OKS
MCID: OPT054
MIFTS: 49

Opitz-Kaveggia Syndrome (OKS)

Categories: Fetal diseases, Genetic diseases, Mental diseases, Neuronal diseases, Rare diseases

Aliases & Classifications for Opitz-Kaveggia Syndrome

MalaCards integrated aliases for Opitz-Kaveggia Syndrome:

Name: Opitz-Kaveggia Syndrome 57 12 53 25 59 74 13 44 40
Fg Syndrome 57 12 75 53 25 74 37 29 6 15 17 72
Keller Syndrome 57 12 53 25
Fgs1 57 53 25 74
Fgs 57 53 25 74
Oks 57 25 74
Mental Retardation, Large Head, Imperforate Anus, Congenital Hypotonia, and Partial Agenesis of Corpus Callosum 57 53
Fg Syndrome Type 1 59 74
Mental Retardation, Large Head, Imperforate Anus, Congenital Hypotonia, and Partial Agenesis of the Corpus Callosum 25
Fg Syndrome 1; Fgs1 57
Fg Syndrome; Fgs 57
Fg Syndrome 1 57

Characteristics:

OMIM:

57
Inheritance:
x-linked recessive


HPO:

32
opitz-kaveggia syndrome:
Inheritance x-linked recessive inheritance


Classifications:



External Ids:

Disease Ontology 12 DOID:14711
OMIM 57 305450
KEGG 37 H00894
MeSH 44 C537923
SNOMED-CT 68 49984004
MESH via Orphanet 45 C537923
ICD10 via Orphanet 34 Q87.8
UMLS via Orphanet 73 C0220769
Orphanet 59 ORPHA93932
MedGen 42 C0220769
UMLS 72 C0220769

Summaries for Opitz-Kaveggia Syndrome

Genetics Home Reference : 25 FG syndrome is a genetic condition that affects many parts of the body and occurs almost exclusively in males. "FG" represents the surname initials of the first family diagnosed with the disorder. FG syndrome affects intelligence and behavior. Almost everyone with the condition has intellectual disability, which ranges from mild to severe. Affected individuals tend to be friendly, inquisitive, and hyperactive, with a short attention span. Compared to people with other forms of intellectual disability, their socialization and daily living skills are strong, while verbal communication and language skills tend to be weaker. The physical features of FG syndrome include weak muscle tone (hypotonia), broad thumbs, and wide first (big) toes. Abnormalities of the tissue connecting the left and right halves of the brain (the corpus callosum) are also common. Most affected individuals have constipation, and many have abnormalities of the anus such as an obstruction of the anal opening (imperforate anus). People with FG syndrome also tend to have a distinctive facial appearance including small, underdeveloped ears; a tall, prominent forehead; and outside corners of the eyes that point downward (down-slanting palpebral fissures). Additional features seen in some people with FG syndrome include widely set eyes (hypertelorism), an upswept frontal hairline, and a large head compared to body size (relative macrocephaly). Other health problems have also been reported, including heart defects, seizures, undescended testes (cryptorchidism) in males, and a soft out-pouching in the lower abdomen (an inguinal hernia).

MalaCards based summary : Opitz-Kaveggia Syndrome, also known as fg syndrome, is related to lujan-fryns syndrome and opitz-gbbb syndrome, and has symptoms including seizures and constipation. An important gene associated with Opitz-Kaveggia Syndrome is MED12 (Mediator Complex Subunit 12), and among its related pathways/superpathways are MAPK signaling pathway and Focal adhesion. The drugs Neuroserpin and Astragalus have been mentioned in the context of this disorder. Affiliated tissues include heart, testes and brain, and related phenotypes are macrocephaly and malar flattening

Disease Ontology : 12 An X-linked recessive disease characterized by retardation, hyperactivity, hypotonia, broad thumbs, big first toes and a characteristic facial appearance including macrocephaly and has an X-linked recessive inheritance pattern.

