Microvascular Complications of Diabetes 4 disease: Malacards - Research Articles, Drugs, Genes, Clinical Trials

MVCD4 MCID: MCR133 MIFTS: 40	Microvascular Complications of Diabetes 4 (MVCD4) Categories: Cardiovascular diseases, Eye diseases, Genetic diseases, Nephrological diseases, Neuronal diseases	Data Licensing For inquiries, contact: [email protected]
Genes Variations Tissues Related diseases Publications Drugs Expand all tables

Sources

Aliases & Classifications for Microvascular Complications of Diabetes 4

MalaCards integrated aliases for Microvascular Complications of Diabetes 4:

Name: Microvascular Complications of Diabetes 4 ⁵⁷ ⁷³ ¹² ³⁸

Microvascular Complications of Diabetes, Susceptibility to, 4 ⁵⁷ ²⁸ ⁵

Diabetic Nephropathy ⁷³ ⁷¹

Mvcd4 ⁵⁷ ⁷³

Nephropathy, Diabetic, Susceptibility to ⁵⁷

Nephropathy, Diabetic ⁵⁷

Classifications:

MalaCards categories:
Global: Genetic diseases
Anatomical: Nephrological diseases Eye diseases Cardiovascular diseases Neuronal diseases

See all MalaCards categories (disease lists)

External Ids:

OMIM® ⁵⁷ 612628

OMIM Phenotypic Series ⁵⁷ PS603933

MeSH ⁴³ D048909

MedGen ⁴⁰ C2675112 CN034316

UMLS ⁷¹ C0011881

Sources

Summaries for Microvascular Complications of Diabetes 4

UniProtKB/Swiss-Prot: ⁷³ Pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis.

MalaCards based summary: Microvascular Complications of Diabetes 4, also known as microvascular complications of diabetes, susceptibility to, 4, is related to type 1 diabetes mellitus and microvascular complications of diabetes 3. An important gene associated with Microvascular Complications of Diabetes 4 is IL1RN (Interleukin 1 Receptor Antagonist). The drugs Pentoxifylline and Captopril have been mentioned in the context of this disorder. Affiliated tissues include kidney, endothelial and pancreas.

More information from OMIM: 612628 PS603933

Sources

Related Diseases for Microvascular Complications of Diabetes 4

Diseases in the Microvascular Complications of Diabetes 1 family:

Microvascular Complications of Diabetes 2	Microvascular Complications of Diabetes 3
Microvascular Complications of Diabetes 4	Microvascular Complications of Diabetes 5
Microvascular Complications of Diabetes 6	Microvascular Complications of Diabetes 7

Diseases related to Microvascular Complications of Diabetes 4 via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 553)

#	Related Disease	Score
1	type 1 diabetes mellitus	11.5
2	microvascular complications of diabetes 3	11.3
3	microvascular complications of diabetes 6	11.3
4	microvascular complications of diabetes 7	11.3
5	diabetic angiopathy	11.2
6	maturity-onset diabetes of the young	11.2
7	hyperglycemia	11.1
8	type 2 diabetes mellitus	11.1
9	renal fibrosis	11.1
10	oto-palatal-digital syndrome	11.0
11	diabetes mellitus	11.0
12	chronic kidney disease	11.0
13	glomerulonephritis	10.8
14	lipid metabolism disorder	10.8
15	nephrotic syndrome	10.7
16	hypertension, essential	10.7
17	rickets	10.7
18	vascular disease	10.7
19	ceroid lipofuscinosis, neuronal, 5	10.6
20	uremia	10.6
21	iga glomerulonephritis	10.6
22	iga nephropathy 1	10.6
23	membranous nephropathy	10.6
24	down syndrome	10.5
25	mckusick-kaufman syndrome	10.5
26	abdominal obesity-metabolic syndrome 1	10.5
27	hypercholesterolemia, familial, 1	10.5
28	cardiovascular system disease	10.5
29	neuropathy	10.5
30	kidney hypertrophy	10.5
31	peripheral vascular disease	10.5
32	glomerular disease	10.5
33	arteriosclerosis	10.5
34	lipoid nephrosis	10.5
35	leptin deficiency or dysfunction	10.5
36	focal segmental glomerulosclerosis	10.5
37	glucose intolerance	10.5
38	hypolipoproteinemia	10.5
39	deficiency anemia	10.5
40	pre-eclampsia	10.5
41	autonomic neuropathy	10.5
42	familial hyperlipidemia	10.5
43	diabetic neuropathy	10.5
44	cytokine deficiency	10.5
45	atherosclerosis susceptibility	10.4
46	hyperinsulinism	10.4
47	renal glucosuria	10.4
48	nephrosclerosis	10.4
49	tatton-brown-rahman syndrome	10.4
50	hyperuricemia	10.4

