Melanoma, Cutaneous Malignant 2 disease: Malacards - Research Articles, Drugs, Genes, Clinical Trials

CMM2 MCID: MLN067 MIFTS: 29	Melanoma, Cutaneous Malignant 2 (CMM2) Categories: Cancer diseases, Genetic diseases, Nephrological diseases, Rare diseases, Skin diseases
Genes Variations Tissues Related diseases Publications Symptoms & Phenotypes Expand all tables

Sources

Aliases & Classifications for Melanoma, Cutaneous Malignant 2

MalaCards integrated aliases for Melanoma, Cutaneous Malignant 2:

Name: Melanoma, Cutaneous Malignant 2 ⁵⁶ ⁷³

Cutaneous Malignant Melanoma 2 ⁷³ ²⁹ ⁶

Melanoma, Cutaneous Malignant, 2 ⁵⁶ ¹³

Cmm2 ⁵⁶ ⁷³

Melanoma, Cutaneous, Malignant, Susceptibility to, Type 2 ³⁹

Melanoma, Cutaneous Malignant, Susceptibility to, 2 ⁵⁶

Characteristics:

OMIM:

⁵⁶

Inheritance:
autosomal dominant

HPO:

³¹

melanoma, cutaneous malignant 2:
Inheritance autosomal dominant inheritance

Classifications:

MalaCards categories:
Global: Genetic diseases Rare diseases Cancer diseases
Anatomical: Skin diseases Nephrological diseases

See all MalaCards categories (disease lists)

External Ids:

OMIM ⁵⁶ 155601

OMIM Phenotypic Series ⁵⁶ PS155600

MeSH ⁴³ D008545

MedGen ⁴¹ C1835044

SNOMED-CT via HPO ⁶⁸ 2092003 263681008 372244006

Sources

Summaries for Melanoma, Cutaneous Malignant 2

OMIM : ⁵⁶ Malignant melanoma is a neoplasm of pigment-producing cells called melanocytes that occurs most often in the skin, but may also occur in the eyes, ears, gastrointestinal tract, leptomeninges, and oral and genital mucous membranes (summary by Habif, 2010). For a discussion of genetic heterogeneity of cutaneous malignant melanoma, see CMM1 (155600). (155601)

MalaCards based summary : Melanoma, Cutaneous Malignant 2, also known as cutaneous malignant melanoma 2, is related to lentigines and nodular malignant melanoma. An important gene associated with Melanoma, Cutaneous Malignant 2 is CDKN2A (Cyclin Dependent Kinase Inhibitor 2A). Affiliated tissues include skin, eye and prostate, and related phenotype is cutaneous melanoma.

UniProtKB/Swiss-Prot : ⁷³ Melanoma, cutaneous malignant 2: A malignant neoplasm of melanocytes, arising de novo or from a pre- existing benign nevus, which occurs most often in the skin but also may involve other sites.

Sources

Related Diseases for Melanoma, Cutaneous Malignant 2

Diseases in the Melanoma, Cutaneous Malignant 1 family:

Melanoma, Cutaneous Malignant 2	Melanoma, Cutaneous Malignant 4
Melanoma, Cutaneous Malignant 3	Melanoma, Cutaneous Malignant 7
Melanoma, Cutaneous Malignant 5	Melanoma, Cutaneous Malignant 6
Melanoma, Cutaneous Malignant 8	Melanoma, Cutaneous Malignant 9
Melanoma, Cutaneous Malignant 10

Diseases related to Melanoma, Cutaneous Malignant 2 via text searches within MalaCards or GeneCards Suite gene sharing:

#	Related Disease	Score
1	lentigines	9.9
2	nodular malignant melanoma	9.9
3	acral lentiginous melanoma	9.9
4	lentigo maligna melanoma	9.9
5	superficial spreading melanoma	9.9

Graphical network of the top 20 diseases related to Melanoma, Cutaneous Malignant 2:

Sources

Symptoms & Phenotypes for Melanoma, Cutaneous Malignant 2

Human phenotypes related to Melanoma, Cutaneous Malignant 2:

³¹

#	Description	HPO Frequency	HPO Source Accession
1	cutaneous melanoma ³¹		HP:0012056

Symptoms via clinical synopsis from OMIM:

⁵⁶

Neoplasia:
malignant melanoma

Laboratory Abnormalities:
frequent deletions of chromosome 9 in melanoma

Clinical features from OMIM:

