OKS
MCID: OPT054
MIFTS: 56

Opitz-Kaveggia Syndrome (OKS)

Categories: Fetal diseases, Genetic diseases, Mental diseases, Neuronal diseases, Rare diseases

Aliases & Classifications for Opitz-Kaveggia Syndrome

MalaCards integrated aliases for Opitz-Kaveggia Syndrome:

Name: Opitz-Kaveggia Syndrome 56 12 52 25 58 73 13 43 39
Fg Syndrome 56 12 74 52 25 73 36 29 6 15 17 71
Keller Syndrome 56 12 52 25
Fgs1 56 52 25 73
Fgs 56 52 25 73
Oks 56 25 73
Mental Retardation, Large Head, Imperforate Anus, Congenital Hypotonia, and Partial Agenesis of Corpus Callosum 56 52
Fg Syndrome Type 1 58 73
Mental Retardation, Large Head, Imperforate Anus, Congenital Hypotonia, and Partial Agenesis of the Corpus Callosum 25
Fg Syndrome 1; Fgs1 56
Fg Syndrome; Fgs 56
Fg Syndrome 1 56

Characteristics:

OMIM:

56
Inheritance:
x-linked recessive


HPO:

31
opitz-kaveggia syndrome:
Inheritance x-linked recessive inheritance


Classifications:

Orphanet: 58  
Rare neurological diseases
Developmental anomalies during embryogenesis


Summaries for Opitz-Kaveggia Syndrome

Genetics Home Reference : 25 FG syndrome is a genetic condition that affects many parts of the body and occurs almost exclusively in males. "FG" represents the surname initials of the first family diagnosed with the disorder. FG syndrome affects intelligence and behavior. Almost everyone with the condition has intellectual disability, which ranges from mild to severe. Affected individuals tend to be friendly, inquisitive, and hyperactive, with a short attention span. Compared to people with other forms of intellectual disability, their socialization and daily living skills are strong, while verbal communication and language skills tend to be weaker. The physical features of FG syndrome include weak muscle tone (hypotonia), broad thumbs, and wide first (big) toes. Abnormalities of the tissue connecting the left and right halves of the brain (the corpus callosum) are also common. Most affected individuals have constipation, and many have abnormalities of the anus such as an obstruction of the anal opening (imperforate anus). People with FG syndrome also tend to have a distinctive facial appearance including small, underdeveloped ears; a tall, prominent forehead; and outside corners of the eyes that point downward (down-slanting palpebral fissures). Additional features seen in some people with FG syndrome include widely set eyes (hypertelorism), an upswept frontal hairline, and a large head compared to body size (relative macrocephaly). Other health problems have also been reported, including heart defects, seizures, undescended testes (cryptorchidism) in males, and a soft out-pouching in the lower abdomen (an inguinal hernia).

MalaCards based summary : Opitz-Kaveggia Syndrome, also known as fg syndrome, is related to lujan-fryns syndrome and x-linked intellectual disability with marfanoid habitus, and has symptoms including seizures and constipation. An important gene associated with Opitz-Kaveggia Syndrome is MED12 (Mediator Complex Subunit 12), and among its related pathways/superpathways are MAPK signaling pathway and Focal adhesion. The drugs Astragalus and Neuroserpin have been mentioned in the context of this disorder. Affiliated tissues include heart, brain and testes, and related phenotypes are macrocephaly and malar flattening

Disease Ontology : 12 An X-linked recessive disease characterized by retardation, hyperactivity, hypotonia, broad thumbs, big first toes and a characteristic facial appearance including macrocephaly and has an X-linked recessive inheritance pattern.

NIH Rare Diseases : 52 FG syndrome (FGS) is a genetic condition that affects many parts of the body and occurs almost exclusively in males. "FG" represents the surname initials of the first individuals diagnosed with the disorder. People with FG syndrome frequently have intellectual disability ranging from mild to severe, hypotonia , constipation and/or anal anomalies, a distinctive facial appearance, broad thumbs and great toes, a large head compared to body size (relative macrocephaly), and abnormalities of the corpus callosum . Medical problems including heart defects , seizures , undescended testicle , and an inguinal hernia have also been reported in some affected individuals. Researchers have identified five regions of the X chromosome that are linked to FG syndrome in affected families. Mutations in the MED12 gene appears to be the most common cause of this disorder, leading to FG syndrome 1. Other genes involved with FG syndrome include FLNA (FGS2), CASK (FGS4), UPF3B (FGS6), and BRWD3 (FGS7). FGS is inherited in an X-linked recessive pattern. Individualized early intervention and educational services are important so that each child can reach their fullest potential.