NIH Rare Diseases : 53 FG syndrome (FGS) is a genetic condition that affects many parts of the body and occurs almost exclusively in males. "FG" represents the surname initials of the first individuals diagnosed with the disorder. People with FG syndrome frequently have intellectual disability ranging from mild to severe, hypotonia, constipation and/or anal anomalies, a distinctive facial appearance, broad thumbs and great toes, a large head compared to body size (relative macrocephaly), and abnormalities of the corpus callosum. Medical problems including heart defects, seizures, undescended testicle, and an inguinal hernia have also been reported in some affected individuals. Researchers have identified five regions of the X chromosome that are linked to FG syndrome in affected families. Mutations in the MED12 gene appears to be the most common cause of this disorder, leading to FG syndrome 1. Other genes involved with FG syndrome include FLNA (FGS2), CASK (FGS4), UPF3B (FGS6), and BRWD3 (FGS7). FGS is inherited in an X-linked recessive pattern. Individualized early intervention and educational services are important so that each child can reach their fullest potential.

OMIM : 57 Opitz-Kaveggia syndrome (OKS) is an X-linked recessive mental retardation syndrome characterized by dysmorphic features, including relative macrocephaly, hypertelorism, downslanted palpebral fissures, prominent forehead with frontal hair upsweep, and broad thumbs and halluces. Most have hypotonia, constipation, and partial agenesis of the corpus callosum. Some patients have sensorineural hearing loss and joint laxity evolving into joint contractures. Affected individuals tend to be hyperactive and talkative (summary by Graham et al., 1999). In their original family, Opitz and Kaveggia (1974) named the disorder 'FG syndrome' according to the Opitz system of using initials of patients' surnames. (305450)

KEGG : 37
FG syndrome (FGS), also known as Opitz-Kaveggia syndrome, is a rare X-linked multiple congenital anomaly/mental retardation (MCA/MR) disorder characterized by high clinical variability and genetic heterogeneity. The cardinal features of the syndrome are congenital hypotonia, delayed development of speech, relative macrocephaly (as compared to height and weight), anal anomalies or severe constipation, and dysmorphic facial features. Five loci have so far been linked to this phenotype on the X chromosome. A recurrent missense mutation in the MED12 gene has been identified as the cause for the subset of FGS cases. Filamin A gene (FLNA) and CASK gene mutations could be another causes of FG syndrome.

UniProtKB/Swiss-Prot : 74 Opitz-Kaveggia syndrome: X-linked disorder characterized by mental retardation, relative macrocephaly, hypotonia and constipation.

Wikipedia : 75 FG syndrome (FGS) is a rare genetic syndrome caused by one or more recessive genes located on the X... more...

Related Diseases for Opitz-Kaveggia Syndrome

Diseases related to Opitz-Kaveggia Syndrome via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 228)
# Related Disease Score Top Affiliating Genes
1 lujan-fryns syndrome 32.6 UPF3B MED12
2 opitz-gbbb syndrome 29.0 MID2 IGBP1
3 fg syndrome 3 12.4
4 fg syndrome 5 12.4
5 cask-related disorders 11.6
6 vaccinia 11.6
7 focal segmental glomerulosclerosis 11.5
8 fg syndrome 4 11.4
9 x-linked intellectual disability with or without nystagmus 11.3
10 ulnar neuropathy 11.3
11 fg syndrome 2 11.3
12 syndromic x-linked intellectual disability 14 11.2
13 med12-related disorders 10.7
14 hypotonia 10.6
15 anus, imperforate 10.5
16 alacrima, achalasia, and mental retardation syndrome 10.4
17 constipation 10.4
18 alzheimer disease 10.3
19 lymphopenia 10.3
20 multiple congenital anomalies/dysmorphic syndrome-intellectual disability 10.3
21 osteoarthritis 10.3
22 pancreatic cancer 10.3
23 hypertelorism 10.2
24 nephrotic syndrome 10.2
25 diabetes mellitus, insulin-dependent, 2 10.2
26 diabetes mellitus, insulin-dependent 10.2
27 filariasis 10.2
28 pertussis 10.2
29 diabetes mellitus, insulin-dependent, 3 10.2
30 human immunodeficiency virus type 1 10.2
31 splenomegaly 10.2
32 ataxia and polyneuropathy, adult-onset 10.1
33 anxiety 10.1
34 rapidly involuting congenital hemangioma 10.1
35 cryptorchidism, unilateral or bilateral 10.1
36 hypospadias 10.1
37 spasticity 10.1
38 neuroblastoma 1 10.1
39 diabetes mellitus, insulin-dependent, 4 10.1
40 gastric cancer 10.1
41 cardiac arrest 10.1
42 acute leukemia 10.1
43 learning disability 10.1
44 fryns syndrome 10.1 UPF3B MED12
45 hypercholesterolemia, familial, 1 10.1
46 neutropenia 10.1
47 adenocarcinoma 10.1
48 pancreatic adenocarcinoma 10.1
49 cleft palate, isolated 10.0
50 telecanthus 10.0