155601

Sources

Drugs & Therapeutics for Melanoma, Cutaneous Malignant 2

Search Clinical Trials , NIH Clinical Center for Melanoma, Cutaneous Malignant 2

Sources

Genetic Tests for Melanoma, Cutaneous Malignant 2

Genetic tests related to Melanoma, Cutaneous Malignant 2:

#	Genetic test	Affiliating Genes
1	Cutaneous Malignant Melanoma 2 ²⁹	CDKN2A

Sources

Anatomical Context for Melanoma, Cutaneous Malignant 2

MalaCards organs/tissues related to Melanoma, Cutaneous Malignant 2:

⁴⁰

Skin, Eye, Prostate

Sources

Publications for Melanoma, Cutaneous Malignant 2

Articles related to Melanoma, Cutaneous Malignant 2:

(show top 50) (show all 72)

#	Title	Authors	PMID	Year
1	Novel and recurrent p14 mutations in Italian familial melanoma. ⁵⁶ ⁶	Binni F...Grammatico P	20132244	2010
2	New founder germline mutations of CDKN2A in melanoma-prone families and multiple primary melanoma development in a patient receiving levodopa treatment. ⁵⁶ ⁶	Kannengiesser C...Bressac-de Paillerets B	17492760	2007
3	A cell cycle regulator potentially involved in genesis of many tumor types. ⁵⁶ ⁶	Kamb A...Skolnick MH	8153634	1994
4	American Society of Clinical Oncology Expert Statement: collection and use of a cancer family history for oncology providers. ⁶	Lu KH...American Society of Clinical Oncology	24493721	2014
5	Indication for CDKN2A-mutation analysis in familial pancreatic cancer families without melanomas. ⁶	Harinck F...Bruno MJ	22636603	2012
6	Melanoma risk for CDKN2A mutation carriers who are relatives of population-based case carriers in Australia and the UK. ⁵⁶	Cust AE...Jenkins MA	21325014	2011
7	Predicting functional significance of cancer-associated p16(INK4a) mutations in CDKN2A. ⁶	McKenzie HA...Rizos H	20340136	2010
8	Genome-wide association study identifies three loci associated with melanoma risk. ⁵⁶	Bishop DT...Bishop JA	19578364	2009
9	Genome-wide association study identifies variants at 9p21 and 22q13 associated with development of cutaneous nevi. ⁵⁶	Falchi M...Spector TD	19578365	2009
10	New common variants affecting susceptibility to basal cell carcinoma. ⁶	Stacey SN...Stefansson K	19578363	2009
11	SLC45A2: a novel malignant melanoma-associated gene. ⁶	Fernandez LP...Ribas G	18563784	2008
12	Variants of the MATP/SLC45A2 gene are protective for melanoma in the French population. ⁶	Guedj M...MelanCohort Investigators	18683857	2008
13	CDKN2A mutations and melanoma risk in the Icelandic population. ⁶	Goldstein AM...Stefansson K	18178632	2008
14	A genomewide association study of skin pigmentation in a South Asian population. ⁶	Stokowski RP...Cox DR	17999355	2007
15	Distribution of the F374 allele of the SLC45A2 (MATP) gene and founder-haplotype analysis. ⁶	Yuasa I...Henke J	17044855	2006
16	Melanoma. ⁵⁶	Miller AJ...Mihm MC	16822996	2006
17	Familial melanoma, pancreatic cancer and germline CDKN2A mutations. ⁶	Goldstein AM	15146471	2004
18	A single Mediterranean, possibly Jewish, origin for the Val59Gly CDKN2A mutation in four melanoma-prone families. ⁶	Yakobson E...Bressac-de Paillerets B	12700603	2003
19	Hereditary p16-Leiden mutation in a patient with multiple head and neck tumors. ⁶	Schneider-Stock R...Roessner A	12549483	2003
20	Germline mutation of ARF in a melanoma kindred. ⁶	Hewitt C...Thakker N	12019208	2002
21	High prevalence of the G101W germline mutation in the CDKN2A (P16(ink4a)) gene in 62 Italian malignant melanoma families. ⁶	Mantelli M...Gruppo Italiano Studi Epidemiologici in Dermatologia	11807902	2002
22	Sporadic multiple primary melanoma cases: CDKN2A germline mutations with a founder effect. ⁶	Auroy S...French Hereditary Melanoma Study Group	11579459	2001
23	A deep intronic mutation in CDKN2A is associated with disease in a subset of melanoma pedigrees. ⁶	Harland M...Bishop JA	11726555	2001