OMIM : 56 Opitz-Kaveggia syndrome (OKS) is an X-linked recessive mental retardation syndrome characterized by dysmorphic features, including relative macrocephaly, hypertelorism, downslanted palpebral fissures, prominent forehead with frontal hair upsweep, and broad thumbs and halluces. Most have hypotonia, constipation, and partial agenesis of the corpus callosum. Some patients have sensorineural hearing loss and joint laxity evolving into joint contractures. Affected individuals tend to be hyperactive and talkative (summary by Graham et al., 1999). In their original family, Opitz and Kaveggia (1974) named the disorder 'FG syndrome' according to the Opitz system of using initials of patients' surnames. (305450)

KEGG : 36 FG syndrome (FGS), also known as Opitz-Kaveggia syndrome, is a rare X-linked multiple congenital anomaly/mental retardation (MCA/MR) disorder characterized by high clinical variability and genetic heterogeneity. The cardinal features of the syndrome are congenital hypotonia, delayed development of speech, relative macrocephaly (as compared to height and weight), anal anomalies or severe constipation, and dysmorphic facial features. Five loci have so far been linked to this phenotype on the X chromosome. A recurrent missense mutation in the MED12 gene has been identified as the cause for the subset of FGS cases. Filamin A gene (FLNA) and CASK gene mutations could be another causes of FG syndrome.

UniProtKB/Swiss-Prot : 73 Opitz-Kaveggia syndrome: X-linked disorder characterized by mental retardation, relative macrocephaly, hypotonia and constipation.

Wikipedia : 74 FG syndrome (FGS) is a rare genetic syndrome caused by one or more recessive genes located on the X... more...

Related Diseases for Opitz-Kaveggia Syndrome

Diseases related to Opitz-Kaveggia Syndrome via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 228)
# Related Disease Score Top Affiliating Genes
1 lujan-fryns syndrome 32.8 UPF3B MED12
2 x-linked intellectual disability with marfanoid habitus 30.4 UPF3B MED12
3 pathologic nystagmus 29.9 MED12 CRYZL1 CASK
4 congenital nystagmus 29.9 CRYZL1 CASK
5 fg syndrome 3 12.5
6 fg syndrome 5 12.4
7 cask-related disorders 11.6
8 vaccinia 11.6
9 focal segmental glomerulosclerosis 11.5
10 fg syndrome 4 11.4
11 ulnar neuropathy 11.3
12 fg syndrome 2 11.3
13 syndromic x-linked intellectual disability 14 11.2
14 med12-related disorders 10.7
15 hypotonia 10.6
16 anus, imperforate 10.5
17 alacrima, achalasia, and mental retardation syndrome 10.4
18 constipation 10.4
19 fryns syndrome 10.4 UPF3B MED12
20 alzheimer disease 10.3
21 lymphopenia 10.3
22 osteoarthritis 10.3
23 multiple congenital anomalies/dysmorphic syndrome-intellectual disability 10.3
24 thoracic benign neoplasm 10.3 MED12 CDK8 CCNC
25 breast benign neoplasm 10.3 MED12 CDK8 CCNC
26 uterine benign neoplasm 10.3 MED12 CDK8 CCNC
27 pancreatic cancer 10.3
28 hypertelorism 10.3
29 reproductive organ benign neoplasm 10.2 MED12 CDK8 CCNC
30 anxiety 10.2
31 nephrotic syndrome 10.2
32 med23 10.2 MED23 CCNC
33 diabetes mellitus, insulin-dependent, 2 10.2
34 diabetes mellitus, insulin-dependent 10.2
35 filariasis 10.2
36 pertussis 10.2
37 spasticity 10.2
38 diabetes mellitus, insulin-dependent, 3 10.2
39 human immunodeficiency virus type 1 10.2
40 splenomegaly 10.2
41 ataxia and polyneuropathy, adult-onset 10.1
42 rapidly involuting congenital hemangioma 10.1
43 ohdo syndrome 10.1 MED13L MED13 MED12 CDK19
44 cryptorchidism, unilateral or bilateral 10.1
45 hypospadias 10.1
46 diabetes mellitus, insulin-dependent, 4 10.1
47 gastric cancer 10.1
48 cardiac arrest 10.1
49 myopia 10.1
50 acute leukemia 10.1

Graphical network of the top 20 diseases related to Opitz-Kaveggia Syndrome:



Diseases related to Opitz-Kaveggia Syndrome

Symptoms & Phenotypes for Opitz-Kaveggia Syndrome

Human phenotypes related to Opitz-Kaveggia Syndrome:

58 31 (show top 50) (show all 109)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 macrocephaly 58 31 frequent (33%) Frequent (79-30%) HP:0000256
2 malar flattening 58 31 frequent (33%) Frequent (79-30%) HP:0000272
3 hypertelorism 58 31 frequent (33%) Frequent (79-30%) HP:0000316
4 high palate 58 31 frequent (33%) Frequent (79-30%) HP:0000218
5 global developmental delay 58 31 frequent (33%) Frequent (79-30%) HP:0001263
6 inguinal hernia 58 31 frequent (33%) Frequent (79-30%) HP:0000023
7 delayed speech and language development 58 31 frequent (33%) Frequent (79-30%) HP:0000750
8 pes planus 58 31 frequent (33%) Frequent (79-30%) HP:0001763
9 microtia 58 31 frequent (33%) Frequent (79-30%) HP:0008551
10 thick vermilion border 58 31 frequent (33%) Frequent (79-30%) HP:0012471
11 short stature 58 31 frequent (33%) Frequent (79-30%) HP:0004322
12 cryptorchidism 58 31 frequent (33%) Frequent (79-30%) HP:0000028
13 micrognathia 58 31 frequent (33%) Frequent (79-30%) HP:0000347
14 downslanted palpebral fissures 58 31 frequent (33%) Frequent (79-30%) HP:0000494
15 intellectual disability, moderate 58 31 frequent (33%) Frequent (79-30%) HP:0002342
16 long philtrum 58 31 frequent (33%) Frequent (79-30%) HP:0000343
17 strabismus 58 31 frequent (33%) Frequent (79-30%) HP:0000486
18 prominent occiput 58 31 frequent (33%) Frequent (79-30%) HP:0000269
19 broad neck 58 31 frequent (33%) Frequent (79-30%) HP:0000475
20 atrial septal defect 58 31 frequent (33%) Frequent (79-30%) HP:0001631
21 ventriculomegaly 58 31 frequent (33%) Frequent (79-30%) HP:0002119
22 optic nerve hypoplasia 58 31 frequent (33%) Frequent (79-30%) HP:0000609
23 wide mouth 58 31 frequent (33%) Frequent (79-30%) HP:0000154
24 hypospadias 58 31 frequent (33%) Frequent (79-30%) HP:0000047
25 high forehead 58 31 frequent (33%) Frequent (79-30%) HP:0000348
26 slender build 58 31 frequent (33%) Frequent (79-30%) HP:0001533
27 dental crowding 58 31 frequent (33%) Frequent (79-30%) HP:0000678
28 small pituitary gland 58 31 frequent (33%) Frequent (79-30%) HP:0012506
29 pyloric stenosis 58 31 frequent (33%) Frequent (79-30%) HP:0002021
30 drooling 58 31 frequent (33%) Frequent (79-30%) HP:0002307
31 stenosis of the external auditory canal 58 31 frequent (33%) Frequent (79-30%) HP:0000402
32 plagiocephaly 58 31 frequent (33%) Frequent (79-30%) HP:0001357
33 premature birth 58 31 frequent (33%) Frequent (79-30%) HP:0001622
34 abnormal cerebellum morphology 58 31 frequent (33%) Frequent (79-30%) HP:0001317
35 aplasia/hypoplasia of the corpus callosum 58 31 frequent (33%) Frequent (79-30%) HP:0007370
36 abnormality of the sternum 58 31 frequent (33%) Frequent (79-30%) HP:0000766
37 prominent nose 58 31 frequent (33%) Frequent (79-30%) HP:0000448
38 cupped ear 58 31 frequent (33%) Frequent (79-30%) HP:0000378
39 generalized neonatal hypotonia 58 31 frequent (33%) Frequent (79-30%) HP:0008935
40 broad toe 58 31 frequent (33%) Frequent (79-30%) HP:0001837
41 malrotation of colon 58 31 frequent (33%) Frequent (79-30%) HP:0004785
42 generalized joint laxity 58 31 frequent (33%) Frequent (79-30%) HP:0002761
43 widely patent fontanelles and sutures 58 31 frequent (33%) Frequent (79-30%) HP:0004492
44 broad-based gait 58 31 frequent (33%) Frequent (79-30%) HP:0002136
45 fused teeth 58 31 frequent (33%) Frequent (79-30%) HP:0011090
46 frontal upsweep of hair 58 31 frequent (33%) Frequent (79-30%) HP:0002236
47 limited elbow extension and supination 58 31 frequent (33%) Frequent (79-30%) HP:0005852
48 finger syndactyly 58 31 occasional (7.5%) Occasional (29-5%) HP:0006101
49 seizures 58 31 occasional (7.5%) Occasional (29-5%) HP:0001250
50 constipation 58 31 occasional (7.5%) Occasional (29-5%) HP:0002019

