Home
User Guide
What's in a MalaCard Search Guide Our Sources
Analysis Tools
GeneCards GeneAnalytics GeneAlaCart PathCards VarElect TGex
News and Views Disease Lists/Categories
About
About MalaCards Datasets Our Publications Weizmann Institute LifeMap Discovery® Terms of Use MalaCards Team
TSE
MCID: PRN023
MIFTS: 57

Prion Disease (TSE)

Categories: Genetic diseases, Mental diseases, Neuronal diseases, Rare diseases
Genes Variations Tissues Related diseases Publications Pathways Drugs
Sources

Aliases & Classifications for Prion Disease

About this section

MalaCards integrated aliases for Prion Disease:

Name: Prion Disease 12 25 36 15 39 17
Prion Diseases 53 54 43 71
Transmissible Spongiform Encephalopathies 25 53 3
Transmissible Spongiform Encephalopathy 12 58
Spongiform Encephalopathy 12 74
Prion Disease Pathway 12 71
Human Transmissible Spongiform Encephalopathies, Inherited 71
Inherited Human Transmissible Spongiform Encephalopathies 25
Prion Disease, Susceptibility to 6
Spongiform Encephalopathies 15
Prion-Associated Disorders 25
Prion-Induced Disorders 25
Transmissible Dementias 25
Prion Induced Disorder 12
Prion Protein Diseases 25
Prion Protein Disease 12
Human Prion Disease 58
Tses 25
Tse 58

Characteristics:

Orphanet epidemiological data:

58
human prion disease
Age of onset: Adult;

Classifications:

MalaCards categories:
Global: Rare diseases Genetic diseases
Anatomical: Neuronal diseases Mental diseases
See all MalaCards categories (disease lists)
ICD10: 32 33
Orphanet: 58  
Rare neurological diseases


External Ids:

Disease Ontology 12 DOID:649
KEGG 36 H00061
MeSH 43 D017096
NCIt 49 C128346
SNOMED-CT 67 20484008
ICD10 32 A81.9
ICD10 via Orphanet 33 A81.0 A81.1 A81.8 more
UMLS via Orphanet 72 C0162534
Orphanet 58 ORPHA56970
UMLS 71 C0162534 C0751645 C3536911
Sources

Summaries for Prion Disease

About this section
NINDS : 53 Transmissible spongiform encephalopathies (TSEs), also known as prion diseases, are a group of rare degenerative brain disorders characterized by tiny holes that give the brain a "spongy" appearance. These holes can be seen when brain tissue is viewed under a microscope. Creutzfeldt-Jakob disease (CJD) is the most well-known of the human TSEs. It is a rare type of dementia that affects about one in every one million people each year. Other human TSEs include kuru, fatal familial insomnia (FFI), and Gerstmann-Straussler-Scheinker disease (GSS). Kuru was identified in people of an isolated tribe in Papua New Guinea and has now almost disappeared. FFI and GSS are extremely rare hereditary diseases, found in just a few families around the world. A new type of CJD, called variant CJD (vCJD), was first described in 1996 and has been found in Great Britain and several other European countries. The initial symptoms of vCJD are different from those of classic CJD and the disorder typically occurs in younger patients. Research suggests that vCJD may have resulted from human consumption of beef from cattle with a TSE disease called bovine spongiform encephalopathy (BSE), also known as "mad cow disease." Other TSEs found in animals include scrapie, which affects sheep and goats; chronic wasting disease, which affects elk and deer; and transmissible mink encephalopathy. In a few rare cases, TSEs have occurred in other mammals such as zoo animals. These cases are probably caused by contaminated feed. CJD and other TSEs also can be transmitted experimentally to mice and other animals in the laboratory. Research suggests that TSEs are caused by an abnormal version of a protein called a prion (prion is short forproteinaceous infectious particle). Prion proteins occur in both a normal form, which is a harmless protein found in the body's cells, and in an infectious form, which causes disease. The harmless and infectious forms of the prion protein are nearly identical, but the infectious form takes on a different folded shape from the normal protein. Human TSEs can occur three ways: sporadically; as hereditary diseases; or through transmission from infected individuals. Sporadic TSEs may develop because some of a person's normal prions spontaneously change into the infectious form of the protein and then alter the prions in other cells in a chain reaction. Inherited cases arise from a change, or mutation, in the prion protein gene that causes the prions to be shaped in an abnormal way. This genetic change may be transmitted to an individual's offspring. Transmission of TSEs from infected individuals is relatively rare. TSEs cannot be transmitted through the air or through touching or most other forms of casual contact. However, they may be transmitted through contact with infected tissue, body fluids, or contaminated medical instruments. Normal sterilization procedures such as boiling or irradiating materials do not prevent transmission of TSEs. Symptoms of TSEs vary, but they commonly include personality changes, psychiatric problems such as depression, lack of coordination, and/or an unsteady gait. Patients also may experience involuntary jerking movements called myoclonus, unusual sensations, insomnia, confusion, or memory problems. In the later stages of the disease, patients have severe mental impairment and lose the ability to move or speak.