Graphical network of the top 20 diseases related to Opitz-Kaveggia Syndrome:



Diseases related to Opitz-Kaveggia Syndrome

Symptoms & Phenotypes for Opitz-Kaveggia Syndrome

Human phenotypes related to Opitz-Kaveggia Syndrome:

59 32 (show top 50) (show all 109)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 macrocephaly 59 32 frequent (33%) Frequent (79-30%) HP:0000256
2 malar flattening 59 32 frequent (33%) Frequent (79-30%) HP:0000272
3 hypertelorism 59 32 frequent (33%) Frequent (79-30%) HP:0000316
4 high palate 59 32 frequent (33%) Frequent (79-30%) HP:0000218
5 inguinal hernia 59 32 frequent (33%) Frequent (79-30%) HP:0000023
6 global developmental delay 59 32 frequent (33%) Frequent (79-30%) HP:0001263
7 delayed speech and language development 59 32 frequent (33%) Frequent (79-30%) HP:0000750
8 pes planus 59 32 frequent (33%) Frequent (79-30%) HP:0001763
9 microtia 59 32 frequent (33%) Frequent (79-30%) HP:0008551
10 thick vermilion border 59 32 frequent (33%) Frequent (79-30%) HP:0012471
11 short stature 59 32 frequent (33%) Frequent (79-30%) HP:0004322
12 long philtrum 59 32 frequent (33%) Frequent (79-30%) HP:0000343
13 micrognathia 59 32 frequent (33%) Frequent (79-30%) HP:0000347
14 strabismus 59 32 frequent (33%) Frequent (79-30%) HP:0000486
15 prominent occiput 59 32 frequent (33%) Frequent (79-30%) HP:0000269
16 cryptorchidism 59 32 frequent (33%) Frequent (79-30%) HP:0000028
17 broad neck 59 32 frequent (33%) Frequent (79-30%) HP:0000475
18 atrial septal defect 59 32 frequent (33%) Frequent (79-30%) HP:0001631
19 ventriculomegaly 59 32 frequent (33%) Frequent (79-30%) HP:0002119
20 optic nerve hypoplasia 59 32 frequent (33%) Frequent (79-30%) HP:0000609
21 intellectual disability, moderate 59 32 frequent (33%) Frequent (79-30%) HP:0002342
22 wide mouth 59 32 frequent (33%) Frequent (79-30%) HP:0000154
23 hypospadias 59 32 frequent (33%) Frequent (79-30%) HP:0000047
24 slender build 59 32 frequent (33%) Frequent (79-30%) HP:0001533
25 dental crowding 59 32 frequent (33%) Frequent (79-30%) HP:0000678
26 downslanted palpebral fissures 59 32 frequent (33%) Frequent (79-30%) HP:0000494
27 high forehead 59 32 frequent (33%) Frequent (79-30%) HP:0000348
28 pyloric stenosis 59 32 frequent (33%) Frequent (79-30%) HP:0002021
29 stenosis of the external auditory canal 59 32 frequent (33%) Frequent (79-30%) HP:0000402
30 plagiocephaly 59 32 frequent (33%) Frequent (79-30%) HP:0001357
31 premature birth 59 32 frequent (33%) Frequent (79-30%) HP:0001622
32 abnormal cerebellum morphology 59 32 frequent (33%) Frequent (79-30%) HP:0001317
33 aplasia/hypoplasia of the corpus callosum 59 32 frequent (33%) Frequent (79-30%) HP:0007370
34 abnormality of the sternum 59 32 frequent (33%) Frequent (79-30%) HP:0000766
35 prominent nose 59 32 frequent (33%) Frequent (79-30%) HP:0000448
36 cupped ear 59 32 frequent (33%) Frequent (79-30%) HP:0000378
37 generalized neonatal hypotonia 59 32 frequent (33%) Frequent (79-30%) HP:0008935
38 drooling 59 32 frequent (33%) Frequent (79-30%) HP:0002307
39 broad toe 59 32 frequent (33%) Frequent (79-30%) HP:0001837
40 generalized joint laxity 59 32 frequent (33%) Frequent (79-30%) HP:0002761
41 widely patent fontanelles and sutures 59 32 frequent (33%) Frequent (79-30%) HP:0004492
42 broad-based gait 59 32 frequent (33%) Frequent (79-30%) HP:0002136
43 small pituitary gland 59 32 frequent (33%) Frequent (79-30%) HP:0012506
44 fused teeth 59 32 frequent (33%) Frequent (79-30%) HP:0011090
45 frontal upsweep of hair 59 32 frequent (33%) Frequent (79-30%) HP:0002236
46 malrotation of colon 59 32 frequent (33%) Frequent (79-30%) HP:0004785
47 limited elbow extension and supination 59 32 frequent (33%) Frequent (79-30%) HP:0005852
48 finger syndactyly 59 32 occasional (7.5%) Occasional (29-5%) HP:0006101
49 hydrocephalus 59 32 occasional (7.5%) Occasional (29-5%) HP:0000238
50 seizures 59 32 occasional (7.5%) Occasional (29-5%) HP:0001250

