous Malignant 2:

6 (show all 36)
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 CDKN2A NM_000077.4(CDKN2A):c.260G>C (p.Arg87Pro) SNV Pathogenic 236984 rs878853647 9:21971098-21971098 9:21971099-21971099
2 CDKN2A NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) SNV Pathogenic 9415 rs104894097 9:21974756-21974756 9:21974757-21974757
3 CDKN2A NM_000077.4(CDKN2A):c.-34G>T SNV Pathogenic 182414 rs1800586 9:21974860-21974860 9:21974861-21974861
4 CDKN2A NM_000077.5(CDKN2A):c.238C>T SNV risk factor 9409 rs121913388 9:21971120-21971120 9:21971121-21971121
5 CDKN2A NM_058197.4(CDKN2A):c.*149_*167del Deletion risk factor 9410 rs587776716 9:21971114-21971132 9:21971115-21971133
6 CDKN2A CDKN2A, 6-BP DEL, NT363 Deletion risk factor 9411
7 CDKN2A CDKN2A, -34G-T SNV risk factor 9417
8 CDKN2A CDKN2A, IVS2, A-G, -105 SNV risk factor 9421
9 CDKN2A CDKN2A, IVS1BDS, A-G, +1 SNV risk factor 30043
10 CDKN2A NM_001363763.2(CDKN2A):c.-4+673AGA[3] Microsatellite risk factor 9413 rs1563902635 9:21994141-21994142 9:21994142-21994143
11 CDKN2A NM_058197.4(CDKN2A):c.*188G>A SNV risk factor 9408 rs137854597 9:21971093-21971093 9:21971094-21971094
12 CDKN2A NM_058195.3(CDKN2A):c.*8G>C SNV risk factor 9422 rs113798404 9:21970994-21970994 9:21970995-21970995
13 CDKN2A NM_001363763.2(CDKN2A):c.-4+650G>A SNV risk factor 30044 rs1587358254 9:21994170-21994170 9:21994171-21994171
14 CDKN2A NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) SNV risk factor 9412 rs104894094 9:21971057-21971057 9:21971058-21971058
15 CDKN2A NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile) SNV risk factor 9414 rs104894095 9:21971199-21971199 9:21971200-21971200
16 CDKN2A NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) SNV risk factor 9415 rs104894097 9:21974756-21974756 9:21974757-21974757
17 CDKN2A NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) Microsatellite risk factor 135827 rs587780668 9:21974794-21974795 9:21974795-21974796
18 CDKN2A NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) SNV risk factor 9420 rs104894098 9:21970981-21970981 9:21970982-21970982
19 CDKN2A NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) SNV risk factor 9423 rs104894099 9:21971182-21971182 9:21971183-21971183
20 CDKN2A NM_000077.4(CDKN2A):c.339_340delGCinsCT (p.Pro114Ser) Indel risk factor 9424 rs387906410 9:21971018-21971019 9:21971019-21971020
21 CDKN2A NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) SNV risk factor 9425 rs104894109 9:21971191-21971191 9:21971192-21971192
22 CDKN2A NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) SNV risk factor 9426 rs137854599 9:21971092-21971092 9:21971093-21971093
23 CDKN2A NM_058195.3(CDKN2A):c.194-3472C>A SNV Uncertain significance 584732 rs864622636 9:21974679-21974679 9:21974680-21974680
24 CDKN2A NM_000077.4(CDKN2A):c.150+82A>G SNV Uncertain significance 584731 rs1231900408 9:21974595-21974595 9:21974596-21974596
25 CDKN2A NM_000077.4(CDKN2A):c.32C>T (p.Pro11Leu) SNV Uncertain significance 584734 rs1374664673 9:21974795-21974795 9:21974796-21974796
26 CDKN2A NM_000077.4(CDKN2A):c.315C>A (p.Asp105Glu) SNV Uncertain significance 406702 rs763269347 9:21971043-21971043 9:21971044-21971044
27 CDKN2A NM_000077.4(CDKN2A):c.294C>T (p.His98=) SNV Uncertain significance 463515 rs752685118 9:21971064-21971064 9:21971065-21971065
28 CDKN2A NM_000077.4(CDKN2A):c.170C>A (p.Ala57Asp) SNV Uncertain significance 483325 rs372266620 9:21971188-21971188 9:21971189-21971189
29 CDKN2A NM_000077.4(CDKN2A):c.160A>C (p.Met54Leu) SNV Uncertain significance 463486 rs201314211 9:21971198-21971198 9:21971199-21971199
30 CDKN2A NM_000077.4(CDKN2A):c.365G>T (p.Gly122Val) SNV Uncertain significance 182419 rs373291490 9:21970993-21970993 9:21970994-21970994
31 CDKN2A NM_000077.4(CDKN2A):c.122C>A (p.Pro41Gln) SNV Uncertain significance 141111 rs373407950 9:21974705-21974705 9:21974706-21974706
32 CDKN2A NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) Microsatellite Uncertain significance 216277 rs587780668 9:21974795-21974818 9:21974796-21974819
33 CDKN2A NM_058195.3(CDKN2A):c.160C>A (p.Arg54Ser) SNV Uncertain significance 487012 rs896054565 9:21994171-21994171 9:21994172-21994172
34 CDKN2A NM_058195.3(CDKN2A):c.35G>A (p.Arg12Gln) SNV Uncertain significance 584735 rs201877069 9:21994296-21994296 9:21994297-21994297
35 CDKN2A NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) SNV Likely benign 127526 rs6413463 9:21970989-21970989 9:21970990-21970990
36 CDKN2A NM_000077.4(CDKN2A):c.150+37G>C SNV Likely benign 41573 rs45456595 9:21974640-21974640 9:21974641-21974641

