FAMMMPC
MCID: MLN047
MIFTS: 30

Melanoma-Pancreatic Cancer Syndrome (FAMMMPC)

Categories: Cancer diseases, Endocrine diseases, Genetic diseases, Skin diseases

Aliases & Classifications for Melanoma-Pancreatic Cancer Syndrome

MalaCards integrated aliases for Melanoma-Pancreatic Cancer Syndrome:

Name: Melanoma-Pancreatic Cancer Syndrome 57 72 29 6 70
Familial Atypical Multiple Mole Melanoma-Pancreatic Carcinoma Syndrome 57 72
Fammmpc 57 72
Familial Atypical Multiple Mole Melanoma-Pancreatic Carcinoma Syndrome; Fammmpc 57
Syndrome, Melanoma-Pancreatic Cancer 39
Pancreatic Cancer/melanoma Syndrome 13

Characteristics:

OMIM®:

57 (Updated 05-Apr-2021)
Inheritance:
autosomal dominant


HPO:

31
melanoma-pancreatic cancer syndrome:
Inheritance autosomal dominant inheritance


Classifications:



Summaries for Melanoma-Pancreatic Cancer Syndrome

OMIM® : 57 Melanoma-pancreatic cancer syndrome is an inherited cancer predisposition syndrome in which mutation carriers have an increased risk of developing malignant melanoma and/or pancreatic cancer. Mutation carriers within families may develop either or both types of cancer (summary by Harinck et al., 2012). For background and phenotypic information on malignant melanoma and pancreatic cancer, see 155600 and 260350, respectively. (606719) (Updated 05-Apr-2021)

MalaCards based summary : Melanoma-Pancreatic Cancer Syndrome, also known as familial atypical multiple mole melanoma-pancreatic carcinoma syndrome, is related to dysplastic nevus syndrome and pancreatic cancer. An important gene associated with Melanoma-Pancreatic Cancer Syndrome is CDKN2A (Cyclin Dependent Kinase Inhibitor 2A). Affiliated tissues include breast and skin, and related phenotypes are melanoma and sarcoma

UniProtKB/Swiss-Prot : 72 Familial atypical multiple mole melanoma-pancreatic carcinoma syndrome: An inherited cancer predisposition syndrome characterized by an increased risk of developing malignant melanoma and/or pancreatic cancer. Mutation carriers within families may develop either or both types of cancer.

Related Diseases for Melanoma-Pancreatic Cancer Syndrome

Diseases related to Melanoma-Pancreatic Cancer Syndrome via text searches within MalaCards or GeneCards Suite gene sharing:

# Related Disease Score Top Affiliating Genes
1 dysplastic nevus syndrome 11.5
2 pancreatic cancer 10.1
3 tumor predisposition syndrome 10.0
4 cutaneous telangiectasia and cancer syndrome, familial 10.0
5 melanoma 10.0
6 skin melanoma 10.0
7 inherited cancer-predisposing syndrome 10.0

Graphical network of the top 20 diseases related to Melanoma-Pancreatic Cancer Syndrome:



Diseases related to Melanoma-Pancreatic Cancer Syndrome

Symptoms & Phenotypes for Melanoma-Pancreatic Cancer Syndrome

Human phenotypes related to Melanoma-Pancreatic Cancer Syndrome:

31 (show all 6)
# Description HPO Frequency HPO Source Accession
1 melanoma 31 HP:0002861
2 sarcoma 31 HP:0100242
3 pancreatic adenocarcinoma 31 HP:0006725
4 squamous cell carcinoma 31 HP:0002860
5 oropharyngeal squamous cell carcinoma 31 HP:0012182
6 pancreatic squamous cell carcinoma 31 HP:0012142

Symptoms via clinical synopsis from OMIM®:

57 (Updated 05-Apr-2021)
Neoplasia:
melanoma
sarcoma
pancreatic adenocarcinoma
oropharyngeal squamous cell carcinoma
pancreatic squamous cell carcinoma

Clinical features from OMIM®:

606719 (Updated 05-Apr-2021)

Drugs & Therapeutics for Melanoma-Pancreatic Cancer Syndrome

Search Clinical Trials , NIH Clinical Center for Melanoma-Pancreatic Cancer Syndrome

Genetic Tests for Melanoma-Pancreatic Cancer Syndrome

Genetic tests related to Melanoma-Pancreatic Cancer Syndrome:

# Genetic test Affiliating Genes
1 Melanoma-Pancreatic Cancer Syndrome 29 CDKN2A

Anatomical Context for Melanoma-Pancreatic Cancer Syndrome

MalaCards organs/tissues related to Melanoma-Pancreatic Cancer Syndrome:

40
Breast, Skin

Publications for Melanoma-Pancreatic Cancer Syndrome

Articles related to Melanoma-Pancreatic Cancer Syndrome:

(show top 50) (show all 56)
# Title Authors PMID Year
1
Indication for CDKN2A-mutation analysis in familial pancreatic cancer families without melanomas. 6 57
22636603 2012
2
Phenotypic variation in eight extended CDKN2A germline mutation familial atypical multiple mole melanoma-pancreatic carcinoma-prone families: the familial atypical mole melanoma-pancreatic carcinoma syndrome. 6 57
11815963 2002
3
Risk of developing pancreatic cancer in families with familial atypical multiple mole melanoma associated with a specific 19 deletion of p16 (p16-Leiden). 57 6
10956390 2000
4
Brief report: a familial syndrome of pancreatic cancer and melanoma with a mutation in the CDKN2 tumor-suppressor gene. 57 6
7666917 1995
5
Germline CDKN2A mutations in childhood melanoma: a case of melanoma-pancreatic cancer syndrome. 6 61
26381259 2015
6
Improving performance of multigene panels for genomic analysis of cancer predisposition. 6
26845104 2016
7
Characterization of individuals at high risk of developing melanoma in Latin America: bases for genetic counseling in melanoma. 6
26681309 2016
8
Multiple primary melanomas (MPMs) and criteria for genetic assessment: MultiMEL, a multicenter study of the Italian Melanoma Intergroup. 6
26775776 2016
9
Novel CDKN2A mutations in Austrian melanoma patients. 6
26225579 2015
10
GESPA: classifying nsSNPs to predict disease association. 6
26206375 2015
11
BRCA1, BRCA2, PALB2, and CDKN2A mutations in familial pancreatic cancer: a PACGENE study. 6
25356972 2015
12
Prevalence and predictors of germline CDKN2A mutations for melanoma cases from Australia, Spain and the United Kingdom. 6
25780468 2014
13
Familial melanoma-associated mutations in p16 uncouple its tumor-suppressor functions. 6
23190892 2013
14
Familial melanoma: clinical factors associated with germline CDKN2A mutations according to the number of patients affected by melanoma in a family. 6
22841127 2012
15
CDKN2A is the main susceptibility gene in Italian pancreatic cancer families. 57
22368299 2012
16
Comprehensive mutational analysis of CDKN2A and CDK4 in Greek patients with cutaneous melanoma. 6
21801156 2011
17
Clinical features predicting identification of CDKN2A mutations in Italian patients with familial cutaneous melanoma. 6
21893440 2011
18
Classifying variants of CDKN2A using computational and laboratory studies. 6
21462282 2011
19
Prevalence of CDKN2A mutations in pancreatic cancer patients: implications for genetic counseling. 6
21150883 2011
20
Novel CDKN2A mutation detected in Spanish melanoma pedigree. 6
20653773 2010
21
Predicting functional significance of cancer-associated p16(INK4a) mutations in CDKN2A. 6
20340136 2010
22
Functional analysis of CDKN2A/p16INK4a 5'-UTR variants predisposing to melanoma. 6
20093296 2010
23
Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy. 6
19799798 2009
24
Germline mutations in CDKN2A are infrequent in female patients with melanoma and breast cancer. 6
19571771 2009
25
Functional, structural, and genetic evaluation of 20 CDKN2A germ line mutations identified in melanoma-prone families or patients. 6
19260062 2009
26
CDKN2A mutations and MC1R variants in Italian patients with single or multiple primary melanoma. 6
18983535 2008
27
CDKN2A germline mutations in individuals with cutaneous malignant melanoma. 6
17218939 2007
28
MELPREDICT: a logistic regression model to estimate CDKN2A carrier probability. 6
16169933 2006
29
Familial melanoma, pancreatic cancer and germline CDKN2A mutations. 6
15146471 2004
30
Germline splicing mutations of CDKN2A predispose to melanoma. 6
14508519 2003
31
CDKN2A point mutations D153spl(c.457G>T) and IVS2+1G>T result in aberrant splice products affecting both p16INK4a and p14ARF. 6
12853981 2003
32
A single Mediterranean, possibly Jewish, origin for the Val59Gly CDKN2A mutation in four melanoma-prone families. 6
12700603 2003
33
Hereditary p16-Leiden mutation in a patient with multiple head and neck tumors. 6
12549483 2003
34
Geographical variation in the penetrance of CDKN2A mutations for melanoma. 6
12072543 2002
35
High prevalence of the G101W germline mutation in the CDKN2A (P16(ink4a)) gene in 62 Italian malignant melanoma families. 6
11807902 2002
36
Sporadic multiple primary melanoma cases: CDKN2A germline mutations with a founder effect. 6
11579459 2001
37
CDKN2A and CDK4 mutation analysis in Italian melanoma-prone families: functional characterization of a novel CDKN2A germ line mutation. 6
11556834 2001
38
A single genetic origin for the G101W CDKN2A mutation in 20 melanoma-prone families. 6
10869234 2000
39
Functional reassessment of P16 variants using a transfection-based assay. 6
10389768 1999
40
A locus linked to p16 modifies melanoma risk in Dutch familial atypical multiple mole melanoma (FAMMM) syndrome families. 6
10400925 1999
41
Mutation of the CDKN2A 5' UTR creates an aberrant initiation codon and predisposes to melanoma. 6
9916806 1999
42
CDKN2A germline mutations in U.K. patients with familial melanoma and multiple primary melanomas. 6
9699728 1998
43
CDKN2A mutations in multiple primary melanomas. 6
9516223 1998
44
Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France. The French Familial Melanoma Study Group. 6
9425228 1998
45
Novel germline p16(INK4) allele (Asp145Cys) in a family with multiple pancreatic carcinomas. Mutations in brief no. 148. Online. 6
10627132 1998
46
Abrogation of the Rb/p16 tumor-suppressive pathway in virtually all pancreatic carcinomas. 57
9242437 1997
47
Prevalence of germ-line mutations in p16, p19ARF, and CDK4 in familial melanoma: analysis of a clinic-based population. 6
8710906 1996
48
Familial melanoma and pancreatic cancer. Ligurian Skin Tumor Study Group. 6
8552158 1996
49
Increased risk of pancreatic cancer in melanoma-prone kindreds with p16INK4 mutations. 57
7666916 1995
50
Homozygotes for CDKN2 (p16) germline mutation in Dutch familial melanoma kindreds. 6
7670475 1995