24	A common founder for the V126D CDKN2A mutation in seven North American melanoma-prone families. ⁶	Goldstein AM...Struewing JP	11506491	2001
25	Haplotype analysis and age estimation of the 113insR CDKN2A founder mutation in Swedish melanoma families. ⁶	Hashemi J...Borg A	11319798	2001
26	Risk of developing pancreatic cancer in families with familial atypical multiple mole melanoma associated with a specific 19 deletion of p16 (p16-Leiden). ⁶	Vasen HF...Bergman W	10956390	2000
27	A single genetic origin for the G101W CDKN2A mutation in 20 melanoma-prone families. ⁶	Ciotti P...Goldstein AM	10869234	2000
28	CDKN2A mutations in Spanish cutaneous malignant melanoma families and patients with multiple melanomas and other neoplasia. ⁶	Ruiz A...Castel T	10874641	1999
29	A locus linked to p16 modifies melanoma risk in Dutch familial atypical multiple mole melanoma (FAMMM) syndrome families. ⁶	van der Velden PA...Gruis NA	10400925	1999
30	Mutation of the CDKN2A 5' UTR creates an aberrant initiation codon and predisposes to melanoma. ⁶	Liu L...Hogg D	9916806	1999
31	CDKN2A germline mutations in U.K. patients with familial melanoma and multiple primary melanomas. ⁶	MacKie RM...Connor JM	9699728	1998
32	CDKN2A mutations in multiple primary melanomas. ⁶	Monzon J...Lassam NJ	9516223	1998
33	Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France. The French Familial Melanoma Study Group. ⁶	Soufir N...Bressac-de Paillerets B	9425228	1998
34	Haplotype analysis of two recurrent CDKN2A mutations in 10 melanoma families: evidence for common founders and independent mutations. ⁶	Pollock PM...Hayward NK	9603434	1998
35	Analysis of the CDKN2A, CDKN2B and CDK4 genes in 48 Australian melanoma kindreds. ⁶	Flores JF...Fountain JW	9416844	1997
36	Germline mutations of the CDKN2 gene in UK melanoma families. ⁶	Harland M...Bishop JN	9328469	1997
37	Novel germline p16 mutation in familial malignant melanoma in southern Sweden. ⁶	Borg A...Ingvar C	8653684	1996
38	Two-locus linkage analysis of cutaneous malignant melanoma/dysplastic nevi. ⁵⁶	Goldstein AM...Tucker MA	8651266	1996
39	The current situation with regard to human melanoma and genetic inferences. ⁶	Hayward NK	8727306	1996
40	Familial melanoma and pancreatic cancer. Ligurian Skin Tumor Study Group. ⁶	Ciotti P...Bianchi-Scarra G	8552158	1996
41	Analysis of the p16 gene, CDKN2, in 17 Australian melanoma kindreds. ⁶	Holland EA...Mann GJ	8570179	1995
42	Mutations of the CDKN2/p16INK4 gene in Australian melanoma kindreds. ⁶	Walker GJ...Fountain JW	8595405	1995
43	Brief report: a familial syndrome of pancreatic cancer and melanoma with a mutation in the CDKN2 tumor-suppressor gene. ⁶	Whelan AJ...Goodfellow PJ	7666917	1995
44	Chromosome 9p deletions in cutaneous malignant melanoma tumors: the minimal deleted region involves markers outside the p16 (CDKN2) gene. ⁵⁶	Puig S...Estivill X	7668266	1995
45	Germline p16INK4A mutation and protein dysfunction in a family with inherited melanoma. ⁶	Liu L...Hogg D	7624155	1995
46	Mutational analysis of CDKN2 (CDK4I/MTS1) gene in tissues and cell lines of human prostate cancer. ⁶	Komiya A...Shimazaki J	7559077	1995
47	Homozygotes for CDKN2 (p16) germline mutation in Dutch familial melanoma kindreds. ⁶	Gruis NA...Frants RR	7670475	1995
48	Genetic heterogeneity in familial malignant melanoma. ⁶	MacGeoch C...Spurr NK	7881419	1994
49	Genetics of seven Dutch familial atypical multiple mole-melanoma syndrome families: a review of linkage results including chromosomes 1 and 9. ⁵⁶	Bergman W...Frants RR	7963673	1994
50	Analysis of the p16 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. ⁵⁶	Kamb A...Weaver-Feldhaus J	7987388	1994