MalaCards based summary : Prion Disease, also known as prion diseases, is related to gerstmann-straussler disease and kuru. An important gene associated with Prion Disease is PRNP (Prion Protein), and among its related pathways/superpathways are Prion diseases and Neuroscience. The drugs Glycerol and Coal tar have been mentioned in the context of this disorder. Affiliated tissues include brain, testes and cortex, and related phenotypes are growth/size/body region and cellular

Disease Ontology : 12 A brain disease that is characterized by brain damage resulting from the abnormal folding, clumping and accumulation of cellular proteins in the brain induced by prion proteins.

Genetics Home Reference : 25 Prion disease represents a group of conditions that affect the nervous system in humans and animals. In people, these conditions impair brain function, causing changes in memory, personality, and behavior; a decline in intellectual function (dementia); and abnormal movements, particularly difficulty with coordinating movements (ataxia). The signs and symptoms of prion disease typically begin in adulthood and worsen with time, leading to death within a few months to several years.

CDC : 3 Prion diseases or transmissible spongiform encephalopathies (TSEs) are a family of rare progressive neurodegenerative disorders that affect both humans and animals. They are distinguished by long incubation periods, characteristic spongiform changes associated with neuronal loss, and a failure to induce inflammatory response. The causative agents of TSEs are believed to be prions. The term "prions" refers to abnormal, pathogenic agents that are transmissible and are able to induce abnormal folding of specific normal cellular proteins called prion proteins that are found most abundantly in the brain. The functions of these normal prion proteins are still not completely understood. The abnormal folding of the prion proteins leads to brain damage and the characteristic signs and symptoms of the disease. Prion diseases are usually rapidly progressive and always fatal.

KEGG : 36 Prion diseases, also termed transmissible spongiform encephalopathies (TSEs), are a group of fatal neurodegenerative diseases that affect humans and a number of other animal species. The etiology of these diseases is thought to be associated with the conversion of a normal protein, PrPC, into an infectious, pathogenic form, PrPSc. The conversion is induced by prion infections (for example, variant Creutzfeldt-Jakob disease (vCJD), iatrogenic CJD, Kuru), mutations (familial CJD, Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia (FFI)) or unknown factors (sporadic CJD (sCJD)), and is thought to occur after PrPC has reached the plasma membrane or is re-internalized for degradation. The PrPSc form shows greater protease resistance than PrPC and accumulates in affected individuals, often in the form of extracellular plaques. Pathways that may lead to neuronal death comprise oxidative stress, regulated activation of complement, ubiquitin-proteasome and endosomal-lysosomal systems, synaptic alterations and dendritic atrophy, corticosteroid response, and endoplasmic reticulum stress. In addition, the conformational transition could lead to the lost of a beneficial activity of the natively folded protein, PrPC.

Wikipedia : 74 Transmissible spongiform encephalopathies (TSEs) are a group of progressive, invariably fatal,... more...

Sources

Related Diseases for Prion Disease

About this section

Diseases in the Prion Disease family:

Inherited Human Prion Disease Sporadic Human Prion Disease
Acquired Human Prion Disease