Symptoms via clinical synopsis from OMIM:

57
Head And Neck Head:
macrocephaly
plagiocephaly
large anterior fontanel

Head And Neck Neck:
short neck

Skeletal Hands:
clinodactyly
single transverse palmar crease
camptodactyly
syndactyly
broad thumbs
more
Genitourinary Internal Genitalia Male:
inguinal hernia
cryptorchidism

Abdomen External Features:
umbilical hernia

Head And Neck Face:
prominent forehead
long philtrum
micrognathia
frontal hair upsweep

Skin Nails Hair Skin:
sacral dimple
single transverse palmar crease
facial wrinkling
persistent fetal fingertip pads
perianal skin tags

Respiratory Nasopharynx:
choanal atresia

Skin Nails Hair Hair:
fine hair
sparse hair
frontal hair upsweep

Skeletal Spine:
lumbar hyperlordosis

Voice:
high-pitched voice

Skeletal Skull:
delayed closure of anterior fontanel

Head And Neck Eyes:
hypertelorism
strabismus
downslanting palpebral fissures
epicanthal folds
medial eyebrow flare

Neurologic Central Nervous System:
agenesis of corpus callosum
hydrocephalus
seizures
global developmental delay
neonatal hypotonia
more
Abdomen Gastrointestinal:
constipation
pyloric stenosis
anteriorly placed anus
anal stenosis
imperforate anus
more
Head And Neck Mouth:
narrow palate
cleft palate
cleft lip
large mouth
prominent lower lip

Growth Height:
short stature

Neurologic Behavioral Psychiatric Manifestations:
hyperactivity
attention deficit disorder
friendly, sociable personality

Genitourinary External Genitalia Male:
hypospadias

Head And Neck Teeth:
dental crowding

Head And Neck Nose:
prominent nose

Head And Neck Ears:
small ears
hearing loss, sensorineural

Skeletal Limbs:
joint contractures
joint hyperlaxity (infancy)

Skeletal Feet:
broad halluces

Clinical features from OMIM:

305450

UMLS symptoms related to Opitz-Kaveggia Syndrome:


seizures, constipation

GenomeRNAi Phenotypes related to Opitz-Kaveggia Syndrome according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Increased shRNA abundance with PLX4720 GR00300-A 8.62 MED12 VCX3A

Drugs & Therapeutics for Opitz-Kaveggia Syndrome

Drugs for Opitz-Kaveggia Syndrome (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):


# Name Status Phase Clinical Trials Cas Number PubChem Id
1 Neuroserpin
2 Astragalus

Interventional clinical trials:


# Name Status NCT ID Phase Drugs
1 Genetic Disease Gene Identification Unknown status NCT00916903

Search NIH Clinical Center for Opitz-Kaveggia Syndrome

Cochrane evidence based reviews: opitz-kaveggia syndrome

Genetic Tests for Opitz-Kaveggia Syndrome

Genetic tests related to Opitz-Kaveggia Syndrome:

# Genetic test Affiliating Genes
1 Fg Syndrome 29 MED12

Anatomical Context for Opitz-Kaveggia Syndrome

MalaCards organs/tissues related to Opitz-Kaveggia Syndrome:

41
Heart, Testes, Brain, Eye, Skin, Colon, Cerebellum

Publications for Opitz-Kaveggia Syndrome

Articles related to Opitz-Kaveggia Syndrome:

(show top 50) (show all 98)
# Title Authors PMID Year
1
A recurrent mutation in MED12 leading to R961W causes Opitz-Kaveggia syndrome. 38 8 71
17334363 2007
2
FG syndrome, an X-linked multiple congenital anomaly syndrome: the clinical phenotype and an algorithm for diagnostic testing. 38 8
19938245 2009
3
Behavior of 10 patients with FG syndrome (Opitz-Kaveggia syndrome) and the p.R961W mutation in the MED12 gene. 38 8
18973276 2008
4
Mediator links epigenetic silencing of neuronal gene expression with x-linked mental retardation. 38 71
18691967 2008
5
MED12-Related Disorders 38 71
20301719 2008
6
The FG syndrome: report of a large Italian series. 38 8
16691600 2006
7
Skewed X chromosome inactivation in carriers is not a constant finding in FG syndrome. 38 8
12700610 2003
8
Mapping of X chromosome inversion breakpoints [inv(X)(q11q28)] associated with FG syndrome: a second FG locus [FGS2]? 38 8
11078572 2000
9
Exclusion of nine candidate genes for their involvement in X-linked FG syndrome (FGS1) in three families. 38 8
11050623 2000
10
Esophageal dysmotility in brothers with an FG-like syndrome. 38 8
10756339 2000
11
Paracentric inversion of the X chromosome [inv(X)(q12q28)] in familial FG syndrome. 38 8
10449643 1999
12
Clinical and behavioral characteristics in FG syndrome. 38 8
10405444 1999
13
FG syndrome: report of three new families with linkage to Xq12-q22.1. 38 8
9805132 1998
14
Syndromal foramina parietalia permagna: "new" or FG syndrome? Comments on the paper by Chrzanowska et al [1998]. 38 8
9714004 1998
15
A gene for FG syndrome maps in the Xq12-q21.31 region. 38 8
9375929 1997
16
FG syndrome: the trias mental retardation, hypotonia and constipation reviewed. 38 8
8775418 1995
17
Japanese kindred with FG syndrome. 38 8
7802020 1994
18
A clinical follow-up of British patients with FG syndrome. 38 8
8055129 1994
19
X linked mental retardation: a family with a separate syndrome? 38 8
2738899 1989
20
FG syndrome update 1988: note of 5 new patients and bibliography. 38 8
3052062 1988
21
FG syndrome. 38 8
3572995 1987
22
Necropsy findings in a child with FG syndrome. 38 8
3746847 1986
23
The FG syndrome: 7 new cases. 38 8
4017279 1985
24
Diagnostic definition of the FG syndrome. 38 8
6507483 1984
25
FG syndrome in a premature male. 38 8
6507484 1984
26
Sensorineural deafness in the FG syndrome: report on four new cases. 38 8
6542310 1984
27
Two retarded male cousins with odd facies, hypotonia, and severe constipation: possible examples of the X linked FG syndrome. 38 8
6682449 1983
28
Studies of malformation syndromes of humans XXXIIIC: the FG syndrome - further studies on three affected individuals from the FG family. 38 8
7201743 1982
29
The FG syndrome: further characterization, report of a third family, and of a sporadic case. 38 8
565138 1977
30
Studies of malformation syndromes of man 33: the FG syndrome. An X-linked recessive syndrome of multiple congenital anomalies and mental retardation. 38 8
4365204 1974
31
Syndromic foramina parietalia permagna. 8
9714003 1998
32
A new syndrome of mental deficiency with craniofacial, limb, and anal abnormalities. 8
1255317 1976
33
HEREDITARY PARTIAL AGENESIS OF CORPUS CALLOSUM; BIOCHEMICAL AND PATHOLOGICAL STUDIES. 8
14158525 1964
34
Dysregulations of sonic hedgehog signaling in MED12-related X-linked intellectual disability disorders. 38
30729724 2019
35
Familial Ebstein Anomaly: Whole Exome Sequencing Identifies Novel Phenotype Associated With FLNA. 38
29237676 2017
36
A novel CASK mutation identified in siblings exhibiting developmental disorders with/without microcephaly. 38
28944139 2017
37
A novel variant in MED12 gene: Further delineation of phenotype. 38
28544239 2017
38
A de novo splice site mutation in CASK causes FG syndrome-4 and congenital nystagmus. 38
28139025 2017
39
De novo mutations in genes of mediator complex causing syndromic intellectual disability: mediatorpathy or transcriptomopathy? 38
27500536 2016
40
Two male sibs with severe micrognathia and a missense variant in MED12. 38
27286923 2016
41
Blepharophimosis, short humeri, developmental delay and hirschsprung disease: expanding the phenotypic spectrum of MED12 mutations. 38
24715367 2014
42
Clinical and neurocognitive characterization of a family with a novel MED12 gene frameshift mutation. 38
24039113 2013
43
MED12 related disorders. 38
24123922 2013
44
MED12 mutations in human diseases. 38
23836153 2013
45
CASK aberrations in male patients with Ohtahara syndrome and cerebellar hypoplasia. 38
22709267 2012
46
FG syndrome: the FGS2 locus revisited. 38
22528511 2012
47
The 22q13.3 Deletion Syndrome (Phelan-McDermid Syndrome). 38
22670140 2012
48
A novel mutation in MED12 causes FG syndrome (Opitz-Kaveggia syndrome). 38
20507344 2011
49
The FG syndrome from a pathological perspective. 38
21391746 2011
50
Behavioral features in young adults with FG syndrome (Opitz-Kaveggia syndrome). 38
20981778 2010