Sources

Genes for Melanoma, Cutaneous Malignant 2

Genes/enhancers related to Melanoma, Cutaneous Malignant 2 (1 elite genes):

- Elite gene

- Cancer Census gene in COSMIC

#	Symbol	Description	Category	Score	Evidence	PubmedIds
1	CDKN2A	Cyclin Dependent Kinase Inhibitor 2A	Protein Coding	1394.21	Molecular basis known ⁵⁶ Pathogenic ⁶ Causative variation ⁷³ Genetic Tests ²⁹ Susceptibility factor ⁵⁶ Risk factor ⁶ GeneCards inferred via : Disorders Variants (show sections)	8727306 9328469 11319798 (more) 11579459 11506491 10956390 10869234 11726555 10874641 11807902 15146471 12019208 10400925 9425228 9416844 9603434 9699728 8012957 7624155 18178632 7881419 8653684 7987387 17492760 8153634 8570179 7559077 20132244 12700603 7670475 9916806 9516223 24493721 22636603 8552158 8595405 20340136 12549483 7666917
1	CDKN2A::GH09J021974	TSS distance: +20.7kb Elite enhancer with elite association with CDKN2A			Curated enhancer-disease association ²³ ( 27569544 )	9916806

Sources

Variations for Melanoma, Cutaneous Malignant 2

ClinVar genetic disease variations for Melanoma, Cutaneous Malignant 2:

⁶ (show all 36) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎

#	Gene	Name	Type	Significance	ClinVarId	dbSNP ID	GRCh37 Pos	GRCh38 Pos
1	CDKN2A	NM_000077.4(CDKN2A):c.238C>T (p.Arg80Ter)	SNV	Likely pathogenic,risk factor	9409	rs121913388	9:21971120-21971120	9:21971121-21971121
2	CDKN2A	NM_000077.4(CDKN2A):c.226_244del (p.Ala76fs)	deletion	Pathogenic,risk factor	9410	rs587776716	9:21971114-21971132	9:21971115-21971133
3	CDKN2A	NM_000077.4(CDKN2A):c.-34G>T	SNV	Pathogenic	182414	rs1800586	9:21974860-21974860	9:21974861-21974861
4	CDKN2A	NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile)	SNV	Pathogenic	9414	rs104894095	9:21971199-21971199	9:21971200-21971200
5	CDKN2A	NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp)	SNV	Pathogenic	9420	rs104894098	9:21970981-21970981	9:21970982-21970982
6	CDKN2A	NM_000077.4(CDKN2A):c.339_340delGCinsCT (p.Pro114Ser)	indel	Pathogenic	9424	rs387906410	9:21971018-21971019	9:21971019-21971020
7	CDKN2A	NM_000077.4(CDKN2A):c.260G>C (p.Arg87Pro)	SNV	Pathogenic	236984	rs878853647	9:21971098-21971098	9:21971099-21971099
8	CDKN2A	NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup)	short repeat	Pathogenic/Likely pathogenic	135827	rs587780668	9:21974794-21974795	9:21974795-21974796
9	CDKN2A	NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile)	SNV	Pathogenic/Likely pathogenic	9425	rs104894109	9:21971191-21971191	9:21971192-21971192
10	CDKN2A	NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly)	SNV	Pathogenic/Likely pathogenic	9423	rs104894099	9:21971182-21971182	9:21971183-21971183
11	CDKN2A	NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro)	SNV	Pathogenic/Likely pathogenic	9415	rs104894097	9:21974756-21974756	9:21974757-21974757
12	CDKN2A	CDKN2A, -34G-T	SNV	risk factor	9417
13	CDKN2A	CDKN2A, IVS2, A-G, -105	SNV	risk factor	9421
14	CDKN2A	NM_000077.4(CDKN2A):c.364G>C (p.Gly122Arg)	SNV	risk factor	9422	rs113798404	9:21970994-21970994	9:21970995-21970995
15	CDKN2A	NM_058195.3(CDKN2A):c.184_186AGA[3] (p.Arg63dup)	short repeat	risk factor	9413	rs1563902635	9:21994141-21994142	9:21994142-21994143
16	CDKN2A	NM_000077.4(CDKN2A):c.265G>A (p.Gly89Ser)	SNV	risk factor	9408	rs137854597	9:21971093-21971093	9:21971094-21971094
17	CDKN2A	CDKN2A, 6-BP DEL, NT363	deletion	risk factor	9411
18	CDKN2A	CDKN2A, IVS1BDS, A-G, +1	SNV	risk factor	30043
19	CDKN2A	NM_058195.3(CDKN2A):c.161G>A (p.Arg54His)	SNV	risk factor	30044		9:21994170-21994170	9:21994171-21994171
20	CDKN2A	NM_000077.4(CDKN2A):c.150+37G>C	SNV	Conflicting interpretations of pathogenicity	41573	rs45456595	9:21974640-21974640	9:21974641-21974641
21	CDKN2A	NM_000077.4(CDKN2A):c.369T>A (p.His123Gln)	SNV	Conflicting interpretations of pathogenicity	127526	rs6413463	9:21970989-21970989	9:21970990-21970990
22	CDKN2A	NM_000077.4(CDKN2A):c.-34G>A	SNV	Conflicting interpretations of pathogenicity	379882	rs1800586	9:21974860-21974860	9:21974861-21974861
23	CDKN2A	NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp)	SNV	Conflicting interpretations of pathogenicity	9412	rs104894094	9:21971057-21971057	9:21971058-21971058
24	CDKN2A	NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp)	SNV	Conflicting interpretations of pathogenicity	9426	rs137854599	9:21971092-21971092	9:21971093-21971093
25	CDKN2A	NM_000077.4(CDKN2A):c.365G>T (p.Gly122Val)	SNV	Uncertain significance	182419	rs373291490	9:21970993-21970993	9:21970994-21970994
26	CDKN2A	NM_058195.3(CDKN2A):c.194-3611_194-3588del	short repeat	Uncertain significance	216277	rs587780668	9:21974795-21974818	9:21974796-21974819
27	CDKN2A	NM_000077.4(CDKN2A):c.315C>A (p.Asp105Glu)	SNV	Uncertain significance	406702	rs763269347	9:21971043-21971043	9:21971044-21971044
28	CDKN2A	NM_000077.4(CDKN2A):c.160A>C (p.Met54Leu)	SNV	Uncertain significance	463486	rs201314211	9:21971198-21971198	9:21971199-21971199
29	CDKN2A	NM_000077.4(CDKN2A):c.294C>T (p.His98=)	SNV	Uncertain significance	463515	rs752685118	9:21971064-21971064	9:21971065-21971065
30	CDKN2A	NM_000077.4(CDKN2A):c.170C>A (p.Ala57Asp)	SNV	Uncertain significance	483325	rs372266620	9:21971188-21971188	9:21971189-21971189
31	CDKN2A	NM_058195.3(CDKN2A):c.160C>A (p.Arg54Ser)	SNV	Uncertain significance	487012	rs896054565	9:21994171-21994171	9:21994172-21994172
32	CDKN2A	NM_000077.4(CDKN2A):c.150+82A>G	SNV	Uncertain significance	584731	rs1231900408	9:21974595-21974595	9:21974596-21974596
33	CDKN2A	NM_000077.4(CDKN2A):c.148C>A (p.Gln50Lys)	SNV	Uncertain significance	584732	rs864622636	9:21974679-21974679	9:21974680-21974680
34	CDKN2A	NM_000077.4(CDKN2A):c.32C>T (p.Pro11Leu)	SNV	Uncertain significance	584734	rs1374664673	9:21974795-21974795	9:21974796-21974796
35	CDKN2A	NM_058195.3(CDKN2A):c.35G>A (p.Arg12Gln)	SNV	Uncertain significance	584735	rs201877069	9:21994296-21994296	9:21994297-21994297
36	CDKN2A	NM_000077.4(CDKN2A):c.122C>A (p.Pro41Gln)	SNV	Uncertain significance	141111	rs373407950	9:21974705-21974705	9:21974706-21974706

UniProtKB/Swiss-Prot genetic disease variations for Melanoma, Cutaneous Malignant 2:

⁷³ (show all 35)