Symptoms via clinical synopsis from OMIM:

56
Head And Neck Head:
macrocephaly
plagiocephaly
large anterior fontanel

Head And Neck Neck:
short neck

Skeletal Hands:
clinodactyly
single transverse palmar crease
camptodactyly
syndactyly
broad thumbs
more
Genitourinary Internal Genitalia Male:
inguinal hernia
cryptorchidism

Abdomen External Features:
umbilical hernia

Head And Neck Face:
micrognathia
prominent forehead
long philtrum
frontal hair upsweep

Skin Nails Hair Skin:
sacral dimple
single transverse palmar crease
facial wrinkling
persistent fetal fingertip pads
perianal skin tags

Respiratory Nasopharynx:
choanal atresia

Skin Nails Hair Hair:
fine hair
sparse hair
frontal hair upsweep

Skeletal Spine:
lumbar hyperlordosis

Voice:
high-pitched voice

Skeletal Skull:
delayed closure of anterior fontanel

Head And Neck Eyes:
hypertelorism
strabismus
downslanting palpebral fissures
epicanthal folds
medial eyebrow flare

Neurologic Central Nervous System:
agenesis of corpus callosum
seizures
hydrocephalus
global developmental delay
neonatal hypotonia
more
Abdomen Gastrointestinal:
constipation
pyloric stenosis
anteriorly placed anus
anal stenosis
imperforate anus
more
Head And Neck Mouth:
narrow palate
cleft palate
cleft lip
large mouth
prominent lower lip

Growth Height:
short stature

Neurologic Behavioral Psychiatric Manifestations:
hyperactivity
attention deficit disorder
friendly, sociable personality

Genitourinary External Genitalia Male:
hypospadias

Head And Neck Teeth:
dental crowding

Head And Neck Nose:
prominent nose

Head And Neck Ears:
small ears
hearing loss, sensorineural

Skeletal Limbs:
joint contractures
joint hyperlaxity (infancy)

Skeletal Feet:
broad halluces

Clinical features from OMIM:

305450

UMLS symptoms related to Opitz-Kaveggia Syndrome:


seizures, constipation

GenomeRNAi Phenotypes related to Opitz-Kaveggia Syndrome according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Decreased substrate adherent cell growth GR00193-A-1 9.26 CASK CDK19 CDK8
2 Decreased substrate adherent cell growth GR00193-A-4 9.26 CASK
3 Increased cell death HMECs cells GR00103-A-0 9.02 CASK CCNC CDK19 MED23 MID2

Drugs & Therapeutics for Opitz-Kaveggia Syndrome

Drugs for Opitz-Kaveggia Syndrome (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):


# Name Status Phase Clinical Trials Cas Number PubChem Id
1 Astragalus
2 Neuroserpin

Interventional clinical trials:


# Name Status NCT ID Phase Drugs
1 Genetic Disease Gene Identification Unknown status NCT00916903

Search NIH Clinical Center for Opitz-Kaveggia Syndrome

Cochrane evidence based reviews: opitz-kaveggia syndrome

Genetic Tests for Opitz-Kaveggia Syndrome

Genetic tests related to Opitz-Kaveggia Syndrome:

# Genetic test Affiliating Genes
1 Fg Syndrome 29 MED12

Anatomical Context for Opitz-Kaveggia Syndrome

MalaCards organs/tissues related to Opitz-Kaveggia Syndrome:

40
Heart, Brain, Testes, Eye, T Cells, Skin, Cerebellum

Publications for Opitz-Kaveggia Syndrome

Articles related to Opitz-Kaveggia Syndrome:

(show top 50) (show all 101)
# Title Authors PMID Year
1
A recurrent mutation in MED12 leading to R961W causes Opitz-Kaveggia syndrome. 61 56 6
17334363 2007
2
FG syndrome, an X-linked multiple congenital anomaly syndrome: the clinical phenotype and an algorithm for diagnostic testing. 61 56
19938245 2009
3
Behavior of 10 patients with FG syndrome (Opitz-Kaveggia syndrome) and the p.R961W mutation in the MED12 gene. 61 56
18973276 2008
4
Mediator links epigenetic silencing of neuronal gene expression with x-linked mental retardation. 61 6
18691967 2008
5
MED12-Related Disorders 61 6
20301719 2008
6
The FG syndrome: report of a large Italian series. 61 56
16691600 2006
7
Skewed X chromosome inactivation in carriers is not a constant finding in FG syndrome. 61 56
12700610 2003
8
Mapping of X chromosome inversion breakpoints [inv(X)(q11q28)] associated with FG syndrome: a second FG locus [FGS2]? 61 56
11078572 2000
9
Exclusion of nine candidate genes for their involvement in X-linked FG syndrome (FGS1) in three families. 61 56
11050623 2000
10
Esophageal dysmotility in brothers with an FG-like syndrome. 61 56
10756339 2000
11
Paracentric inversion of the X chromosome [inv(X)(q12q28)] in familial FG syndrome. 61 56
10449643 1999
12
Clinical and behavioral characteristics in FG syndrome. 61 56
10405444 1999
13
FG syndrome: report of three new families with linkage to Xq12-q22.1. 61 56
9805132 1998
14
Syndromal foramina parietalia permagna: "new" or FG syndrome? Comments on the paper by Chrzanowska et al [1998]. 61 56
9714004 1998
15
A gene for FG syndrome maps in the Xq12-q21.31 region. 61 56
9375929 1997
16
FG syndrome: the trias mental retardation, hypotonia and constipation reviewed. 61 56
8775418 1995
17
Japanese kindred with FG syndrome. 61 56
7802020 1994
18
A clinical follow-up of British patients with FG syndrome. 61 56
8055129 1994
19
X linked mental retardation: a family with a separate syndrome? 61 56
2738899 1989
20
FG syndrome update 1988: note of 5 new patients and bibliography. 61 56
3052062 1988
21
FG syndrome. 61 56
3572995 1987
22
Necropsy findings in a child with FG syndrome. 61 56
3746847 1986
23
The FG syndrome: 7 new cases. 61 56
4017279 1985
24
Diagnostic definition of the FG syndrome. 61 56
6507483 1984
25
FG syndrome in a premature male. 61 56
6507484 1984
26
Sensorineural deafness in the FG syndrome: report on four new cases. 61 56
6542310 1984
27
Two retarded male cousins with odd facies, hypotonia, and severe constipation: possible examples of the X linked FG syndrome. 61 56
6682449 1983
28
Studies of malformation syndromes of humans XXXIIIC: the FG syndrome - further studies on three affected individuals from the FG family. 61 56
7201743 1982
29
The FG syndrome: further characterization, report of a third family, and of a sporadic case. 61 56
565138 1977
30
Studies of malformation syndromes of man 33: the FG syndrome. An X-linked recessive syndrome of multiple congenital anomalies and mental retardation. 61 56
4365204 1974
31
Syndromic foramina parietalia permagna. 56
9714003 1998
32
A new syndrome of mental deficiency with craniofacial, limb, and anal abnormalities. 56
1255317 1976
33
HEREDITARY PARTIAL AGENESIS OF CORPUS CALLOSUM; BIOCHEMICAL AND PATHOLOGICAL STUDIES. 56
14158525 1964
34
A male infant with Xq22.2q22.3 duplication containing PLP1 and MID2. 61
31951325 2020
35
[Long-term efficacy analysis of laparoscopic-assisted anorectoplasty for high and middle imperforate anus]. 61
31874535 2019
36
MED12 missense mutation in a three-generation family. Clinical characterization of MED12-related disorders and literature review. 61
31536828 2019
37
Dysregulations of sonic hedgehog signaling in MED12-related X-linked intellectual disability disorders. 61
30729724 2019
38
Familial Ebstein Anomaly: Whole Exome Sequencing Identifies Novel Phenotype Associated With FLNA. 61
29237676 2017
39
A novel variant in MED12 gene: Further delineation of phenotype. 61
28544239 2017
40
A novel CASK mutation identified in siblings exhibiting developmental disorders with/without microcephaly. 61
28944139 2017
41
A de novo splice site mutation in CASK causes FG syndrome-4 and congenital nystagmus. 61
28139025 2017
42
De novo mutations in genes of mediator complex causing syndromic intellectual disability: mediatorpathy or transcriptomopathy? 61
27500536 2016
43
Two male sibs with severe micrognathia and a missense variant in MED12. 61
27286923 2016
44
Blepharophimosis, short humeri, developmental delay and hirschsprung disease: expanding the phenotypic spectrum of MED12 mutations. 61
24715367 2014
45
Clinical and neurocognitive characterization of a family with a novel MED12 gene frameshift mutation. 61
24039113 2013
46
MED12 related disorders. 61
24123922 2013
47
MED12 mutations in human diseases. 61
23836153 2013
48
CASK aberrations in male patients with Ohtahara syndrome and cerebellar hypoplasia. 61
22709267 2012
49
FG syndrome: the FGS2 locus revisited. 61
22528511 2012
50
The 22q13.3 Deletion Syndrome (Phelan-McDermid Syndrome). 61
22670140 2012