Diseases related to Prion Disease via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 295)
# Related Disease Score Top Affiliating Genes
1 gerstmann-straussler disease 33.3 SPRN PRNP PRND MSMB MIR342 MAPT
2 kuru 33.3 SPRN PRNP PRND MSMB APP
3 creutzfeldt-jakob disease 33.2 SPRN SERPINA3 RPSA PRNP PRND MSMB
4 fatal familial insomnia 33.2 SPRN SERPINA3 PRNP PRND MSMB MAPT
5 chronic wasting disease 33.1 SPRN RPSA PRNP PRND MSMB CR2
6 scrapie 31.6 SPRN SERPINA3 RPSA PRNP PRND MSMB
7 akinetic mutism 31.3 PRNP MAPT ENO2
8 dementia 31.1 SERPINA3 PRNP MAPT MAP2 IL1B APP
9 leukoencephalopathy, hereditary diffuse, with spheroids 31.1 PRNP MAPT MAP2 APP
10 amyloidosis 31.1 SERPINA3 PRNP MAPT IL1B APP
11 neuroblastoma 31.0 SOD2 PRNP MAPT MAP2 IL1B ENO2
12 cerebral amyloid angiopathy, cst3-related 31.0 SERPINA3 PRNP MAPT APP
13 aphasia 30.8 PRNP MAPT APP
14 pick disease of brain 30.8 SERPINA3 PRNP MAPT MAP2 APP
15 olivopontocerebellar atrophy 30.8 SERPINA3 MAPT MAP2
16 meningoencephalitis 30.8 SERPINA3 IL1B APP
17 alzheimer disease 30.7 SOD2 SERPINA3 PRNP PRND MAPT MAP2
18 normal pressure hydrocephalus 30.7 SERPINA3 MAPT APP
19 hydrocephalus 30.7 SERPINA3 MAPT ENO2 APP
20 peripheral nervous system disease 30.7 SERPINA3 MIR342 IL1B CAT APP
21 supranuclear palsy, progressive, 1 30.7 SERPINA3 PRNP MAPT APP
22 vascular dementia 30.5 SERPINA3 PRNP MAPT IL1B CAT APP
23 multiple system atrophy 1 30.5 SERPINA3 PRNP MAPT MAP2
24 nervous system disease 30.5 SERPINA3 MIR342 IL1B APP
25 dementia, lewy body 30.4 SERPINA3 PRNP MAPT APP
26 inclusion body myositis 30.4 SERPINA3 MAPT APP
27 demyelinating disease 30.4 SERPINA3 MAPT MAP2 IL1B
28 myositis 30.4 SERPINA3 MAPT IL1B APP
29 parkinson disease, late-onset 30.3 SOD2 SERPINA3 PRNP MAPT MAP2 CAT
30 amyotrophic lateral sclerosis 1 30.3 TFRC SOD2 SERPINA3 PRNP PRND MAPT
31 central nervous system disease 30.3 SERPINA3 PRNP MIR342 MAPT IL1B APP
32 inherited human prion disease 12.5
33 sporadic human prion disease 12.4
34 acquired human prion disease 12.4
35 familial alzheimer-like prion disease 12.3
36 huntington disease-like 1 12.2
37 spongiform encephalopathy with neuropsychiatric features 11.7
38 variably protease-sensitive prionopathy 11.7
39 gerstmann syndrome 11.3
40 nasopharyngeal carcinoma 2 11.2
41 nasopharyngeal carcinoma 11.2
42 ciliary dyskinesia, primary, 26 11.2
43 ciliary dyskinesia, primary, 27 11.2
44 encephalopathy 11.0
45 papillary tumor of the pineal region 10.7 MAP2 ENO2
46 cerebellopontine angle primitive neuroectodermal tumor 10.6 ENO2 CR2
47 cerebellar liponeurocytoma 10.6 MAP2 ENO2
48 erysipelas 10.6 SOD2 IL1B CAT
49 congenital epulis 10.6 SERPINA3 ENO2
50 epulis 10.6 SERPINA3 ENO2

Graphical network of the top 20 diseases related to Prion Disease:



Diseases related to Prion Disease
Sources

Symptoms & Phenotypes for Prion Disease

About this section

MGI Mouse Phenotypes related to Prion Disease:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 growth/size/body region MP:0005378 10.15 ADAM10 APP ENO2 HSF1 IL1B MAP2
2 cellular MP:0005384 10.14 ADAM10 APP CAT ENO2 FPR2 HSF1
3 immune system MP:0005387 10.07 ADAM10 APP CD40 CR2 FPR2 HSF1
4 hematopoietic system MP:0005397 10.06 ADAM10 APP CD40 CR2 FPR2 IL1B
5 integument MP:0010771 9.85 ADAM10 APP HSF1 IL1B MAPT MSMB
6 mortality/aging MP:0010768 9.8 ADAM10 APP CAT CR2 FPR2 HSF1
7 nervous system MP:0003631 9.44 ADAM10 APP CD40 ENO2 HSF1 IL1B
Sources

Drugs & Therapeutics for Prion Disease

About this section

Drugs for Prion Disease (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):