#	Symbol	AA change	Variation ID	SNP ID
1	CDKN2A	p.Arg24Cys	VAR_001413
2	CDKN2A	p.Arg24Pro	VAR_001414	rs104894097
3	CDKN2A	p.Leu32Pro	VAR_001416	rs878853650
4	CDKN2A	p.Gly35Ala	VAR_001418	rs746834149
5	CDKN2A	p.Gly35Glu	VAR_001419	rs746834149
6	CDKN2A	p.Pro48Leu	VAR_001420
7	CDKN2A	p.Gln50Arg	VAR_001423	rs587778189
8	CDKN2A	p.Met53Ile	VAR_001424	rs104894095
9	CDKN2A	p.Val59Gly	VAR_001427	rs104894099
10	CDKN2A	p.Leu62Pro	VAR_001430
11	CDKN2A	p.Ala68Leu	VAR_001432	rs876658534
12	CDKN2A	p.Asn71Lys	VAR_001437
13	CDKN2A	p.Asp84Tyr	VAR_001449	rs11552822
14	CDKN2A	p.Arg87Pro	VAR_001451	rs878853647
15	CDKN2A	p.Gly89Asp	VAR_001453	rs137854599
16	CDKN2A	p.Gly89Ser	VAR_001454	rs137854597
17	CDKN2A	p.Leu97Arg	VAR_001457
18	CDKN2A	p.His98Pro	VAR_001458
19	CDKN2A	p.His98Gln	VAR_001459
20	CDKN2A	p.Arg99Pro	VAR_001460
21	CDKN2A	p.Ala100Leu	VAR_001462
22	CDKN2A	p.Gly101Trp	VAR_001464	rs104894094
23	CDKN2A	p.Arg107Cys	VAR_001466
24	CDKN2A	p.Leu117Met	VAR_001471
25	CDKN2A	p.Ala118Thr	VAR_001472	rs155465396
26	CDKN2A	p.Val126Asp	VAR_001479	rs104894098
27	CDKN2A	p.Arg87Trp	VAR_012317	rs749714198
28	CDKN2A	p.Leu94Gln	VAR_023604
29	CDKN2A	p.Gly122Arg	VAR_035069	rs113798404
30	CDKN2A	p.Gly35Val	VAR_058551	rs746834149
31	CDKN2A	p.Gly67Arg	VAR_058553	rs758389471
32	CDKN2A	p.Asp74Tyr	VAR_058555	rs760640852
33	CDKN2A	p.Thr77Pro	VAR_058556
34	CDKN2A	p.Arg80Pro	VAR_058557	rs105751988
35	CDKN2A	p.Pro81Thr	VAR_058558

Cosmic variations for Melanoma, Cutaneous Malignant 2:

⁹ (show all 46)