Variations for Opitz-Kaveggia Syndrome

ClinVar genetic disease variations for Opitz-Kaveggia Syndrome:

6 (show top 50) (show all 107) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 MED12 NM_005120.3(MED12):c.2881C>T (p.Arg961Trp)SNV Pathogenic 11520 rs80338758 X:70347217-70347217 X:71127367-71127367
2 MED12 NM_005120.3(MED12):c.2873G>A (p.Gly958Glu)SNV Pathogenic 65683 rs397515554 X:70347209-70347209 X:71127359-71127359
3 MED12 NM_005120.3(MED12):c.2444G>A (p.Arg815Gln)SNV Pathogenic 252962 rs762905361 X:70345907-70345907 X:71126057-71126057
4 MED12 NM_005120.3(MED12):c.3067A>G (p.Ile1023Val)SNV Pathogenic 252963 rs879255526 X:70347828-70347828 X:71127978-71127978
5 MED12 NM_005120.3(MED12):c.5898dup (p.Ser1967fs)duplication Pathogenic 252964 rs879255527 X:70357641-70357642 X:71137791-71137792
6 MED12 NM_005120.3(MED12):c.1862G>A (p.Arg621Gln)SNV Likely pathogenic 225253 rs1057519381 X:70344126-70344126 X:71124276-71124276
7 MED12 NM_005120.3(MED12):c.1546C>T (p.Arg516Cys)SNV Likely pathogenic 619013 rs1569481124 X:70343005-70343005 X:71123155-71123155
8 MED12 NM_005120.3(MED12):c.3505G>T (p.Ala1169Ser)SNV Likely pathogenic 666337 X:70348993-70348993 X:71129143-71129143
9 MED12 NM_005120.3(MED12):c.224G>C (p.Ser75Thr)SNV Likely pathogenic 804025 X:70339555-70339555 X:71119705-71119705
10 MED12 NM_005120.3(MED12):c.6309_6314ACAGCA[3] (p.Gln2114_Gln2115dup)short repeat Conflicting interpretations of pathogenicity 445536 rs764789036 X:70361115-70361116 X:71141265-71141266
11 MED12 NM_005120.3(MED12):c.6309_6314ACAGCA[1] (p.Gln2114_Gln2115del)short repeat Conflicting interpretations of pathogenicity 458830 rs764789036 X:70361116-70361121 X:71141266-71141271
12 MED12 NM_005120.3(MED12):c.6279_6284ACAGCA[3] (p.Gln2114_Gln2115dup)short repeat Conflicting interpretations of pathogenicity 509645 rs761195801 X:70361085-70361086 X:71141235-71141236
13 MED12 NM_005120.3(MED12):c.6241_6243CAG[7] (p.Gln2086dup)short repeat Conflicting interpretations of pathogenicity 166876 rs786200971 X:70360679-70360680 X:71140829-71140830
14 MED12 NM_005120.3(MED12):c.6321_6335del (p.Gln2111_Gln2115del)deletion Conflicting interpretations of pathogenicity 166877 rs727503869 X:70361122-70361136 X:71141272-71141286
15 MED12 NM_005120.3(MED12):c.6288_6290GCA[9] (p.Gln2114_Gln2115dup)short repeat Conflicting interpretations of pathogenicity 197488 rs766775649 X:70361097-70361098 X:71141247-71141248
16 MED12 NM_005120.3(MED12):c.1849A>G (p.Thr617Ala)SNV Conflicting interpretations of pathogenicity 213633 rs765417606 X:70344113-70344113 X:71124263-71124263
17 MED12 NM_005120.3(MED12):c.4147G>A (p.Ala1383Thr)SNV Conflicting interpretations of pathogenicity 213624 rs863223696 X:70351950-70351950 X:71132100-71132100
18 MED12 NM_005120.3(MED12):c.6241_6243CAG[5] (p.Gln2086del)short repeat Conflicting interpretations of pathogenicity 213650 rs786200971 X:70360680-70360682 X:71140830-71140832
19 MED12 NM_005120.3(MED12):c.1744+4C>TSNV Conflicting interpretations of pathogenicity 388498 rs780750721 X:70343574-70343574 X:71123724-71123724
20 MED12 NM_005120.3(MED12):c.3691+4C>TSNV Conflicting interpretations of pathogenicity 408884 rs373381746 X:70349283-70349283 X:71129433-71129433
21 MED12 NM_005120.3(MED12):c.4238C>A (p.Thr1413Asn)SNV Conflicting interpretations of pathogenicity 408880 rs759532414 X:70352041-70352041 X:71132191-71132191
22 MED12 NM_005120.3(MED12):c.6288_6290GCA[8] (p.Gln2115dup)short repeat Conflicting interpretations of pathogenicity 418565 rs766775649 X:70361097-70361098 X:71141247-71141248
23 MED12 NM_005120.3(MED12):c.6526C>T (p.Arg2176Cys)SNV Uncertain significance 426569 rs777818556 X:70362060-70362060 X:71142210-71142210