Variations for Opitz-Kaveggia Syndrome

ClinVar genetic disease variations for Opitz-Kaveggia Syndrome:

6 (show top 50) (show all 143)
# Gene Variation Type Significance SNP ID GRCh37 Pos GRCh38 Pos
1 MED12 NM_005120.3(MED12): c.2881C> T (p.Arg961Trp) single nucleotide variant Pathogenic rs80338758 X:70347217-70347217 X:71127367-71127367
2 MED12 NM_005120.3(MED12): c.2873G> A (p.Gly958Glu) single nucleotide variant Pathogenic rs397515554 X:70347209-70347209 X:71127359-71127359
3 MED12 NM_005120.3(MED12): c.2444G> A (p.Arg815Gln) single nucleotide variant Pathogenic rs762905361 X:70345907-70345907 X:71126057-71126057
4 MED12 NM_005120.3(MED12): c.3067A> G (p.Ile1023Val) single nucleotide variant Pathogenic rs879255526 X:70347828-70347828 X:71127978-71127978
5 MED12 NM_005120.3(MED12): c.5898dup (p.Ser1967fs) duplication Pathogenic rs879255527 X:70357647-70357647 X:71137797-71137797
6 MED12 NM_005120.3(MED12): c.1862G> A (p.Arg621Gln) single nucleotide variant Likely pathogenic rs1057519381 X:70344126-70344126 X:71124276-71124276
7 MED12 NM_005120.3(MED12): c.1546C> T (p.Arg516Cys) single nucleotide variant Likely pathogenic X:70343005-70343005 X:71123155-71123155
8 MED12 NM_005120.3(MED12): c.6241_6243CAG[5] (p.Gln2086del) short repeat Conflicting interpretations of pathogenicity rs786200971 X:70360696-70360698 X:71140846-71140848
9 MED12 NM_005120.3(MED12): c.6241_6243CAG[7] (p.Gln2086dup) short repeat Conflicting interpretations of pathogenicity rs786200971 X:70360696-70360698 X:71140846-71140848
10 MED12 NM_005120.3(MED12): c.6321_6335del (p.Gln2111_Gln2115del) deletion Conflicting interpretations of pathogenicity rs727503869 X:70361133-70361147 X:71141283-71141297
11 MED12 NM_005120.3(MED12): c.381G> A (p.Thr127=) single nucleotide variant Conflicting interpretations of pathogenicity rs202125318 X:70339712-70339712 X:71119862-71119862
12 MED12 NM_005120.3(MED12): c.5400+6C> T single nucleotide variant Conflicting interpretations of pathogenicity rs192656109 X:70356511-70356511 X:71136661-71136661
13 MED12 NM_005120.3(MED12): c.6288_6290GCA[9] (p.Gln2114_Gln2115dup) short repeat Conflicting interpretations of pathogenicity rs766775649 X:70361115-70361120 X:71141265-71141270
14 MED12 NM_005120.3(MED12): c.653C> T (p.Thr218Met) single nucleotide variant Conflicting interpretations of pathogenicity rs369083173 X:70340920-70340920 X:71121070-71121070
15 MED12 NM_005120.3(MED12): c.1695T> A (p.Ile565=) single nucleotide variant Conflicting interpretations of pathogenicity rs138984044 X:70343521-70343521 X:71123671-71123671
16 MED12 NM_005120.3(MED12): c.1849A> G (p.Thr617Ala) single nucleotide variant Conflicting interpretations of pathogenicity rs765417606 X:70344113-70344113 X:71124263-71124263
17 MED12 NM_005120.3(MED12): c.4147G> A (p.Ala1383Thr) single nucleotide variant Conflicting interpretations of pathogenicity rs863223696 X:70351950-70351950 X:71132100-71132100
18 MED12 NM_005120.3(MED12): c.3797G> A (p.Arg1266His) single nucleotide variant Conflicting interpretations of pathogenicity rs587780391 X:70349635-70349635 X:71129785-71129785
19 MED12 NM_005120.3(MED12): c.6279_6284ACAGCA[3] (p.Gln2114_Gln2115dup) short repeat Conflicting interpretations of pathogenicity rs761195801 X:70361097-70361102 X:71141247-71141252
20 MED12 NM_005120.3(MED12): c.6309_6314ACAGCA[1] (p.Gln2114_Gln2115del) short repeat Conflicting interpretations of pathogenicity rs764789036 X:70361127-70361132 X:71141277-71141282
21 MED12 NM_005120.3(MED12): c.1744+4C> T single nucleotide variant Conflicting interpretations of pathogenicity rs780750721 X:70343574-70343574 X:71123724-71123724
22 MED12 NM_005120.3(MED12): c.4238C> A (p.Thr1413Asn) single nucleotide variant Conflicting interpretations of pathogenicity rs759532414 X:70352041-70352041 X:71132191-71132191
23 MED12 NM_005120.3(MED12): c.6288_6290GCA[8] (p.Gln2115dup) short repeat Conflicting interpretations of pathogenicity rs766775649 X:70361118-70361120 X:71141268-71141270
24 MED12 NM_005120.3(MED12): c.3691+4C> T single nucleotide variant Conflicting interpretations of pathogenicity rs373381746 X:70349283-70349283 X:71129433-71129433