Graphical network of the top 20 diseases related to Microvascular Complications of Diabetes 4:

Sources

Symptoms & Phenotypes for Microvascular Complications of Diabetes 4

Clinical features from OMIM®:

612628 (Updated 08-Dec-2022)

Sources

Drugs & Therapeutics for Microvascular Complications of Diabetes 4

Drugs for Microvascular Complications of Diabetes 4 (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show top 50) (show all 259)

Name

Status

Phase

Clinical Trials

Cas Number

PubChem Id

Pentoxifylline

Approved, Investigational

Phase 4

6493-05-6

4740

Captopril

Approved

Phase 4

62571-86-2

44093

Clopidogrel

Approved

Phase 4

120202-66-6, 113665-84-2

60606

Vildagliptin

Approved, Investigational

Phase 4

274901-16-5

6918537

Moxonidine

Approved, Investigational

Phase 4

75438-57-2

4810

Alprostadil

Approved, Investigational

Phase 4

745-65-3

5280723

Amlodipine

Approved

Phase 4

88150-42-9

2162

Atenolol

Approved

Phase 4

29122-68-7

2249

Doxazosin

Approved

Phase 4

74191-85-8

3157

Acetylsalicylic acid

Approved, Vet_approved

Phase 4

50-78-2

2244

Irbesartan

Approved, Investigational

Phase 4

138402-11-6

3749

Furosemide

Approved, Vet_approved

Phase 4

54-31-9

3440

Simvastatin

Approved

Phase 4

79902-63-9

54454

Clonidine

Approved

Phase 4

4205-91-8, 4205-90-7

2803 20179

Insulin glulisine

Approved

Phase 4

207748-29-6

Insulin glargine

Approved

Phase 4

160337-95-1

118984454

Lixisenatide

Approved

Phase 4

320367-13-3

90472060 16139342

Glucagon

Approved

Phase 4

16941-32-5

16133228 16186314

Zaleplon

Approved, Illicit, Investigational

Phase 4

151319-34-5

5719

Tacrolimus

Approved, Investigational

Phase 4

104987-11-3

6473866 445643

Miconazole

Approved, Investigational, Vet_approved

Phase 4

22916-47-8

4189

Clotrimazole

Approved, Vet_approved

Phase 4

23593-75-1

2812

Carbamide peroxide

Approved

Phase 4

124-43-6

Candesartan cilexetil

Approved

Phase 4

145040-37-5

Allopurinol

Approved

Phase 4

315-30-0

2094 135401907

Nisoldipine

Approved

Phase 4

63675-72-9

4499

Prednisone

Approved, Vet_approved

Phase 4

53-03-2

5865

Probucol

Approved, Investigational

Phase 4

23288-49-5

4912

Cilostazol

Approved, Investigational

Phase 4

73963-72-1

2754

Exenatide

Approved, Investigational

Phase 4

141758-74-9

45588096

Atorvastatin

Approved

Phase 4

134523-00-5

60823

Indapamide

Approved

Phase 4

26807-65-8

3702

Insulin lispro

Approved

Phase 4

133107-64-9

16132438

Metformin

Approved

Phase 4

1115-70-4, 657-24-9

4091

Verapamil

Approved

Phase 4

152-11-4, 52-53-9

2520

Trandolapril

Approved

Phase 4

87679-37-6

5484727

Saxagliptin

Approved

Phase 4

361442-04-8

11243969

Enalaprilat

Approved

Phase 4

76420-72-9

6917719 5462501

Enalapril

Approved, Vet_approved

Phase 4

75847-73-3

40466924 5388962 5362032

Ertugliflozin

Approved, Investigational

Phase 4

1210344-57-2

75075340 44814423

Perindopril

Approved

Phase 4

82834-16-0, 107133-36-8

107807

Lisinopril

Approved, Investigational

Phase 4

83915-83-7, 76547-98-3

5362119

Losartan

Approved

Phase 4

114798-26-4

3961

Valsartan

Approved, Investigational

Phase 4

137862-53-4

60846

Benazepril

Approved, Investigational

Phase 4

86541-75-5

5362124

Calcitriol

Approved, Nutraceutical

Phase 4

32222-06-3

5280453

Thiamine

Approved, Investigational, Nutraceutical, Vet_approved

Phase 4

70-16-6

1130

Cholecalciferol

Approved, Nutraceutical, Vet_approved

Phase 4

67-97-0, 1406-16-2

5280795 10883523

Alfacalcidol

Approved, Nutraceutical

Phase 4

41294-56-8

5282181

Vitamin A

Approved, Nutraceutical, Vet_approved

Phase 4

22737-96-8, 68-26-8

5280382 445354

Interventional clinical trials:

(show top 50) (show all 279)

#	Name	Status	NCT ID	Phase	Drugs
1	Effects of SGLT2 Inhibition Treatment on Different Levels of Albuminuria in Patients With Type 2 Diabetes: a Prospective Interventional Study	Unknown status	NCT04127084	Phase 4	SGLT2 Inhibition
2	Effect of Aldosterone Antagonism in the Reduction of Albuminuria and Diastolic Disfunction of Patients With Diabetic Nephropathy.	Unknown status	NCT00870402	Phase 4	Spironolactone;Placebo
3	Clinical Trial Technology Development for the Validation of Surrogate Prognostic Markers in Patients With Diabetic Nephropathy	Unknown status	NCT01673204	Phase 4	Calcitriol;Placebo
4	Phase 4 Study of Mechanisms of Low Protein Diet Supplemented With Ketoanalogs on Reducing Proteinuria and Maintaining Nutritional Status in Type 2 Diabetic Nephropathy	Unknown status	NCT01300273	Phase 4
5	A Prospective, Randomized, Two Period, With an Intermediate Wash Out Period, Cross-over Study to Compare the Effects of Either Combined Therapy With Ramipril and Clopidogrel or Ramipril Monotherapy on Oxidative Stress, Vascular Inflammation and Endothelial Dysfunction in Patients With Type 2 Diabetes and Diabetic Nephropathy	Unknown status	NCT01743014	Phase 4	Ramipril;Clopidogrel
6	Effect of Intravenous and Oral Therapy With Sulodexide on Albuminuria in Type 2 Diabetic Patients	Unknown status	NCT01316068	Phase 4	intravenous use of sulodexide followed by oral use;use of sulodexide orally only
7	Prevention of Renal Complications of Diabetes With Thiamine	Unknown status	NCT01725412	Phase 4
8	Comparative Effecacy of Metformin and Vildagliptin on Cardiometabolic Risk Factors, Metabolic Syndrome, and Diabetic Nephropathy Progression	Unknown status	NCT04485845	Phase 4	Vildagliptin;Captopril Tablets;MetFORMIN 500 Mg Oral Tablet
9	Pentoxifylline Effect on Renal Function, Oxidative Stress, Inflammation, and Fibrosis Markers, and Quality of Life in Patients With Diabetic Nephropathy	Unknown status	NCT03664414	Phase 4	pentoxifylline
10	Sympathetic Nervous System Inhibition for the Treatment of Diabetic Nephropathy	Unknown status	NCT01094769	Phase 4	Moxonidine;Placebo
11	A Randomised, Double-blind, Placebo-controlled, Multicenter Trial to Investigate the Preventive Effect of BIBR277 (Telmisartan) in Diabetic Nephropathy on Transition From Incipient to Overt Nephropathy - Incipient to Overt : Angiotensin 2 Receptor Blocker, Telmisartan, Investigation on Type 2 Diabetic Nephropathy (INNOVATION Study -	Completed	NCT00153088	Phase 4	Telmisartan capsule 40 mg;Placebo;Telmisartan capsule 80 mg
12	Lipo-prostaglandin E1 Improves Renal Hypoxia Evaluated by BOLD-MRI in Patients	Completed	NCT02628106	Phase 4	Lipo-PGE1
13	Nephropathy in Type 2 Diabetes: Effects of an Intensive Multifactorial Intervention Trial on Cardio-renal Events.	Completed	NCT00535925	Phase 4	SoC therapy;irbesartan;ramipril;hydrochlorothiazide;furosemide;amlodipine;atenolol;doxazosin;clonidine;insulin;simvastatin;fibrate;erythropoietin;aspirin
14	Combined Diabetes-Renal Multifactorial Intervention In Patients With Advanced Diabetic Nephropathy (ADN)	Completed	NCT00708981	Phase 4
15	A Phase 4, Mono-center, Randomized, Open Label, Comparator-controlled, Parallel-group, Mechanistic Intervention Trial to Assess the Effect of 8-week Treatment With the Glucagon-like Peptide-1 Receptor Agonist Lixisenatide Versus Insulin Glulisine on Renal Physiology and Biomarkers in Insulin Glargine-treated Patients With Type 2 Diabetes Mellitus	Completed	NCT02276196	Phase 4	Lixisenatide;Insulin glulisine
16	Effect of Enalapril and Losartan Association Therapy on Proteinuria and Inflammatory Biomarkers in Diabetic Nephropathy: a Clinical Trial on Type 2 Diabetes Mellitus	Completed	NCT00419835	Phase 4	enalapril;losartan
17	FGF-23 and Endothelial Dysfunction in Diabetic Proteinuric Patients	Completed	NCT01703234	Phase 4	Ramipril