UniProtKB/Swiss-Prot genetic disease variations for Melanoma, Cutaneous Malignant 2:

73 (show all 35)
# Symbol AA change Variation ID SNP ID
1 CDKN2A p.Arg24Cys VAR_001413
2 CDKN2A p.Arg24Pro VAR_001414 rs104894097
3 CDKN2A p.Leu32Pro VAR_001416 rs878853650
4 CDKN2A p.Gly35Ala VAR_001418 rs746834149
5 CDKN2A p.Gly35Glu VAR_001419 rs746834149
6 CDKN2A p.Pro48Leu VAR_001420
7 CDKN2A p.Gln50Arg VAR_001423 rs587778189
8 CDKN2A p.Met53Ile VAR_001424 rs104894095
9 CDKN2A p.Val59Gly VAR_001427 rs104894099
10 CDKN2A p.Leu62Pro VAR_001430
11 CDKN2A p.Ala68Leu VAR_001432 rs876658534
12 CDKN2A p.Asn71Lys VAR_001437
13 CDKN2A p.Asp84Tyr VAR_001449 rs11552822
14 CDKN2A p.Arg87Pro VAR_001451 rs878853647
15 CDKN2A p.Gly89Asp VAR_001453 rs137854599
16 CDKN2A p.Gly89Ser VAR_001454 rs137854597
17 CDKN2A p.Leu97Arg VAR_001457
18 CDKN2A p.His98Pro VAR_001458
19 CDKN2A p.His98Gln VAR_001459
20 CDKN2A p.Arg99Pro VAR_001460 rs754806883
21 CDKN2A p.Ala100Leu VAR_001462
22 CDKN2A p.Gly101Trp VAR_001464 rs104894094
23 CDKN2A p.Arg107Cys VAR_001466 rs155465402
24 CDKN2A p.Leu117Met VAR_001471
25 CDKN2A p.Ala118Thr VAR_001472 rs155465396
26 CDKN2A p.Val126Asp VAR_001479 rs104894098
27 CDKN2A p.Arg87Trp VAR_012317 rs749714198
28 CDKN2A p.Leu94Gln VAR_023604
29 CDKN2A p.Gly122Arg VAR_035069 rs113798404
30 CDKN2A p.Gly35Val VAR_058551 rs746834149
31 CDKN2A p.Gly67Arg VAR_058553 rs758389471
32 CDKN2A p.Asp74Tyr VAR_058555 rs760640852
33 CDKN2A p.Thr77Pro VAR_058556
34 CDKN2A p.Arg80Pro VAR_058557 rs105751988
35 CDKN2A p.Pro81Thr VAR_058558 rs133482876

Cosmic variations for Melanoma, Cutaneous Malignant 2:

9 (show all 46)
# Cosmic Mut ID Gene Symbol COSMIC Disease Classification
(Primary site, Site subtype, Primary histology, Histology subtype)		 Mutation CDS Mutation AA GRCh38 Location Conf
1 COSM97107326 NRAS skin,ear,malignant melanoma,NS c.181C>A p.Q61K 1:114713909-114713909 6
2 COSM93665204 NF1 skin,ear,malignant melanoma,NS c.3652C>T p.Q1218* 17:31233157-31233157 6
3 COSM93539965 NF1 skin,ear,malignant melanoma,NS c.3097C>T p.Q1033* 17:31230366-31230366 6
4 COSM93692305 NF1 skin,ear,malignant melanoma,NS c.3097C>T p.Q1033* 17:31230366-31230366 6
5 COSM93519256 NF1 skin,ear,malignant melanoma,NS c.3652C>T p.Q1218* 17:31233157-31233157 6
6 COSM88321369 KIT skin,eye,malignant melanoma,NS c.1459G>A p.G487S 4:54725969-54725969 6
7 COSM99100400 GRIN2A skin,ear,malignant melanoma,NS c.3217G>A p.E1073K 16:9764327-9764327 6
8 COSM99100596 GRIN2A skin,ear,malignant melanoma,NS c.1959G>A p.M653I 16:9829471-9829471 6
9 COSM89609735 GRIN2A skin,ear,malignant melanoma,NS c.1959G>A p.M653I 16:9829471-9829471 6
10 COSM135206415 GRIN2A skin,ear,malignant melanoma,NS c.3217G>A p.E1073K 16:9764327-9764327 6
11 COSM135217389 GRIN2A skin,ear,malignant melanoma,NS c.3773-19C>T p.? 16:9763447-9763447 6
12 COSM131440106 GRIN2A skin,ear,malignant melanoma,NS c.1548G>A p.M516I 16:9829471-9829471 6
13 COSM89609531 GRIN2A skin,ear,malignant melanoma,NS c.3217G>A p.E1073K 16:9764327-9764327 6
14 COSM135206628 GRIN2A skin,ear,malignant melanoma,NS c.1959G>A p.M653I 16:9829471-9829471 6
15 COSM89621238 GRIN2A skin,ear,malignant melanoma,NS c.4097C>T p.P1366L 16:9763447-9763447 6
16 COSM99112008 GRIN2A skin,ear,malignant melanoma,NS c.4097C>T p.P1366L 16:9763447-9763447 6
17 COSM131447592 GRIN2A skin,ear,malignant melanoma,NS c.3362-19C>T p.? 16:9763447-9763447 6
18 COSM131440017 GRIN2A skin,ear,malignant melanoma,NS c.2806G>A p.E936K 16:9764327-9764327 6
19 COSM97223158 CNR1 skin,ear,malignant melanoma,NS c.103+42C>T p.? 6:88145130-88145130 6
20 COSM152018575 CNR1 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
21 COSM108059286 CNR1 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
22 COSM117327995 CNR1 skin,ear,malignant melanoma,NS c.63-17C>T p.? 6:88145130-88145130 6
23 COSM96983478 CNR1 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
24 COSM96990932 CNR1 skin,ear,malignant melanoma,NS c.145C>T p.P49S 6:88145130-88145130 6
25 COSM87493313 CHRM3 skin,ear,malignant melanoma,NS c.1741T>A p.F581I 1:239909192-239909192 6
26 COSM144455643 CHRM3 skin,ear,malignant melanoma,NS c.1741T>A p.F581I 1:239909192-239909192 6
27 COSM149414554 BRAF skin,ear,malignant melanoma,NS c.1910T>G p.L637R 7:140753345-140753345 6
28 COSM150563774 BRAF skin,ear,malignant melanoma,NS c.1799T>A p.V600E 7:140753336-140753336 6
29 COSM150564452 BRAF skin,ear,malignant melanoma,NS c.1801A>G p.K601E 7:140753334-140753334 6
30 COSM88812698 BRAF skin,ear,malignant melanoma,NS c.1910T>A p.L637Q 7:140753345-140753345 6
31 COSM118795694 BRAF skin,ear,malignant melanoma,NS c.1790T>A p.L597Q 7:140753345-140753345 6
32 COSM88803061 BRAF skin,ear,malignant melanoma,NS c.1919T>A p.V640E 7:140753336-140753336 6
33 COSM118813778 BRAF skin,ear,malignant melanoma,NS c.1790T>G p.L597R 7:140753345-140753345 6
34 COSM88806346 BRAF skin,ear,malignant melanoma,NS c.1900G>A p.D634N 7:140753355-140753355 6
35 COSM118790577 BRAF skin,ear,malignant melanoma,NS c.1780G>A p.D594N 7:140753355-140753355 6
36 COSM150570620 BRAF skin,ear,malignant melanoma,NS c.1790T>A p.L597Q 7:140753345-140753345 6
37 COSM150565869 BRAF skin,ear,malignant melanoma,NS c.1780G>A p.D594N 7:140753355-140753355 6
38 COSM118787231 BRAF skin,ear,malignant melanoma,NS c.1799T>A p.V600E 7:140753336-140753336 6
39 COSM150585368 BRAF skin,ear,malignant melanoma,NS c.1790T>G p.L597R 7:140753345-140753345 6
40 COSM149385292 BRAF skin,ear,malignant melanoma,NS c.1919T>A p.V640E 7:140753336-140753336 6
41 COSM149386940 BRAF skin,ear,malignant melanoma,NS c.1921A>G p.K641E 7:140753334-140753334 6
42 COSM149388933 BRAF skin,ear,malignant melanoma,NS c.1900G>A p.D634N 7:140753355-140753355 6
43 COSM88834639 BRAF skin,ear,malignant melanoma,NS c.1910T>G p.L637R 7:140753345-140753345 6
44 COSM118788384 BRAF skin,ear,malignant melanoma,NS c.1801A>G p.K601E 7:140753334-140753334 6
45 COSM149394818 BRAF skin,ear,malignant melanoma,NS c.1910T>A p.L637Q 7:140753345-140753345 6
46 COSM88804430 BRAF skin,ear,malignant melanoma,NS c.1921A>G p.K641E 7:140753334-140753334 6
Sources

Expression for Melanoma, Cutaneous Malignant 2

About this section
Search GEO for disease gene expression data for Melanoma, Cutaneous Malignant 2.
Sources

Pathways for Melanoma, Cutaneous Malignant 2

About this section
Sources

GO Terms for Melanoma, Cutaneous Malignant 2

About this section
Sources

Sources for Melanoma, Cutaneous Malignant 2

About this section
3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
20 GARD
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
53 NINDS
54 Novoseek
56 OMIM via Orphanet
57 OMIM® (Updated 05-Mar-2021)
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
The MalaCards human disease database index: 1-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Content
Loading form....