#	Cosmic Mut ID	Gene Symbol	COSMIC Disease Classification (Primary site, Site subtype, Primary histology, Histology subtype)	Mutation CDS	Mutation AA	GRCh38 Location	Conf
1	COSM97107326	NRAS	skin,ear,malignant melanoma,NS	c.181C>A	p.Q61K	1:114713909-114713909	6
2	COSM93665204	NF1	skin,ear,malignant melanoma,NS	c.3652C>T	p.Q1218*	17:31233157-31233157	6
3	COSM93692305	NF1	skin,ear,malignant melanoma,NS	c.3097C>T	p.Q1033*	17:31230366-31230366	6
4	COSM88321369	KIT	skin,eye,malignant melanoma,NS	c.1459G>A	p.G487S	4:54725969-54725969	6
5	COSM99100400	GRIN2A	skin,ear,malignant melanoma,NS	c.3217G>A	p.E1073K	16:9764327-9764327	6
6	COSM99100596	GRIN2A	skin,ear,malignant melanoma,NS	c.1959G>A	p.M653I	16:9829471-9829471	6
7	COSM99112008	GRIN2A	skin,ear,malignant melanoma,NS	c.4097C>T	p.P1366L	16:9763447-9763447	6
8	COSM96990932	CNR1	skin,ear,malignant melanoma,NS	c.145C>T	p.P49S	6:88145130-88145130	6
9	COSM87493313	CHRM3	skin,ear,malignant melanoma,NS	c.1741T>A	p.F581I	1:239909192-239909192	6
10	COSM150563774	BRAF	skin,ear,malignant melanoma,NS	c.1799T>A	p.V600E	7:140753336-140753336	6
11	COSM150564452	BRAF	skin,ear,malignant melanoma,NS	c.1801A>G	p.K601E	7:140753334-140753334	6
12	COSM150570620	BRAF	skin,ear,malignant melanoma,NS	c.1790T>A	p.L597Q	7:140753345-140753345	6
13	COSM150565869	BRAF	skin,ear,malignant melanoma,NS	c.1780G>A	p.D594N	7:140753355-140753355	6
14	COSM150585368	BRAF	skin,ear,malignant melanoma,NS	c.1790T>G	p.L597R	7:140753345-140753345	6
15	COSM149414554		skin,ear,malignant melanoma,NS	c.1910T>G	p.L637R	7:140753345-140753345	6
16	COSM88812698		skin,ear,malignant melanoma,NS	c.1910T>A	p.L637Q	7:140753345-140753345	6
17	COSM118795694		skin,ear,malignant melanoma,NS	c.1790T>A	p.L597Q	7:140753345-140753345	6
18	COSM88803061		skin,ear,malignant melanoma,NS	c.1919T>A	p.V640E	7:140753336-140753336	6
19	COSM97223158		skin,ear,malignant melanoma,NS	c.103+42C>T	p.?	6:88145130-88145130	6
20	COSM118813778		skin,ear,malignant melanoma,NS	c.1790T>G	p.L597R	7:140753345-140753345	6
21	COSM88806346		skin,ear,malignant melanoma,NS	c.1900G>A	p.D634N	7:140753355-140753355	6
22	COSM118790577		skin,ear,malignant melanoma,NS	c.1780G>A	p.D594N	7:140753355-140753355	6
23	COSM89609735		skin,ear,malignant melanoma,NS	c.1959G>A	p.M653I	16:9829471-9829471	6
24	COSM144455643		skin,ear,malignant melanoma,NS	c.1741T>A	p.F581I	1:239909192-239909192	6
25	COSM152018575		skin,ear,malignant melanoma,NS	c.145C>T	p.P49S	6:88145130-88145130	6
26	COSM93539965		skin,ear,malignant melanoma,NS	c.3097C>T	p.Q1033*	17:31230366-31230366	6
27	COSM118787231		skin,ear,malignant melanoma,NS	c.1799T>A	p.V600E	7:140753336-140753336	6
28	COSM108059286		skin,ear,malignant melanoma,NS	c.145C>T	p.P49S	6:88145130-88145130	6
29	COSM135206415		skin,ear,malignant melanoma,NS	c.3217G>A	p.E1073K	16:9764327-9764327	6
30	COSM117327995		skin,ear,malignant melanoma,NS	c.63-17C>T	p.?	6:88145130-88145130	6
31	COSM135217389		skin,ear,malignant melanoma,NS	c.3773-19C>T	p.?	16:9763447-9763447	6
32	COSM131440106		skin,ear,malignant melanoma,NS	c.1548G>A	p.M516I	16:9829471-9829471	6
33	COSM89609531		skin,ear,malignant melanoma,NS	c.3217G>A	p.E1073K	16:9764327-9764327	6
34	COSM135206628		skin,ear,malignant melanoma,NS	c.1959G>A	p.M653I	16:9829471-9829471	6
35	COSM149385292		skin,ear,malignant melanoma,NS	c.1919T>A	p.V640E	7:140753336-140753336	6
36	COSM96983478		skin,ear,malignant melanoma,NS	c.145C>T	p.P49S	6:88145130-88145130	6
37	COSM149386940		skin,ear,malignant melanoma,NS	c.1921A>G	p.K641E	7:140753334-140753334	6
38	COSM89621238		skin,ear,malignant melanoma,NS	c.4097C>T	p.P1366L	16:9763447-9763447	6
39	COSM149388933		skin,ear,malignant melanoma,NS	c.1900G>A	p.D634N	7:140753355-140753355	6
40	COSM88834639		skin,ear,malignant melanoma,NS	c.1910T>G	p.L637R	7:140753345-140753345	6
41	COSM118788384		skin,ear,malignant melanoma,NS	c.1801A>G	p.K601E	7:140753334-140753334	6
42	COSM131447592		skin,ear,malignant melanoma,NS	c.3362-19C>T	p.?	16:9763447-9763447	6
43	COSM93519256		skin,ear,malignant melanoma,NS	c.3652C>T	p.Q1218*	17:31233157-31233157	6
44	COSM149394818		skin,ear,malignant melanoma,NS	c.1910T>A	p.L637Q	7:140753345-140753345	6
45	COSM88804430		skin,ear,malignant melanoma,NS	c.1921A>G	p.K641E	7:140753334-140753334	6
46	COSM131440017		skin,ear,malignant melanoma,NS	c.2806G>A	p.E936K	16:9764327-9764327	6

Sources

Expression for Melanoma, Cutaneous Malignant 2

Search GEO for disease gene expression data for Melanoma, Cutaneous Malignant 2.