18	Effect of Sarpogrelate On the Nephropathy in Type 2 Diabetes	Completed	NCT01869881	Phase 4	Anplag(Sarpogrelate);Placebo
19	Effect of Renin Angiotensin System Blockade on CD95 and ADMA Levels in Type-2 Diabetic Patients With Proteinuria	Completed	NCT00893425	Phase 4	ramipril
20	A 28-week, Randomised, Open-label, Parallel-Group, Multi-Center Study To Find the Effective Dose of Candesartan Cilexetil (Atacand) for Renoprotection in Korean Hypertensive Patients With Non-diabetic Nephropathy	Completed	NCT00573430	Phase 4	Candesartan Cilexetil;Candesartan Cilexetil 32mg
21	Antiproteinuric Effect of Valsartan, Lisinopril and Valsartan Plus Lisinopril in Non-diabetic and Diabetic Renal Disease: a Randomized, Double Blind, Parallel Group, Controlled Trial With 5 Months Follow-up	Completed	NCT00171574	Phase 4	Valsartan;Valsartan plus HCTZ;Lisinopril
22	A Prospective, Multi-center, Randomized, Open-label, Parallel-arm Controlled Study of Treating Type 2 Diabetic Nephropathy (Stage II-IV) With Alfacalcidol and Irbesartan	Completed	NCT03147677	Phase 4	Alfacalcidol;Irbesartan
23	Effect of Urinary Alkalinization on Urine Uric Acid Precipitation and Crystallization in Adults With Type 1 DiabetesL a Open-label Trial	Completed	NCT02502071	Phase 4	sodium bicarbonate
24	A Double-Blind Clinical Trial of Benfotiamine Treatment in Diabetic Nephropathy	Completed	NCT00565318	Phase 4	Benfotiamine;Placebo
25	A Double-blind, Randomized, Placebo Controlled Trial of Allopurinol in Patients With Type 1 Diabetes and Microalbuminuria	Completed	NCT02829177	Phase 4	Allopurinol;Placebo
26	A Multicenter, Randomized, Open-label, Parallel-group, Diabetic Diet-controlled Study to Evaluate the Efficacy and Safety of Compound α-Keto Acid Tablet in Combination With LPD in Delaying the Progress of Type 2 Diabetic Nephropathy	Completed	NCT00363987	Phase 4	Ketosteril®
27	Spironolactone in Diabetic Nephropathy	Completed	NCT00317954	Phase 4	Spironolactone
28	Renoprotective Effect of Nisoldipine and Lisinopril in Type 1 Diabetic Nephropathy	Completed	NCT00311870	Phase 4	nisoldipine;lisinopril
29	Randomized Open Label Study Comparing the Metabolic Control of Kidney Transplant Recipients With Type 2 Diabetes Receiving Either Prograf or Neoral as Part of a ATG Induction, Prednisone Free and Monitored MMF Immunosuppressive Regimen.	Completed	NCT00296296	Phase 4	Cyclosporin;Tacrolimus
30	Effect of Continuous Positive Airway Pressure on Albuminuria in Patients With Diabetic Nephropathy and Obstructive Sleep Apnea	Completed	NCT02816762	Phase 4	Pharmacological treatment
31	"Safety and Efficacy of Acthar Gel on Albuminuria and Urinary Transforming Growth Factor Excretion in Type I or Type II Diabetics Requiring Medical Treatment of Hyperglycemia With Nephrotic Range Proteinuria: A Pilot Study"	Completed	NCT01028287	Phase 4	ACTH
32	A Randomized, Control, Parallel, Open Label, Multi-centre Clinical Study to Evaluate the Efficacy and Safety of Cilostazol and Probucol in Combination on Patients With Diabetic Nephropathy	Completed	NCT01252056	Phase 4	Probucol;Probucol and Cilostazol
33	Renal Denervation in Patients With Diabetic Nephropathy and Persistent Proteinuria	Completed	NCT01588795	Phase 4	Standardized antiproteinuric medication regimen includes an angiotensin receptor blocker , a diuretic , 25OH vitamin D3 and a statin
34	The Effect of Paricalcitol Versus Placebo on Plasma N-Terminal-proBNP in Patients With Type 1 Diabetes Mellitus and Diabetic Nephropathy	Completed	NCT01331317	Phase 4	Paricalcitol
35	Effects of Dapagliflozin Treatment on Urinary Proteomic Patterns in Patients With Type 2 Diabetes	Completed	NCT02914691	Phase 4	Dapagliflozine 10 mg once daily tablet treatment;Placebo identical once daily tablet treatment