(show all 27)
# Name Status Phase Clinical Trials Cas Number PubChem Id
1
Glycerol Approved, Investigational Phase 2, Phase 3 56-81-5 753
2
Coal tar Approved Phase 2 8007-45-2
3
Quinacrine Investigational Phase 2 83-89-6 237
4 Anthelmintics Phase 2
5 Anti-Infective Agents Phase 2
6 Antiparasitic Agents Phase 2
7 Antiprotozoal Agents Phase 2
8 Antimalarials Phase 2
9 Insulin, Globin Zinc Phase 1, Phase 2
10 insulin Phase 1, Phase 2
11 Liver Extracts Phase 1, Phase 2
12 Bifidobacterium Phase 2
13
Methylprednisolone Approved, Vet_approved Phase 1 83-43-2 6741
14
Prednisolone phosphate Approved, Vet_approved Phase 1 302-25-0
15
Methylprednisolone hemisuccinate Approved Phase 1 2921-57-5
16
Prednisolone Approved, Vet_approved Phase 1 50-24-8 5755
17 Prednisolone acetate Approved, Vet_approved Phase 1 52-21-1
18
Prednisolone hemisuccinate Experimental Phase 1 2920-86-7
19 Anesthetics Phase 1
20 Methylprednisolone Acetate Phase 1
21 Cyclosporins Phase 1
22 Thymoglobulin Phase 1
23 Antilymphocyte Serum Phase 1
24
Thrombin Approved, Investigational
25 Epoetin alfa 113427-24-0
26 Antibodies
27 Immunoglobulins

Interventional clinical trials:

(show all 16)
# Name Status NCT ID Phase Drugs
1 A Randomized Controlled Trial of the Safety and Efficacy of Fecal Microbiota Transplantation in a Population With Bipolar Disorder Recruiting NCT03279224 Phase 2, Phase 3
2 Novel Therapeutics For Prion Diseases: A Randomized, Double-blinded, Placebo-controlled Study of the Efficacy of Quinacrine in the Treatment of Sporadic Creutzfeldt-Jakob Disease Completed NCT00183092 Phase 2 Quinacrine;Placebo
3 Bovine Colostrum for Patients With Non Alcoholic Fatty Liver Disease Completed NCT01016418 Phase 1, Phase 2
4 The Safety and Effectiveness of Probiotic Supplementation on Bipolar Depression: a Proof of Concept Randomized Controlled Trial Terminated NCT02155972 Phase 2
5 Phase I Serum-Free Cultured Thymus Transplantation in DiGeorge Anomaly, IND9836 Terminated NCT00849888 Phase 1
6 PRION-1: Quinacrine for Human Prion Disease. A Partially Randomized Patient Preference Trial to Evaluate the Activity and Safety of Quinacrine in Human Prion Disease Completed NCT00104663 Quinacrine
7 CardioCel Tri-leaflet Repair Study; a Prospective, Non-randomised, Single Arm, Multi-centre Clinical Investigation Completed NCT02629328
8 A Prospective, Immunogenicity Surveillance Registry (PRIMS) to Estimate the Incidence of Erythropoietin Antibody-Mediated Pure Red Cell Aplasia Among Subjects With Chronic Renal Failure and Subcutaneous Exposure to Recombinant Erythropoietin Products Completed NCT00391287
9 Vascular Post Market Review Completed NCT02681341
10 The Clinical Utility of the Congo-Red Dot Test for Diagnosis and Early Prediction of Preeclampsia During Pregnancy Completed NCT02455544
11 FDDNP-PET Imaging in Persons at Risk for Chronic Traumatic Encephalopathy Completed NCT02003183
12 Enhanced CJD Surveillance in the Older Population Recruiting NCT02629640
13 Development and Application of a Novel Neurorehabilitation Technology With Paired Associative Nerve Stimulation in Spinal Cord Injured Subjects Recruiting NCT04194099
14 The Canadian Depression Research and Intervention Network (CDRIN) Maritimes Registry: Reliable Assessment to Enable Research and Improve Clinical Care Recruiting NCT02443636
15 Therapeutic Antibodies Against Prion Diseases From PRNP Mutation Carriers Active, not recruiting NCT02837705
16 The Role of the Coagulation Pathway at the Synapse in Prion Diseases Not yet recruiting NCT02480725

Search NIH Clinical Center for Prion Disease

Cochrane evidence based reviews: prion diseases

Sources

Genetic Tests for Prion Disease

About this section
Sources

Anatomical Context for Prion Disease

About this section

MalaCards organs/tissues related to Prion Disease:

40
Brain, Testes, Cortex, Spleen, Liver, Bone, Spinal Cord
Sources

Publications for Prion Disease

About this section

Articles related to Prion Disease:

(show top 50) (show all 6120)
# Title Authors PMID Year
1
A novel protective prion protein variant that colocalizes with kuru exposure. 6 54 61
19923577 2009
2
Prion disease genetics. 54 61 6
16391566 2006
3
Complete sequence data support lack of balancing selection on PRNP in a natural Chinese population. 61 6
16565881 2006
4
Prion protein codon 129 genotype prevalence is altered in primary progressive aphasia. 61 6
16315279 2005
5
Association of sporadic Creutzfeldt-Jakob disease with homozygous genotypes at PRNP codons 129 and 219 in the Korean population. 61 6
16217673 2005
6
Human prion protein with valine 129 prevents expression of variant CJD phenotype. 6 61
15539564 2004
7
RNA molecules stimulate prion protein conversion. 6 61
14562104 2003
8
Fatal familial insomnia and the widening spectrum of prion diseases. 61 6
8137139 1993
9
Presymptomatic detection or exclusion of prion protein gene defects in families with inherited prion diseases. 6 61
1684089 1991
10
Homozygous prion protein genotype predisposes to sporadic Creutzfeldt-Jakob disease. 6 61
1677164 1991
11
Upregulation of miRNA hsa-miR-342-3p in experimental and idiopathic prion disease. 61 46
19712440 2009
12
Prion protein (PRNP) genotypes in frontotemporal lobar degeneration syndromes. 6
16969862 2006
13
The prion gene is associated with human long-term memory. 6
15987701 2005
14
Prion protein codon 129 polymorphism and risk of Alzheimer disease. 6
15277640 2004
15
Polymorphisms in the prion protein gene and in the doppel gene increase susceptibility for Creutzfeldt-Jakob disease. 6
14970845 2004
16
Absence of association between codon 129/219 polymorphisms of the prion protein gene and Alzheimer's disease in Japan. 6
14520676 2003
17
Early cognitive decline is associated with prion protein codon 129 polymorphism. 6
12891686 2003
18
Distribution of codon 129 genotype in human growth hormone-treated CJD patients in France and the UK. 6
12867116 2003
19
PRNP Val129 homozygosity increases risk for early-onset Alzheimer's disease. 6
12601712 2003
20
Distribution of the M129V polymorphism of the prion protein gene in a Turkish population suggests a high risk for Creutzfeldt-Jakob disease. 6
11840201 2001
21
Biochemical and structural studies of the prion protein polymorphism. 6
11749972 2001
22
Prion protein gene polymorphism and Alzheimer's disease: one modulatory trait of cognitive decline? 6
11488277 2001
23
Increased incidence of sporadic Creutzfeldt-Jakob disease on the island of Crete associated with a high rate of PRNP 129-methionine homozygosity in the local population. 6
11506406 2001
24
Sporadic Creutzfeldt-Jakob disease in a young Dutch valine homozygote: atypical molecular phenotype. 6
11506411 2001
25
Polymorphism at codon 129 of the prion protein gene is not associated with sporadic AD. 6
10953203 2000
26
The genetics of prions--a contradiction in terms? 6
10437852 1999
27
Phenotype-genotype studies in kuru: implications for new variant Creutzfeldt-Jakob disease. 6
9789072 1998
28
Polymorphism of the prion protein is associated with cognitive impairment in the elderly: the EVA study. 6
9748018 1998
29
Prion protein NMR structure and familial human spongiform encephalopathies. 6
9751723 1998
30
Genotype at codon 129 and susceptibility to Creutzfeldt-Jakob disease. 6
9643750 1998
31
Fatal familial insomnia and familial Creutzfeldt-Jakob disease: different prion proteins determined by a DNA polymorphism. 6
7908444 1994
32
Creutzfeldt-Jakob disease cosegregates with the codon 178Asn PRNP mutation in families of European origin. 6
1353341 1992
33
CJD discrepancy. 6
1682813 1991
34
Codon 129 changes in the prion protein gene in Caucasians. 6
2378641 1990
35
A codon 129 polymorphism in the PRIP gene. 6
1971924 1990
36
Pro----leu change at position 102 of prion protein is the most common but not the sole mutation related to Gerstmann-Sträussler syndrome. 6
2783132 1989
37
Mutant prion protein expression is associated with an alteration of the Rab GDP dissociation inhibitor alpha (GDI)/Rab11 pathway. 54 61
19996123 2010
38
Changes of tau profiles in brains of the hamsters infected with scrapie strains 263 K or 139 A possibly associated with the alteration of phosphate kinases. 54 61
20356412 2010
39
Structure of the prion protein and its gene: an analysis using bioinformatics and computer simulation. 54 61
20158453 2010
40
Involvement of Dab1 in APP processing and beta-amyloid deposition in sporadic Creutzfeldt-Jakob patients. 54 61
19853035 2010
41
Prions: protein aggregation and infectious diseases. 61 54
19789378 2009
42
Genetic analysis of the SPRN gene in ruminants reveals polymorphisms in the alanine-rich segment of shadoo protein. 61 54
19515828 2009
43
Prion protein oligomers in Creutzfeldt-Jakob disease detected by gel-filtration centrifuge columns. 54 61
19389076 2009
44
Spontaneous generation of prion infectivity in fatal familial insomnia knockin mice. 61 54
19709627 2009
45
Loss of anti-Bax function in Gerstmann-Sträussler-Scheinker syndrome-associated prion protein mutants. 61 54
19680558 2009
46
Prion protein (PrP) knock-out mice show altered iron metabolism: a functional role for PrP in iron uptake and transport. 54 61
19568430 2009
47
[Stable inhibition of human prion protein through a retrovirus-based RNAi system]. 54 61
19835143 2009
48
[Alternations of tau protein and its phosphorylated profiles in the experimental hamsters infected by scrapie agents 263K and 139A]. 54 61
19634763 2009
49
Early onset prion disease from octarepeat expansion correlates with copper binding properties. 61 54
19381258 2009
50
An antibody to the aggregated synthetic prion protein peptide (PrP106-126) selectively recognizes disease-associated prion protein (PrP) from human brain specimens. 61 54
18507665 2009
Sources