Variations for Melanoma-Pancreatic Cancer Syndrome

ClinVar genetic disease variations for Melanoma-Pancreatic Cancer Syndrome:

6 (show top 50) (show all 92)
# Gene Name Type Significance ClinVarId dbSNP ID Position
1 CDKN2A NM_058197.4(CDKN2A):c.*149_*167del Deletion Pathogenic 9410 rs587776716 GRCh37: 9:21971114-21971132
GRCh38: 9:21971115-21971133
2 CDKN2A CDKN2A, 5-BP DUP, NT19 Duplication Pathogenic 37003 GRCh37:
GRCh38:
3 CDKN2A NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) SNV Pathogenic 9420 rs104894098 GRCh37: 9:21970981-21970981
GRCh38: 9:21970982-21970982
4 CDKN2A NM_058197.4(CDKN2A):c.*163_*176del Deletion Pathogenic 182412 rs730881675 GRCh37: 9:21971105-21971118
GRCh38: 9:21971106-21971119
5 CDKN2A NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) SNV Pathogenic 9412 rs104894094 GRCh37: 9:21971057-21971057
GRCh38: 9:21971058-21971058
6 CDKN2A NM_000077.4(CDKN2A):c.-34G>T SNV Pathogenic 182414 rs1800586 GRCh37: 9:21974860-21974860
GRCh38: 9:21974861-21974861
7 CDKN2A NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) SNV Pathogenic 9415 rs104894097 GRCh37: 9:21974756-21974756
GRCh38: 9:21974757-21974757
8 CDKN2A NM_000077.4(CDKN2A):c.-34G>T SNV Pathogenic 182414 rs1800586 GRCh37: 9:21974860-21974860
GRCh38: 9:21974861-21974861
9 CDKN2A NM_000077.4(CDKN2A):c.68G>A (p.Gly23Asp) SNV Pathogenic 420108 rs1064794292 GRCh37: 9:21974759-21974759
GRCh38: 9:21974760-21974760
10 CDKN2A NM_000077.4(CDKN2A):c.151-1G>A SNV Pathogenic 635365 rs730881677 GRCh37: 9:21971208-21971208
GRCh38: 9:21971209-21971209
11 CDKN2A NM_000077.4(CDKN2A):c.248A>G (p.His83Arg) SNV Pathogenic 376379 rs1057519881 GRCh37: 9:21971110-21971110
GRCh38: 9:21971111-21971111
12 CDKN2A NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) SNV Pathogenic/Likely pathogenic 9415 rs104894097 GRCh37: 9:21974756-21974756
GRCh38: 9:21974757-21974757
13 CDKN2A NM_000077.4(CDKN2A):c.259C>T (p.Arg87Trp) SNV Likely pathogenic 406707 rs749714198 GRCh37: 9:21971099-21971099
GRCh38: 9:21971100-21971100
14 CDKN2A NM_000077.4(CDKN2A):c.457G>T (p.Asp153Tyr) SNV Likely pathogenic 216035 rs45476696 GRCh37: 9:21970901-21970901
GRCh38: 9:21970902-21970902
15 CDKN2A NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) SNV Likely pathogenic 9423 rs104894099 GRCh37: 9:21971182-21971182
GRCh38: 9:21971183-21971183
16 CDKN2A NM_000077.4(CDKN2A):c.250G>A (p.Asp84Asn) SNV Likely pathogenic 229806 rs11552822 GRCh37: 9:21971108-21971108
GRCh38: 9:21971109-21971109
17 CDKN2A NM_000077.5(CDKN2A):c.281T>A (p.Leu94Gln) SNV Likely pathogenic 1012195 GRCh37: 9:21971077-21971077
GRCh38: 9:21971078-21971078
18 CDKN2A NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) SNV Conflicting interpretations of pathogenicity 127526 rs6413463 GRCh37: 9:21970989-21970989
GRCh38: 9:21970990-21970990