36	Effect of Exenatide on 24h-UAER in Patients With Diabetic Nephropathy: a 24- Week Study	Completed	NCT02690883	Phase 4	Exenatide;Lispro
37	A Randomised, Double-Blind, Placebo-Controlled Study of Cilostazol 100 mg Twice Daily in the Treatment of Diabetic Nephropathy in Hong Kong Chinese	Completed	NCT00272831	Phase 4	Cilostazol;Placebo
38	Effects of Doxazosin on Ambulatory Blood Pressure and Sympathetic Nervous Activity in Hypertensive Patients With Diabetic Nephropathy	Completed	NCT00295555	Phase 4	Effects of doxazosin on morning surge in diabetic patients
39	Effects of Atorvastatin Versus Probucol on Low-Density Lipoprotein Subtype Distribution and Renal Function in Hyperlipidemic Patients With Non-Diabetic Nephropathy	Completed	NCT00276133	Phase 4	Effects of atorvastatin versus probucol on small dense LDL
40	A Two-Phase Study for Primary and Secondary Prevention of Diabetic Nephropathy by Combined ACE Inhibition and Calcium Channel Blockade (BENEDICT)	Completed	NCT00235014	Phase 4	trandolapril;trandolapril/verapamil;placebo;verapamil
41	A Phase IV, Randomized, Open-Label, Active Controlled Study to Compare the Effects of Tarka® and Lotrel® on Albuminuria in Hypertensive, Type 2 Diabetic Subjects With Diabetic Nephropathy	Completed	NCT00234871	Phase 4	trandolapril/verapamil;Lotrel (amlodipine/benazepril)
42	A Single Arm Open Label Multicenter Interventional Study to Assess the Efficacy, Safety, and Tolerability of Every 4 Weeks Administration of Subcutaneous C.E.R.A. for the Treatment of Chronic Renal Anemia in Diabetic Nephropathy With Chronic Kidney Disease Stages III-IV Not on Dialysis, Not Currently Treated With ESA.	Completed	NCT01191983	Phase 4	Methoxy polyethylene glycol-epoetin beta [Mircera]
43	A New Clinical Utility for Tubular Markers to Identify Kidney Responders to Saxagliptin Treatment in Patients With Diabetic Nephropathy	Completed	NCT04521049	Phase 4	Saxagliptin 5mg
44	Phase 4, Randomized, Placebo-controlled, Cross-over Trial to Assess the Effect of 4-week Ertugliflozin (SGLT-2 Inhibitor) Therapy on Renal Oxygenation by BOLD-MRI and Renal Oxygen Consumption by PET Using ¹¹C-acetate in T2DM Without Kidney Disease and Healthy Controls.	Recruiting	NCT04027530	Phase 4	Ertugliflozin 15 mg
45	Safety and Efficacy of Maximally Tolerated RAAS Blockade and Spironolactone Therapy on Urinary Proteinuria and Progression of Type II Diabetic Nephropathy in African Americans and Other Patient Cohorts.	Recruiting	NCT03502031	Phase 4	Renin-Angiotensin (RAAS) alone;Renin-Angiotensin (RAAS) blockers in combination with Spironolactone
46	Study of Triple Blockade of the Renin Angiotensin Aldosterone System (RAAS) in Diabetic (Type 1&2) Proteinuric Patients With (ACE-, ARB, DRI)	Terminated	NCT00961207	Phase 4	Aliskiren
47	Aldosterone Breakthrough During Diovan (Valsartan), Tekturna (Aliskiren), and Combination (Valsartan+Aliskiren) Anti-hypertensive Therapy in Patients With Proteinuric Kidney Disease	Terminated	NCT01129557	Phase 4	Aliskiren;Valsartan
48	Comparative, Open Multicenter Trial Assessing the Effect on Albumin Excretion Rate of 320mg Valsartan (With or Without HCTZ) vs 40mg Lisinopril (With or Without HCTZ) on Hypertensive Patients With Diabetic and Non-diabetic Nephropathy and Albuminuria	Terminated	NCT00171600	Phase 4	VALSARTAN, VALSARTAN PLUS HCTZ, LISINOPRIL, LISINOPRIL PLUS HCTZ
49	A 24-Week Study to Assess Blood Pressure Independent Effects of Valsartan Treatment, Benazepril Treatment and Combination of Both Valsartan and Benazepril Treatment on Urinary Albumin Excretion Rate With Type II Diabetes Mellitus and Microalbuminuria	Terminated	NCT00171119	Phase 4	valsartan
50	The Collaborative Study Group Trial: The Effect of Sulodexide in Overt Type 2 Diabetic Nephropathy	Terminated	NCT00130312	Phase 4	Sulodexide;Placebo