Variations for Prion Disease

About this section

ClinVar genetic disease variations for Prion Disease:

6 (show top 50) (show all 72) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 PRNP NM_000311.5(PRNP):c.598G>A (p.Glu200Lys)SNV Pathogenic 13398 rs28933385 20:4680464-4680464 20:4699818-4699818
2 PRNP NM_000311.5(PRNP):c.532G>A (p.Asp178Asn)SNV Pathogenic 39359 rs74315403 20:4680398-4680398 20:4699752-4699752
3 PRNP NM_000311.5(PRNP):c.593T>C (p.Phe198Ser)SNV Pathogenic 13401 rs74315405 20:4680459-4680459 20:4699813-4699813
4 PRNP NM_000311.5(PRNP):c.650A>G (p.Gln217Arg)SNV Pathogenic 13402 rs74315406 20:4680516-4680516 20:4699870-4699870
5 PRNP NM_000311.5(PRNP):c.628G>A (p.Val210Ile)SNV Pathogenic 13403 rs74315407 20:4680494-4680494 20:4699848-4699848
6 PRNP NM_000311.5(PRNP):c.314C>T (p.Pro105Leu)SNV Pathogenic 13404 rs11538758 20:4680180-4680180 20:4699534-4699534
7 PRNP NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln)NT expansion Pathogenic 13394 rs193922906 20:4680026-4680049 20:4699379-4699380
8 PRNP NM_000311.5(PRNP):c.305C>T (p.Pro102Leu)SNV Pathogenic 13395 rs74315401 20:4680171-4680171 20:4699525-4699525
9 PRNP NM_000311.5(PRNP):c.350C>T (p.Ala117Val)SNV Pathogenic 13396 rs74315402 20:4680216-4680216 20:4699570-4699570
10 PRNP NM_000311.5(PRNP):c.547A>G (p.Thr183Ala)SNV Pathogenic 13407 rs74315411 20:4680413-4680413 20:4699767-4699767
11 PRNP NM_000311.5(PRNP):c.560A>G (p.His187Arg)SNV Pathogenic 13412 rs74315413 20:4680426-4680426 20:4699780-4699780
12 PRNP NM_000311.5(PRNP):c.313C>A (p.Pro105Thr)SNV Pathogenic 13413 rs74315414 20:4680179-4680179 20:4699533-4699533
13 PRNP NM_000311.5(PRNP):c.313C>T (p.Pro105Ser)SNV Pathogenic 13415 rs74315414 20:4680179-4680179 20:4699533-4699533
14 PRNP NM_000311.5(PRNP):c.435T>G (p.Tyr145Ter)SNV Pathogenic 21147 rs80356710 20:4680301-4680301 20:4699655-4699655
15 PRNP NM_000311.5(PRNP):c.478C>T (p.Gln160Ter)SNV Pathogenic 21148 rs80356711 20:4680344-4680344 20:4699698-4699698
16 PRNP NM_000311.5(PRNP):c.538G>A (p.Val180Ile)SNV Pathogenic/Likely pathogenic 13405 rs74315408 20:4680404-4680404 20:4699758-4699758
17 PRNP NM_000311.5(PRNP):c.623G>A (p.Arg208His)SNV Conflicting interpretations of pathogenicity 13411 rs74315412 20:4680489-4680489 20:4699843-4699843
18 PRNP NM_000311.5(PRNP):c.-22C>GSNV Uncertain significance 338642 rs886056741 20:4667147-4667147 20:4686501-4686501
19 PRNP NM_000311.5(PRNP):c.*1134T>ASNV Uncertain significance 895124 20:4681762-4681762 20:4701116-4701116
20 PRNP NM_000311.5(PRNP):c.*1328T>CSNV Uncertain significance 895125 20:4681956-4681956 20:4701310-4701310
21 PRNP NM_000311.5(PRNP):c.695T>G (p.Met232Arg)SNV Uncertain significance 13406 rs74315409 20:4680561-4680561 20:4699915-4699915
22 PRNP NM_000311.5(PRNP):c.143G>A (p.Arg48His)SNV Uncertain significance 895060 20:4680009-4680009 20:4699363-4699363
23 PRNP NM_000311.5(PRNP):c.497T>C (p.Met166Thr)SNV Uncertain significance 896503 20:4680363-4680363 20:4699717-4699717
24 PRNP NM_000311.5(PRNP):c.565G>A (p.Val189Ile)SNV Uncertain significance 896504 20:4680431-4680431 20:4699785-4699785