Sources

Pathways for Melanoma, Cutaneous Malignant 2

Sources

GO Terms for Melanoma, Cutaneous Malignant 2

Sources

Sources for Melanoma, Cutaneous Malignant 2

¹ BioSystems

² BitterDB

³ CDC

⁴ Cell Signaling Technology

⁵ ClinicalTrials

⁶ ClinVar

⁷ CNVD

⁸ Cochrane Library

⁹ Cosmic

¹⁰ dbSNP

¹¹ DGIdb

¹² Disease Ontology

¹³ diseasecard

¹⁴ DiseaseEnhancer

¹⁵ DISEASES

¹⁶ DrugBank

¹⁷ EFO

¹⁸ ExPASy

¹⁹ FMA

²⁰ GeneAnalytics

²¹ GeneCards

²² GeneGo (Thomson Reuters)

²³ GeneHancer via GeneCards

²⁴ GeneReviews

²⁵ Genetics Home Reference

²⁶ GenomeRNAi

²⁷ GEO DataSets

²⁸ GO

²⁹ GTR

³⁰ HMDB

³¹ HPO

³² ICD10

³³ ICD10 via Orphanet

³⁴ ICD9CM

³⁵ IUPHAR

³⁶ KEGG

³⁷ LifeMap

³⁸ LncRNADisease

³⁹ LOVD

⁴⁰ MalaCards

⁴¹ MedGen

⁴² MedlinePlus

⁴³ MeSH

⁴⁴ MESH via Orphanet

⁴⁵ MGI

⁴⁶ miR2Disease

⁴⁷ NCBI Bookshelf

⁴⁸ NCI

⁴⁹ NCIt

⁵⁰ NDF-RT

⁵¹ NIH Clinical Center

⁵² NIH Rare Diseases

⁵³ NINDS

⁵⁴ Novoseek

⁵⁵ Novus Biologicals

⁵⁶ OMIM

⁵⁷ OMIM via Orphanet

⁵⁸ Orphanet

⁵⁹ PathCards

⁶⁰ PharmGKB

⁶¹ PubMed

⁶² PubMed Health

⁶³ QIAGEN

⁶⁴ R&D Systems

⁶⁵ Reactome

⁶⁶ Sino Biological

⁶⁷ SNOMED-CT

⁶⁸ SNOMED-CT via HPO

⁶⁹ TGDB

⁷⁰ Tocris

⁷¹ UMLS

⁷² UMLS via Orphanet

⁷³ UniProtKB/Swiss-Prot

⁷⁴ Wikipedia

Melanoma, Cutaneous Malignant 2 (CMM2)

Aliases & Classifications for Melanoma, Cutaneous Malignant 2

MalaCards integrated aliases for Melanoma, Cutaneous Malignant 2:

Characteristics:

OMIM:

HPO:

Classifications:

External Ids:

Summaries for Melanoma, Cutaneous Malignant 2

Related Diseases for Melanoma, Cutaneous Malignant 2

Diseases in the Melanoma, Cutaneous Malignant 1 family:

Diseases related to Melanoma, Cutaneous Malignant 2 via text searches within MalaCards or GeneCards Suite gene sharing:

Graphical network of the top 20 diseases related to Melanoma, Cutaneous Malignant 2:

Symptoms & Phenotypes for Melanoma, Cutaneous Malignant 2

Human phenotypes related to Melanoma, Cutaneous Malignant 2:

Symptoms via clinical synopsis from OMIM:

Clinical features from OMIM:

Drugs & Therapeutics for Melanoma, Cutaneous Malignant 2

Genetic Tests for Melanoma, Cutaneous Malignant 2

Genetic tests related to Melanoma, Cutaneous Malignant 2:

Anatomical Context for Melanoma, Cutaneous Malignant 2

MalaCards organs/tissues related to Melanoma, Cutaneous Malignant 2:

Publications for Melanoma, Cutaneous Malignant 2

Articles related to Melanoma, Cutaneous Malignant 2:

Genes for Melanoma, Cutaneous Malignant 2

Genes/enhancers related to Melanoma, Cutaneous Malignant 2 (1 elite genes):

Variations for Melanoma, Cutaneous Malignant 2

ClinVar genetic disease variations for Melanoma, Cutaneous Malignant 2:

UniProtKB/Swiss-Prot genetic disease variations for Melanoma, Cutaneous Malignant 2:

Cosmic variations for Melanoma, Cutaneous Malignant 2:

Expression for Melanoma, Cutaneous Malignant 2

Pathways for Melanoma, Cutaneous Malignant 2

GO Terms for Melanoma, Cutaneous Malignant 2

Sources for Melanoma, Cutaneous Malignant 2