19 CDKN2A NM_000077.4(CDKN2A):c.150+37G>C SNV Conflicting interpretations of pathogenicity 41573 rs45456595 GRCh37: 9:21974640-21974640
GRCh38: 9:21974641-21974641
20 CDKN2A NM_058195.3(CDKN2A):c.62G>A (p.Arg21Lys) SNV Uncertain significance 371974 rs1057517601 GRCh37: 9:21994269-21994269
GRCh38: 9:21994270-21994270
21 CDKN2A NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) SNV Uncertain significance 127524 rs200863613 GRCh37: 9:21971060-21971060
GRCh38: 9:21971061-21971061
22 CDKN2A NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) SNV Uncertain significance 246117 rs756750256 GRCh37: 9:21971161-21971161
GRCh38: 9:21971162-21971162
23 CDKN2A NM_000077.4(CDKN2A):c.370C>T (p.Arg124Cys) SNV Uncertain significance 231362 rs34170727 GRCh37: 9:21970988-21970988
GRCh38: 9:21970989-21970989
24 CDKN2A NM_000077.4(CDKN2A):c.373G>C (p.Asp125His) SNV Uncertain significance 41577 rs146179135 GRCh37: 9:21970985-21970985
GRCh38: 9:21970986-21970986
25 CDKN2A NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) SNV Uncertain significance 127523 rs199907548 GRCh37: 9:21974681-21974681
GRCh38: 9:21974682-21974682
26 CDKN2A NM_000077.4(CDKN2A):c.315C>A (p.Asp105Glu) SNV Uncertain significance 406702 rs763269347 GRCh37: 9:21971043-21971043
GRCh38: 9:21971044-21971044
27 CDKN2A NM_000077.4(CDKN2A):c.160A>C (p.Met54Leu) SNV Uncertain significance 463486 rs201314211 GRCh37: 9:21971198-21971198
GRCh38: 9:21971199-21971199
28 CDKN2A NM_000077.4(CDKN2A):c.-14C>T SNV Uncertain significance 221032 rs764244718 GRCh37: 9:21974840-21974840
GRCh38: 9:21974841-21974841
29 CDKN2A NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) Microsatellite Uncertain significance 216277 rs587780668 GRCh37: 9:21974795-21974818
GRCh38: 9:21974796-21974819
30 CDKN2A NM_000077.4(CDKN2A):c.-34G>C SNV Uncertain significance 245907 rs1800586 GRCh37: 9:21974860-21974860
GRCh38: 9:21974861-21974861
31 CDKN2A NM_000077.4(CDKN2A):c.-19413C>G SNV Uncertain significance 265298 rs528789830 GRCh37: 9:21994239-21994239
GRCh38: 9:21994240-21994240
32 CDKN2A NM_058195.3(CDKN2A):c.43T>C (p.Cys15Arg) SNV Uncertain significance 548785 rs1554659236 GRCh37: 9:21994288-21994288
GRCh38: 9:21994289-21994289
33 CDKN2A NM_000077.4(CDKN2A):c.32C>T (p.Pro11Leu) SNV Uncertain significance 584734 rs1374664673 GRCh37: 9:21974795-21974795
GRCh38: 9:21974796-21974796
34 CDKN2A NM_000077.4(CDKN2A):c.295C>G (p.Arg99Gly) SNV Uncertain significance 372062 rs34886500 GRCh37: 9:21971063-21971063
GRCh38: 9:21971064-21971064
35 CDKN2A NM_000077.4(CDKN2A):c.415G>C (p.Gly139Arg) SNV Uncertain significance 216276 rs587781733 GRCh37: 9:21970943-21970943
GRCh38: 9:21970944-21970944
36 CDKN2A NM_000077.4(CDKN2A):c.150+82A>G SNV Uncertain significance 584731 rs1231900408 GRCh37: 9:21974595-21974595
GRCh38: 9:21974596-21974596