25 PRNP NM_000311.5(PRNP):c.76C>G (p.Pro26Ala)SNV Uncertain significance 899177 20:4679942-4679942 20:4699296-4699296
26 PRNP NM_000311.5(PRNP):c.*460G>TSNV Uncertain significance 898128 20:4681088-4681088 20:4700442-4700442
27 PRNP NM_000311.5(PRNP):c.*994C>TSNV Uncertain significance 338668 rs886056746 20:4681622-4681622 20:4700976-4700976
28 PRNP NM_000311.5(PRNP):c.*1588C>TSNV Uncertain significance 338675 rs886056750 20:4682216-4682216 20:4701570-4701570
29 PRNP NM_000311.4(PRNP):c.-211G>ASNV Uncertain significance 338640 rs886056739 20:4666958-4666958 20:4686312-4686312
30 PRNP NM_000311.4(PRNP):c.-310T>ASNV Uncertain significance 338638 rs765471807 20:4666859-4666859 20:4686213-4686213
31 PRNP NM_000311.5(PRNP):c.-21G>TSNV Uncertain significance 338643 rs886056742 20:4667148-4667148 20:4686502-4686502
32 PRNP NM_000311.5(PRNP):c.*358C>ASNV Uncertain significance 338659 rs886056744 20:4680986-4680986 20:4700340-4700340
33 PRNP NM_000311.5(PRNP):c.*874C>TSNV Uncertain significance 338666 rs760516358 20:4681502-4681502 20:4700856-4700856
34 PRNP NM_000311.5(PRNP):c.*1193G>ASNV Uncertain significance 338671 rs886056748 20:4681821-4681821 20:4701175-4701175
35 PRNP NM_000311.4(PRNP):c.-206C>GSNV Uncertain significance 338641 rs886056740 20:4666963-4666963 20:4686317-4686317
36 PRNP NM_000311.5(PRNP):c.*1035T>GSNV Uncertain significance 338669 rs886056747 20:4681663-4681663 20:4701017-4701017
37 PRNP NM_000311.5(PRNP):c.*1281A>GSNV Uncertain significance 338672 rs540167431 20:4681909-4681909 20:4701263-4701263
38 PRNP NM_000311.5(PRNP):c.*1466G>CSNV Uncertain significance 338674 rs886056749 20:4682094-4682094 20:4701448-4701448
39 PRNP NM_000311.5(PRNP):c.*216G>ASNV Uncertain significance 338658 rs748532463 20:4680844-4680844 20:4700198-4700198
40 PRNP NM_000311.5(PRNP):c.*407T>GSNV Uncertain significance 338660 rs886056745 20:4681035-4681035 20:4700389-4700389
41 PRNP NM_000311.5(PRNP):c.*115G>ASNV Uncertain significance 338656 rs746943389 20:4680743-4680743 20:4700097-4700097
42 PRNP NM_000311.5(PRNP):c.*98_*100TCT[1]short repeat Likely benign 338655 rs570683075 20:4680725-4680727 20:4700079-4700081
43 PRNP NM_000311.5(PRNP):c.160G>A (p.Gly54Ser)SNV Likely benign 338646 rs763524380 20:4680026-4680026 20:4699380-4699380
44 PRNP NM_000311.5(PRNP):c.654C>T (p.Tyr218=)SNV Likely benign 896505 20:4680520-4680520 20:4699874-4699874
45 PRNP NM_000311.5(PRNP):c.5C>T (p.Ala2Val)SNV Likely benign 899176 20:4679871-4679871 20:4699225-4699225
46 PRNP NM_000311.3(PRNP):c.204_227del24 (p.Pro84_Gln91del)short repeat Likely benign 65494 rs193922906 20:4680026-4680049 20:4699380-4699403
47 PRNP NM_000311.5(PRNP):c.228C>T (p.Pro76=)SNV Benign/Likely benign 218578 rs112637437 20:4680094-4680094 20:4699448-4699448
48 PRNP NM_000311.5(PRNP):c.159C>T (p.Gly53=)SNV Benign/Likely benign 338645 rs776188950 20:4680025-4680025 20:4699379-4699379
49 PRNP NM_000311.5(PRNP):c.424G>A (p.Gly142Ser)SNV Benign/Likely benign 338652 rs150351644 20:4680290-4680290 20:4699644-4699644
50 PRNP NM_000311.5(PRNP):c.*70G>ASNV Benign 338654 rs116970629 20:4680698-4680698 20:4700052-4700052
Sources