Search NIH Clinical Center for Microvascular Complications of Diabetes 4

Inferred drug relations via UMLS ⁷¹ / NDF-RT ⁵⁰ :

benazepril

Benazepril hydrochloride

candesartan

candesartan cilexetil

Captopril

Enalapril

Enalapril Maleate

Enalaprilat

eprosartan

Eprosartan mesylate

Fosinopril

Fosinopril Sodium

irbesartan

Lisinopril

Losartan

Losartan Potassium

moexipril

Moexipril hydrochloride

olmesartan

Olmesartan medoxomil

Perindopril

Perindopril arginine

Perindopril Erbumine

quinapril

Quinapril hydrochloride

Ramipril

telmisartan

trandolapril

valsartan

Sources

Genetic Tests for Microvascular Complications of Diabetes 4

Genetic tests related to Microvascular Complications of Diabetes 4:

#	Genetic test	Affiliating Genes
1	Microvascular Complications of Diabetes, Susceptibility to, 4 ²⁸	IL1RN

Sources

Anatomical Context for Microvascular Complications of Diabetes 4

Organs/tissues related to Microvascular Complications of Diabetes 4:

MalaCards : Kidney, Endothelial, Pancreas, Bone Marrow, Heart, Monocytes, Bone

Sources

Publications for Microvascular Complications of Diabetes 4

Articles related to Microvascular Complications of Diabetes 4:

(show top 50) (show all 20950)