24 MED12 NM_005120.3(MED12):c.2545T>C (p.Ser849Pro)SNV Uncertain significance 431098 rs1135401775 X:70346194-70346194 X:71126344-71126344
25 MED12 NM_005120.3(MED12):c.6017A>C (p.Tyr2006Ser)SNV Uncertain significance 435845 rs769232520 X:70357766-70357766 X:71137916-71137916
26 MED12 NM_005120.3(MED12):c.1744+5G>ASNV Uncertain significance 408882 rs368353373 X:70343575-70343575 X:71123725-71123725
27 MED12 NC_000023.10:g.(?_70348964)_(70350064_?)dupduplication Uncertain significance 417448 X:70348964-70350064 X:71129114-71130214
28 MED12 NM_005120.3(MED12):c.3796C>T (p.Arg1266Cys)SNV Uncertain significance 408881 rs1060502168 X:70349634-70349634 X:71129784-71129784
29 MED12 NM_005120.3(MED12):c.5345G>A (p.Arg1782His)SNV Uncertain significance 408879 rs1060502167 X:70356450-70356450 X:71136600-71136600
30 MED12 NM_005120.3(MED12):c.6177_6200ACAGCAACAGCAGCAGCAGCAGCA[1] (p.Gln2069_Gln2076del)short repeat Uncertain significance 408883 rs773709991 X:70360609-70360632 X:71140759-71140782
31 MED12 NM_005120.3(MED12):c.4028G>A (p.Arg1343His)SNV Uncertain significance 220794 rs201044355 X:70350045-70350045 X:71130195-71130195
32 MED12 NM_005120.3(MED12):c.6097A>G (p.Met2033Val)SNV Uncertain significance 213627 rs372606012 X:70360537-70360537 X:71140687-71140687
33 MED12 NM_005120.3(MED12):c.4021C>T (p.Arg1341Trp)SNV Uncertain significance 213641 rs777250096 X:70350038-70350038 X:71130188-71130188
34 MED12 NM_005120.3(MED12):c.1039A>G (p.Ser347Gly)SNV Uncertain significance 213631 rs752300879 X:70341604-70341604 X:71121754-71121754
35 MED12 NM_005120.3(MED12):c.1264C>T (p.Arg422Trp)SNV Uncertain significance 213632 rs368913305 X:70342373-70342373 X:71122523-71122523
36 MED12 NM_005120.3(MED12):c.5922G>T (p.Gln1974His)SNV Uncertain significance 252965 rs879255528 X:70357671-70357671 X:71137821-71137821
37 MED12 NM_005120.3(MED12):c.4253+4G>ASNV Uncertain significance 264566 rs750162341 X:70352060-70352060 X:71132210-71132210
38 MED12 NM_005120.3(MED12):c.568A>G (p.Ile190Val)SNV Uncertain significance 134638 rs374780236 X:70340835-70340835 X:71120985-71120985
39 MED12 NM_005120.3(MED12):c.2068A>G (p.Thr690Ala)SNV Uncertain significance 240095 rs878854752 X:70344838-70344838 X:71124988-71124988
40 MED12 NM_005120.3(MED12):c.5585G>A (p.Arg1862His)SNV Uncertain significance 458820 rs773713291 X:70357070-70357070 X:71137220-71137220
41 MED12 NM_005120.3(MED12):c.4154C>T (p.Ala1385Val)SNV Uncertain significance 528482 rs771349148 X:70351957-70351957 X:71132107-71132107
42 MED12 NM_005120.3(MED12):c.628G>C (p.Ala210Pro)SNV Uncertain significance 560275 rs1379201163 X:70340895-70340895 X:71121045-71121045
43 MED12 NM_005120.3(MED12):c.1963A>G (p.Ser655Gly)SNV Uncertain significance 570289 rs1569481250 X:70344227-70344227 X:71124377-71124377
44 MED12 NM_005120.3(MED12):c.2422+6T>GSNV Uncertain significance 572431 rs1569481413 X:70345569-70345569 X:71125719-71125719
45 MED12 NM_005120.3(MED12):c.6186_6188GCA[3] (p.Gln2075_Gln2076del)short repeat Uncertain significance 578555 rs754533796 X:70360624-70360629 X:71140774-71140779
46 MED12 NM_005120.3(MED12):c.1619G>A (p.Arg540His)SNV Uncertain significance 578754 rs774363039 X:70343445-70343445 X:71123595-71123595
47 MED12 NM_005120.3(MED12):c.3693G>T (p.Gly1231=)SNV Uncertain significance 576481 rs965896553 X:70349531-70349531 X:71129681-71129681
48 MED12 NM_005120.3(MED12):c.5192G>A (p.Arg1731Lys)SNV Uncertain significance 571606 rs1569482278 X:70356297-70356297 X:71136447-71136447
49 MED12 NM_005120.3(MED12):c.6288_6290GCA[6] (p.Gln2115del)short repeat Uncertain significance 573087 rs766775649 X:70361098-70361100 X:71141248-71141250
50 MED12 NM_005120.3(MED12):c.616C>G (p.Arg206Gly)SNV Uncertain significance 458822 rs1556334331 X:70340883-70340883 X:71121033-71121033