Expression for Prion Disease

About this section
Search GEO for disease gene expression data for Prion Disease.
Sources

Pathways for Prion Disease

About this section

Pathways related to Prion Disease according to KEGG:

36
# Name Kegg Source Accession
1 Prion diseases hsa05020

Pathways related to Prion Disease according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1
Neuroscience 4
12.19 PRNP MAPT MAP2 ENO2 APP
2
Folate Metabolism 1
Show member pathways
 12 SOD2 SERPINA3 IL1B CAT
3
Alzheimers Disease 1
11.63 MAPT IL1B APP ADAM10
4
Hematopoietic cell lineage 36
11.58 TFRC IL1B CR2
5
Alzheimers Disease Pathway 63
11.15 MAPT APP ADAM10
6
Copper homeostasis 1
10.66 PRNP MAPT APP ADAM10
7
A-beta Uptake and Degradation 64
10.64 FPR2 CD40 APP
Sources

GO Terms for Prion Disease

About this section

Cellular components related to Prion Disease according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 plasma membrane GO:0005886 10.22 TFRC SPRN RPSA PRNP PRND MAPT
2 extracellular region GO:0005576 9.96 TFRC SPRN SERPINA3 PRND MSMB MAPT
3 cell GO:0005623 9.87 TFRC PRNP PRND MAPT FPR2 CD40
4 extracellular space GO:0005615 9.81 TFRC SERPINA3 MSMB MIR342 IL1B ENO2
5 neuronal cell body GO:0043025 9.77 MAPT MAP2 ENO2 CD40 ADAM10
6 extracellular exosome GO:0070062 9.7 TFRC SOD2 SERPINA3 RPSA PRNP ENO2
7 nuclear periphery GO:0034399 9.43 MAPT MAP2
8 main axon GO:0044304 8.8 MAPT MAP2 APP

Biological processes related to Prion Disease according to GeneCards Suite gene sharing:

(show all 20)
# Name GO ID Score Top Affiliating Genes
1 viral entry into host cell GO:0046718 9.73 TFRC RPSA CR2
2 positive regulation of protein phosphorylation GO:0001934 9.72 TFRC IL1B FPR2 CD40 APP
3 cellular response to amyloid-beta GO:1904646 9.63 PRNP FPR2 APP
4 microglial cell activation GO:0001774 9.61 MAPT FPR2 APP
5 positive regulation of interleukin-6 biosynthetic process GO:0045410 9.59 IL1B APP
6 negative regulation of long-term synaptic potentiation GO:1900272 9.58 PRNP APP
7 positive regulation of chemokine biosynthetic process GO:0045080 9.58 IL1B APP
8 cellular response to copper ion GO:0071280 9.58 PRNP HSF1 APP
9 complement receptor mediated signaling pathway GO:0002430 9.57 FPR2 CR2
10 cellular response to drug GO:0035690 9.56 TFRC PRNP IL1B HSF1
11 amyloid fibril formation GO:1990000 9.55 MAPT APP
12 regulation of microtubule polymerization GO:0031113 9.54 MAPT MAP2
13 response to lead ion GO:0010288 9.54 MAPT CAT APP
14 neuron projection maintenance GO:1990535 9.52 PRNP APP
15 modulation of age-related behavioral decline GO:0090647 9.51 PRNP APP
16 response to peptide GO:1901652 9.49 HSF1 CD40
17 immune response-regulating cell surface receptor signaling pathway GO:0002768 9.48 FPR2 CD40
18 positive regulation of NF-kappaB transcription factor activity GO:0051092 9.35 TFRC IL1B CD40 CAT APP
19 cellular copper ion homeostasis GO:0006878 9.33 PRNP PRND APP
20 astrocyte activation GO:0048143 8.92 MAPT IL1B FPR2 APP

Molecular functions related to Prion Disease according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 identical protein binding GO:0042802 9.8 TFRC SOD2 PRNP MAPT HSF1 CAT
2 complement receptor activity GO:0004875 9.16 FPR2 CR2
3 virus receptor activity GO:0001618 9.13 TFRC RPSA CR2
4 tubulin binding GO:0015631 8.8 PRNP MAPT MAP2
Sources

Sources for Prion Disease

About this section
3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
The MalaCards human disease database index: 1-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Content
Loading form....