25 MED12 NM_005120.3(MED12): c.6309_6314ACAGCA[3] (p.Gln2114_Gln2115dup) short repeat Conflicting interpretations of pathogenicity rs764789036 X:70361115-70361116 X:71141265-71141266
26 MED12 NM_005120.3(MED12): c.1744+5G> A single nucleotide variant Uncertain significance rs368353373 X:70343575-70343575 X:71123725-71123725
27 MED12 NM_005120.3(MED12): c.616C> G (p.Arg206Gly) single nucleotide variant Uncertain significance rs1556334331 X:70340883-70340883 X:71121033-71121033
28 MED12 NM_005120.3(MED12): c.6288_6290GCA[5] (p.Gln2114_Gln2115del) short repeat Uncertain significance rs766775649 X:70361115-70361120 X:71141265-71141270
29 MED12 NM_005120.3(MED12): c.6526C> T (p.Arg2176Cys) single nucleotide variant Uncertain significance rs777818556 X:70362060-70362060 X:71142210-71142210
30 MED12 NM_005120.3(MED12): c.2545T> C (p.Ser849Pro) single nucleotide variant Uncertain significance rs1135401775 X:70346194-70346194 X:71126344-71126344
31 MED12 NM_005120.3(MED12): c.6017A> C (p.Tyr2006Ser) single nucleotide variant Uncertain significance rs769232520 X:70357766-70357766 X:71137916-71137916
32 MED12 NC_000023.10: g.(?_70348964)_(70350064_?)dup duplication Uncertain significance X:70348964-70350064 X:71129114-71130214
33 MED12 NM_005120.3(MED12): c.3796C> T (p.Arg1266Cys) single nucleotide variant Uncertain significance rs1060502168 X:70349634-70349634 X:71129784-71129784
34 MED12 NM_005120.3(MED12): c.5345G> A (p.Arg1782His) single nucleotide variant Uncertain significance rs1060502167 X:70356450-70356450 X:71136600-71136600
35 MED12 NM_005120.3(MED12): c.6177_6200ACAGCAACAGCAGCAGCAGCAGCA[1] (p.Gln2069_Gln2076del) short repeat Uncertain significance rs773709991 X:70360641-70360664 X:71140791-71140814
36 MED12 NM_005120.3(MED12): c.1030A> C (p.Thr344Pro) single nucleotide variant Uncertain significance rs1556334571 X:70341595-70341595 X:71121745-71121745
37 MED12 NM_005120.3(MED12): c.5585G> A (p.Arg1862His) single nucleotide variant Uncertain significance rs773713291 X:70357070-70357070 X:71137220-71137220
38 MED12 NM_005120.3(MED12): c.1924G> A (p.Asp642Asn) single nucleotide variant Uncertain significance rs1556335288 X:70344188-70344188 X:71124338-71124338
39 MED12 NM_005120.3(MED12): c.3125G> A (p.Ser1042Asn) single nucleotide variant Uncertain significance rs1556336419 X:70347886-70347886 X:71128036-71128036
40 MED12 NM_005120.3(MED12): c.3745C> T (p.Leu1249Phe) single nucleotide variant Uncertain significance rs1422779785 X:70349583-70349583 X:71129733-71129733
41 MED12 NM_005120.3(MED12): c.5989G> T (p.Gly1997Cys) single nucleotide variant Uncertain significance rs1556339260 X:70357738-70357738 X:71137888-71137888
42 MED12 NM_005120.3(MED12): c.5336C> T (p.Thr1779Ile) single nucleotide variant Uncertain significance rs1556338856 X:70356441-70356441 X:71136591-71136591
43 MED12 NM_005120.3(MED12): c.3587C> A (p.Thr1196Lys) single nucleotide variant Uncertain significance rs1556336812 X:70349175-70349175 X:71129325-71129325
44 MED12 NM_005120.3(MED12): c.4154C> T (p.Ala1385Val) single nucleotide variant Uncertain significance rs771349148 X:70351957-70351957 X:71132107-71132107
45 MED12 NM_005120.3(MED12): c.628G> C (p.Ala210Pro) single nucleotide variant Uncertain significance X:70340895-70340895 X:71121045-71121045
46 MED12 NM_005120.3(MED12): c.1682C> T (p.Pro561Leu) single nucleotide variant Uncertain significance rs766485358 X:70343508-70343508 X:71123658-71123658
47 MED12 NM_005120.3(MED12): c.6097A> G (p.Met2033Val) single nucleotide variant Uncertain significance rs372606012 X:70360537-70360537 X:71140687-71140687
48 MED12 NM_005120.3(MED12): c.4021C> T (p.Arg1341Trp) single nucleotide variant Uncertain significance rs777250096 X:70350038-70350038 X:71130188-71130188
49 MED12 NM_005120.3(MED12): c.568A> G (p.Ile190Val) single nucleotide variant Uncertain significance rs374780236 X:70340835-70340835 X:71120985-71120985
50 MED12 NM_005120.3(MED12): c.1039A> G (p.Ser347Gly) single nucleotide variant Uncertain significance rs752300879 X:70341604-70341604 X:71121754-71121754