37 CDKN2A NM_058197.4(CDKN2A):c.*256C>T SNV Uncertain significance 802462 rs1490202463 GRCh37: 9:21971025-21971025
GRCh38: 9:21971026-21971026
38 CDKN2A NM_058197.4(CDKN2A):c.*144A>C SNV Uncertain significance 802463 rs200429615 GRCh37: 9:21971137-21971137
GRCh38: 9:21971138-21971138
39 CDKN2A NM_058197.4(CDKN2A):c.*143G>C SNV Uncertain significance 802464 rs760640852 GRCh37: 9:21971138-21971138
GRCh38: 9:21971139-21971139
40 CDKN2A NM_000077.4(CDKN2A):c.26T>C (p.Met9Thr) SNV Uncertain significance 483319 rs145445140 GRCh37: 9:21974801-21974801
GRCh38: 9:21974802-21974802
41 CDKN2A NM_058195.3(CDKN2A):c.69C>A (p.Phe23Leu) SNV Uncertain significance 372023 rs374360796 GRCh37: 9:21994262-21994262
GRCh38: 9:21994263-21994263
42 CDKN2A NM_058195.3(CDKN2A):c.-33G>A SNV Uncertain significance 372077 rs1057517639 GRCh37: 9:21994363-21994363
GRCh38: 9:21994364-21994364
43 CDKN2A NM_000077.4(CDKN2A):c.150+1104C>A SNV Uncertain significance 220864 rs756102261 GRCh37: 9:21973573-21973573
GRCh38: 9:21973574-21973574
44 CDKN2A NM_000077.4(CDKN2A):c.-19492T>A SNV Uncertain significance 245816 rs776987532 GRCh37: 9:21994318-21994318
GRCh38: 9:21994319-21994319
45 CDKN2A NM_000077.4(CDKN2A):c.331G>A (p.Gly111Ser) SNV Uncertain significance 463499 rs778971134 GRCh37: 9:21971027-21971027
GRCh38: 9:21971028-21971028
46 CDKN2A NM_000077.4(CDKN2A):c.365G>T (p.Gly122Val) SNV Uncertain significance 182419 rs373291490 GRCh37: 9:21970993-21970993
GRCh38: 9:21970994-21970994
47 CDKN2A NM_000077.4(CDKN2A):c.122C>A (p.Pro41Gln) SNV Uncertain significance 141111 rs373407950 GRCh37: 9:21974705-21974705
GRCh38: 9:21974706-21974706
48 CDKN2A NM_058195.3(CDKN2A):c.79A>C (p.Ile27Leu) SNV Uncertain significance 371881 rs1057517575 GRCh37: 9:21994252-21994252
GRCh38: 9:21994253-21994253
49 CDKN2A NM_000077.4(CDKN2A):c.427G>A (p.Ala143Thr) SNV Uncertain significance 245681 rs754195015 GRCh37: 9:21970931-21970931
GRCh38: 9:21970932-21970932
50 CDKN2A NM_000077.4(CDKN2A):c.301G>A (p.Gly101Arg) SNV Uncertain significance 463494 rs104894094 GRCh37: 9:21971057-21971057
GRCh38: 9:21971058-21971058

UniProtKB/Swiss-Prot genetic disease variations for Melanoma-Pancreatic Cancer Syndrome:

72
# Symbol AA change Variation ID SNP ID
1 CDKN2A p.Gly101Trp VAR_001464 rs104894094

Expression for Melanoma-Pancreatic Cancer Syndrome

Search GEO for disease gene expression data for Melanoma-Pancreatic Cancer Syndrome.

Pathways for Melanoma-Pancreatic Cancer Syndrome

GO Terms for Melanoma-Pancreatic Cancer Syndrome

Sources for Melanoma-Pancreatic Cancer Syndrome

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
20 GARD
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
53 NINDS
54 Novoseek
56 OMIM via Orphanet
57 OMIM® (Updated 05-Apr-2021)
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 Tocris
70 UMLS
71 UMLS via Orphanet
Content
Loading form....