UniProtKB/Swiss-Prot genetic disease variations for Opitz-Kaveggia Syndrome:

73
# Symbol AA change Variation ID SNP ID
1 MED12 p.Arg961Trp VAR_033112 rs80338758

Copy number variations for Opitz-Kaveggia Syndrome from CNVD:

7
# CNVD ID Chromosome Start End Type Gene Symbol CNVD Disease
1 264548 X 67700000 76000000 Copy number Opitz-Kaveggia syndrome

Expression for Opitz-Kaveggia Syndrome

Search GEO for disease gene expression data for Opitz-Kaveggia Syndrome.

Pathways for Opitz-Kaveggia Syndrome

Pathways related to Opitz-Kaveggia Syndrome according to KEGG:

36
# Name Kegg Source Accession
1 MAPK signaling pathway hsa04010
2 Focal adhesion hsa04510
3 Tight junction hsa04530

Pathways related to Opitz-Kaveggia Syndrome according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1
Show member pathways
12.77 MED23 MED13L MED13 MED12 DLG3 CDK8
2
Show member pathways
12.58 MED23 MED13 MED12 CDK8 CCNC
3
Show member pathways
11.94 MED23 MED13L MED13 MED12 CDK8 CDK19
4 11.41 MED13L MED13 MED12
5 10.76 CDK8 CCNC

GO Terms for Opitz-Kaveggia Syndrome

Cellular components related to Opitz-Kaveggia Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 mediator complex GO:0016592 9.17 MED23 MED13L MED13 MED12 CDK8 CDK19

Biological processes related to Opitz-Kaveggia Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 regulation of transcription by RNA polymerase II GO:0006357 9.43 MED23 MED13L MED13 MED12 CCNC ATOH7
2 transcription initiation from RNA polymerase II promoter GO:0006367 9.02 MED23 MED13 MED12 CDK8 CCNC

Molecular functions related to Opitz-Kaveggia Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 thyroid hormone receptor binding GO:0046966 9.32 MED13 MED12
2 cyclin-dependent protein serine/threonine kinase activity GO:0004693 9.26 CDK8 CDK19
3 RNA polymerase II CTD heptapeptide repeat kinase activity GO:0008353 9.16 CDK8 CDK19
4 vitamin D receptor binding GO:0042809 8.96 MED13 MED12
5 transcription coregulator activity GO:0003712 8.8 MED13L MED13 MED12

Sources for Opitz-Kaveggia Syndrome

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....