UniProtKB/Swiss-Prot genetic disease variations for Opitz-Kaveggia Syndrome:

74
# Symbol AA change Variation ID SNP ID
1 MED12 p.Arg961Trp VAR_033112 rs80338758

Copy number variations for Opitz-Kaveggia Syndrome from CNVD:

7
# CNVD ID Chromosom Start End Type Gene Symbol CNVD Disease
1 264548 X 67700000 76000000 Copy number Opitz-Kaveggia syndrome

Expression for Opitz-Kaveggia Syndrome

Search GEO for disease gene expression data for Opitz-Kaveggia Syndrome.

Pathways for Opitz-Kaveggia Syndrome

Pathways related to Opitz-Kaveggia Syndrome according to KEGG:

37
# Name Kegg Source Accession
1 MAPK signaling pathway hsa04010
2 Focal adhesion hsa04510
3 Tight junction hsa04530

GO Terms for Opitz-Kaveggia Syndrome

Cellular components related to Opitz-Kaveggia Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 mediator complex GO:0016592 8.62 MED13L MED12

Molecular functions related to Opitz-Kaveggia Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 transcription coregulator activity GO:0003712 8.62 MED13L MED12

Sources for Opitz-Kaveggia Syndrome

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HGMD
31 HMDB
32 HPO
33 ICD10
34 ICD10 via Orphanet
35 ICD9CM
36 IUPHAR
37 KEGG
38 LifeMap
40 LOVD
42 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
54 NINDS
55 Novoseek
57 OMIM
58 OMIM via Orphanet
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 TGDB
71 Tocris
72 UMLS
73 UMLS via Orphanet
Content
Loading form....