#	Title	Authors	PMID	Year
1	Polymorphisms in interleukin-1 beta and Interleukin-1 receptor antagonist genes are associated with kidney failure in Korean patients with type 2 diabetes mellitus. ⁶² ⁵⁷ ⁵	Lee SH...Chung JH	15286433	2004
2	Interleukin-1 receptor antagonist allele (IL1RN*2) associated with nephropathy in diabetes mellitus. ⁶² ⁵⁷ ⁵	Blakemore AI...Duff GW	8786086	1996
3	Interleukin-1 system gene polymorphisms are associated with fat mass in young men. ⁵	Strandberg L...Jansson JO	16636119	2006
4	Osteoporotic fractures are associated with an 86-base pair repeat polymorphism in the interleukin-1--receptor antagonist gene but not with polymorphisms in the interleukin-1beta gene. ⁵	Langdahl BL...Eriksen EF	10750554	2000
5	Interleukin-1 polymorphisms associated with increased risk of gastric cancer. ⁵	El-Omar EM...Rabkin CS	10746728	2000
6	Association of interleukin-1beta and interleukin-1 receptor antagonist genes with disease severity in MS. ⁵	Schrijver HM...Pena AS	10025794	1999
7	Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat. ⁵	Tarlow JK...Duff GW	8500797	1993
8	Ginsenoside Rg1 attenuates glomerular fibrosis by inhibiting CD36/TRPC6/NFAT2 signaling in type 2 diabetes mellitus mice. ⁶²	Han Y...Li W	36375645	2023
9	Network pharmacology analysis combined with experimental validation to explore the therapeutic mechanism of Schisandra Chinensis Mixture on diabetic nephropathy. ⁶²	Ma Y...Zhang M	36280016	2023
10	Beneficial effects of ginsenosides on diabetic nephropathy: A systematical review and meta-analysis of preclinical evidence. ⁶²	Chen XM...Tang D	36341813	2023
11	Suppression of lncRNA Snhg1 inhibits high glucose-induced inflammation and proliferation in mouse mesangial cells. ⁶²	Sheng J...Wu B	36243327	2023
12	The changing trajectory of diabetic kidney disease. ⁶²	Mistry N...Bakris GL	36250469	2023
13	Interplay between long non-coding RNA MALAT1 and pyroptosis in diabetic nephropathy patients. ⁶²	Shoeib HM...El-Dardiry SA	36270460	2023
14	Ion channels and channelopathies in glomeruli. ⁶²	Staruschenko A...Dryer SE	36007181	2023
15	Modern indications for referral for kidney and pancreas transplantation. ⁶²	Fridell JA...Stratta RJ	36444661	2023
16	CircHOMER1 aggravates oxidative stress, inflammation and extracellular matrix deposition in high glucose-induced human mesangial cells. ⁶²	Shu S...Zhang Y	36181383	2022
17	XIST silencing alleviated inflammation and mesangial cells proliferation in diabetic nephropathy by sponging miR-485. ⁶²	Wang Q	32669002	2022
18	Haptoglobin Genotype Does Not Confer a Risk of Stroke in Type 1 Diabetes. ⁶²	Syreeni A...Thorn LM	36409784	2022
19	Empagliflozin ameliorates type 2 diabetes mellitus-related diabetic nephropathy via altering the gut microbiota. ⁶²	Deng L...Xu G	36185030	2022
20	Differences in the Distribution of Ceramides and Sphingosine among Lipoprotein and Lipoprotein-Depleted Fractions in Patients with Type 2 Diabetes Mellitus. ⁶²	Kurano M...Yatomi Y	35082227	2022
21	The roles of MTHFR (C677T, A1298C) and MGP (G-7A, T-138C) gene variations in development of diabetic nephropathy in patients with type 2 diabetes mellitus. ⁶²	Ay A...Sut N	36404848	2022
22	Association between cause of kidney failure and fracture incidence in a national US dialysis population cohort study. ⁶²	Ziolkowski S...O'Shaughnessy MM	36381373	2022
23	Changes in the spectrum of kidney diseases: a survey of 2803 patients from 2010 to 2018 at a single center in southeastern China. ⁶²	Zheng L...Wei X	35656734	2022
24	Kidney biopsy during pregnancy: a difficult decision. A case series reporting on 20 patients from Mexico. ⁶²	Moguel Gonzalez B...Madero Rovalo M	35994230	2022
25	Role of abnormal energy metabolism in the progression of chronic kidney disease and drug intervention. ⁶²	Liu X...Shao L	35535500	2022
26	MicroRNA-122-5p ameliorates tubular injury in diabetic nephropathy via FIH-1/HIF-1α pathway. ⁶²	Cheng L...Liu L	35166173	2022
27	Berberine protects diabetic nephropathy by suppressing epithelial-to-mesenchymal transition involving the inactivation of the NLRP3 inflammasome. ⁶²	Ma Z...Chen L	35618411	2022
28	Protective effect of salidroside on streptozotocin-induced diabetic nephropathy by inhibiting oxidative stress and inflammation in rats via the Akt/GSK-3β signalling pathway. ⁶²	Pei D...Piao M	36086879	2022
29	Ranunculus ternatus Thunb extract attenuates renal fibrosis of diabetic nephropathy via inhibiting SMYD2. ⁶²	Xu W...Liu L	35142600	2022
30	Peritoneal dialysis in the era of COVID-19: experience of a Tunisian center. ⁶²	Badrouchi S...Abderrahim E	35913609	2022
31	Discovery of caffeoylisocitric acid as a Keap1-dependent Nrf2 activator and its effects in mesangial cells under high glucose. ⁶²	Yao H...Li Y	34894983	2022
32	Addition of glomerular lesion severity improves the value of anemia status for the prediction of renal outcomes in Chinese patients with type 2 diabetes. ⁶²	Zhao L...Liu F	35188068	2022
33	High Glucose-Induced Human Kidney Cell Apoptosis and Inflammatory Injury Are Alleviated by Circ_0008529 Knockdown via Circ_0008529-Mediated miR-485-5p/WNT2B Signaling. ⁶²	Wang W...Lu H	35913598	2022
34	Vitamin E functions by association with a novel binding site on the 67 kDa laminin receptor activating diacylglycerol kinase. ⁶²	Hayashi D...Shirai Y	35977663	2022
35	Chronic kidney disease in public renal practices in Queensland, Australia, 2011-2018. ⁶²	Hoy WE...NHMRC CKD.CRE and the CKD.QLD Collaborative	36161428	2022
36	Inhibition of the glycogen synthase kinase 3β-hypoxia-inducible factor 1α pathway alleviates NLRP3-mediated pyroptosis induced by high glucose in renal tubular epithelial cells. ⁶²	Wan J...Liu Z	36056793	2022
37	Redox phospholipidomics analysis reveals specific oxidized phospholipids and regions in the diabetic mouse kidney. ⁶²	McCrimmon A...Stadler K	36334379	2022
38	Histopathology pattern and survival analysis of patients with kidney biopsy in the top end of Northern Australia from 2007 to 2020. ⁶²	Goh KL...Priyadarshana K	36456968	2022
39	Trends in the incidence of renal replacement therapy by type of primary kidney disease in Japan, 2006-2020. ⁶²	Wakasugi M...Narita I	36461735	2022
40	Predicting diabetic nephropathy in type 2 diabetic patients using machine learning algorithms. ⁶²	Hosseini Sarkhosh SM...Daraei M	36404838	2022
41	Effect of Costus pictus per se and in combination with Metformin and Enalapril in streptozotocin induced diabetic nephropathy in rats. ⁶²	Sanaye M...Kulkarni YA	36404856	2022
42	Renoprotective activity of anethole- rich fraction from aromatic herbs on junk food induced diabetic nephropathy in rats. ⁶²	Vellapandian C...Ramachandram DS	36404830	2022
43	Emerging drugs for the treatment of diabetic nephropathy. ⁶²	Kim YK...Davis SN	36472144	2022
44	Verteporfin inhibits the dedifferentiation of tubular epithelial cells via TGF-β1/Smad pathway but induces podocyte loss in diabetic nephropathy. ⁶²	Qi C...Wu H	36375573	2022
45	Statement of Retraction: Diminution of microRNA-98 alleviates renal fibrosis in diabetic nephropathy by elevating Nedd4L and inactivating TGF-β/Smad2/3 pathway. ⁶²		36346834	2022
46	Cynapanoside A exerts protective effects against obesity-induced diabetic nephropathy through ameliorating TRIM31-mediated inflammation, lipid synthesis and fibrosis. ⁶²	Luo J...Xu M	36375322	2022
47	Expression of growth arrest specific 1 (Gas1) in the distal tubules and collecting ducts in normal kidney and in the early stages of diabetic nephropathy. ⁶²	Luna-Antonio BI...Segovia J	36272046	2022
48	Association of the expression pattern and functions of long non-coding RNA with the progression of diabetic nephropathy. ⁶²	Lei L...Li YL	35718604	2022
49	NUP160 knockdown inhibits the progression of diabetic nephropathy in vitro and in vivo. ⁶²	Xie J...Zhu Q	35785044	2022
50	Polymorphisms in glucose homeostasis genes are associated with cardiovascular and renal parameters in patients with diabetic nephropathy. ⁶²	Mota-Zamorano S...Gervasini G	36314849	2022

Sources

Genes for Microvascular Complications of Diabetes 4

Genes related to Microvascular Complications of Diabetes 4 (1 elite genes):

- Elite gene

- Cancer Census gene in COSMIC

#	Symbol	Description	Category	Score	Evidence	PubMed IDs
1	IL1RN	Interleukin 1 Receptor Antagonist	Protein Coding	683.11	Molecular basis known ⁵⁷ Genetic Tests ²⁸ Susceptibility factor ⁵⁷ Risk factor ⁵ GeneCards inferred via : Disorders (show sections)	8500797 8786086 10025794 (more) 15286433 10746728 10750554 16636119

Sources

Variations for Microvascular Complications of Diabetes 4

ClinVar genetic disease variations for Microvascular Complications of Diabetes 4:

⁵

#	Gene	Name	Type	Significance	ClinVarId	dbSNP ID	Position
1	IL1RN	NM_173842.3(IL1RN):c.206-516ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC[2]	MICROSAT	Risk Factor	14674		GRCh37: 2:113888106-113888277 GRCh38: 2:113130529-113130700