MCID: RRP027
MIFTS: 19

Rare Peripheral Neuropathy

Categories: Immune diseases, Neuronal diseases, Rare diseases

Aliases & Classifications for Rare Peripheral Neuropathy

MalaCards integrated aliases for Rare Peripheral Neuropathy:

Name: Rare Peripheral Neuropathy 59

Classifications:

Orphanet: 59  
Rare neurological diseases


External Ids:

UMLS via Orphanet 73 C0031117
Orphanet 59 ORPHA98496

Summaries for Rare Peripheral Neuropathy

MalaCards based summary : Rare Peripheral Neuropathy is related to peripheral nervous system disease and neuromyotonia and axonal neuropathy, autosomal recessive. An important gene associated with Rare Peripheral Neuropathy is IARS2 (Isoleucyl-TRNA Synthetase 2, Mitochondrial). Related phenotype is Synthetic lethal with Ras.

Related Diseases for Rare Peripheral Neuropathy

Graphical network of the top 20 diseases related to Rare Peripheral Neuropathy:



Diseases related to Rare Peripheral Neuropathy

Symptoms & Phenotypes for Rare Peripheral Neuropathy

GenomeRNAi Phenotypes related to Rare Peripheral Neuropathy according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Synthetic lethal with Ras GR00018-A-0 8.8 IARS2 NEFL NGLY1

Drugs & Therapeutics for Rare Peripheral Neuropathy

Search Clinical Trials , NIH Clinical Center for Rare Peripheral Neuropathy

Genetic Tests for Rare Peripheral Neuropathy

Anatomical Context for Rare Peripheral Neuropathy

Publications for Rare Peripheral Neuropathy

Articles related to Rare Peripheral Neuropathy:

# Title Authors PMID Year
1
A Drosophila model of GDAP1 function reveals the involvement of insulin signalling in the mitochondria-dependent neuromuscular degeneration. 38
28065847 2017
2
[Davidenkow syndrome. A rare peripheral neuropathy]. 38
26826991 2016
3
The Importance of Rare Subtypes in Diagnosis and Treatment of Peripheral Neuropathy: A Review. 38
26437251 2015
4
Suprascapular neuropathy caused by heterotopic ossification after clavicle shaft fracture: a case report. 38
26662750 2012
5
Amyloid neuropathy mimicking chronic inflammatory demyelinating polyneuropathy. 38
22190302 2012
6
Rare peripheral femoral nerve neuropathy in children. 38
17273033 2007
7
Entrapment of the suprascapular nerve: anatomy, etiology, diagnosis, treatment. 38
17514177 2007
8
Confirmation of linkage of type 1 hereditary sensory neuropathy to human chromosome 9q22. 38
10025779 1999
9
Treatment of advanced seminoma with cyclophosphamide, vincristine and carboplatin on an outpatient basis. 38
8826863 1996

Variations for Rare Peripheral Neuropathy

ClinVar genetic disease variations for Rare Peripheral Neuropathy:

6 (show top 50) (show all 69)
# Gene Variation Type Significance SNP ID GRCh37 Pos GRCh38 Pos
1 NGLY1 NM_001145294.1(NGLY1): c.1407_1410del (p.Asn469fs) deletion Pathogenic rs765211108 3:25770699-25770702 3:25729208-25729211
2 IARS2 NM_018060.4(IARS2): c.2726C> T (p.Pro909Leu) single nucleotide variant Pathogenic rs587783070 1:220316451-220316451 1:220143109-220143109
3 46;XX;inv(7)(q11.23q36.3)dn inversion Pathogenic
4 NEFL NM_006158.4(NEFL): c.64C> T (p.Pro22Ser) single nucleotide variant Pathogenic/Likely pathogenic rs28928910 8:24813966-24813966 8:24956452-24956452
5 COX6A1 NM_004373.4(COX6A1): c.103+1G> C single nucleotide variant Likely pathogenic 12:120876033-120876033 12:120438230-120438230
6 PMP2 NM_002677.5(PMP2): c.128T> A (p.Ile43Asn) single nucleotide variant Likely pathogenic rs879253869 8:82357170-82357170 8:81444935-81444935
7 DNAJB5 NM_001135004.2(DNAJB5): c.169C> T (p.Pro57Ser) single nucleotide variant Likely pathogenic rs774909609 9:34990670-34990670 9:34990673-34990673
8 SPTLC3 NM_018327.4(SPTLC3): c.448T> C (p.Trp150Arg) single nucleotide variant Likely pathogenic rs755919784 20:13053048-13053048 20:13072400-13072400
9 CHRNG NM_005199.5(CHRNG): c.256C> T (p.Arg86Cys) single nucleotide variant Likely pathogenic rs777219451 2:233405327-233405327 2:232540617-232540617
10 NEB NM_001271208.2(NEB): c.21902C> T (p.Pro7301Leu) single nucleotide variant Conflicting interpretations of pathogenicity rs367626762 2:152384038-152384038 2:151527524-151527524
11 NEB NM_001271208.2(NEB): c.16637G> A (p.Arg5546His) single nucleotide variant Conflicting interpretations of pathogenicity rs201111610 2:152435919-152435919 2:151579405-151579405
12 LMNA NM_005572.3(LMNA): c.1634G> A (p.Arg545His) single nucleotide variant Conflicting interpretations of pathogenicity rs142191737 1:156107470-156107470 1:156137679-156137679
13 SPTAN1 NM_001130438.3(SPTAN1): c.4039G> A (p.Asp1347Asn) single nucleotide variant Conflicting interpretations of pathogenicity rs574740801 9:131367749-131367749 9:128605470-128605470
14 MEFV NM_000243.2(MEFV): c.2084A> G (p.Lys695Arg) single nucleotide variant Conflicting interpretations of pathogenicity rs104895094 16:3293403-3293403 16:3243403-3243403
15 ABCA4 NM_000350.3(ABCA4): c.2588G> C (p.Gly863Ala) single nucleotide variant Conflicting interpretations of pathogenicity rs76157638 1:94517254-94517254 1:94051698-94051698
16 ABCA4 NM_000350.3(ABCA4): c.203C> T (p.Pro68Leu) single nucleotide variant Conflicting interpretations of pathogenicity rs62654397 1:94577093-94577093 1:94111537-94111537
17 DNM2 NM_001005360.2(DNM2): c.190G> A (p.Val64Ile) single nucleotide variant Conflicting interpretations of pathogenicity rs144250390 19:10870442-10870442 19:10759766-10759766
18 FLRT1 NM_013280.4(FLRT1): c.211G> C (p.Gly71Arg) single nucleotide variant Uncertain significance rs777177875 11:63883950-63883950 11:64116478-64116478
19 FLRT1 NM_013280.4(FLRT1): c.1355G> A (p.Arg452His) single nucleotide variant Uncertain significance rs150825004 11:63885094-63885094 11:64117622-64117622
20 KIF24 deletion Uncertain significance 9:34280042-34296294 9:34280044-34296296
21 MYBPC3 NM_000256.3(MYBPC3): c.3614G> A (p.Arg1205Gln) single nucleotide variant Uncertain significance rs730880596 11:47354130-47354130 11:47332579-47332579
22 DYSF NM_003494.4(DYSF): c.1353G> A (p.Met451Ile) single nucleotide variant Uncertain significance rs146064054 2:71762219-71762219 2:71535089-71535089
23 FLRT1 NM_013280.4(FLRT1): c.437C> T (p.Ser146Leu) single nucleotide variant Uncertain significance 11:63884176-63884176 11:64116704-64116704
24 FLRT1 NM_013280.4(FLRT1): c.64_84delGTTGTGATGACCACGGCCACC deletion Uncertain significance 11:63883803-63883823 11:64116331-64116351
25 FLRT1 NM_013280.4(FLRT1): c.776C> T (p.Ser259Leu) single nucleotide variant Uncertain significance 11:63884515-63884515 11:64117043-64117043
26 FLRT1 NM_013280.4(FLRT1): c.1091G> A (p.Arg364Gln) single nucleotide variant Uncertain significance 11:63884830-63884830 11:64117358-64117358
27 FLRT1 NM_013280.4(FLRT1): c.1253G> A (p.Gly418Glu) single nucleotide variant Uncertain significance 11:63884992-63884992 11:64117520-64117520
28 FLRT1 NM_013280.4(FLRT1): c.1368G> T (p.Lys456Asn) single nucleotide variant Uncertain significance 11:63885107-63885107 11:64117635-64117635
29 FLRT1 NM_013280.4(FLRT1): c.722A> T (p.Asp241Val) single nucleotide variant Uncertain significance 11:63884461-63884461 11:64116989-64116989
30 FLRT1 NM_013280.4(FLRT1): c.1729G> A (p.Val577Met) single nucleotide variant Uncertain significance 11:63885468-63885468 11:64117996-64117996
31 FLRT1 NM_013280.4(FLRT1): c.667A> G (p.Ser223Gly) single nucleotide variant Uncertain significance 11:63884406-63884406 11:64116934-64116934
32 FLRT1 NM_013280.4(FLRT1): c.736C> T (p.Arg246Cys) single nucleotide variant Uncertain significance 11:63884475-63884475 11:64117003-64117003
33 FLRT1 NM_013280.4(FLRT1): c.1066A> C (p.Met356Leu) single nucleotide variant Uncertain significance 11:63884805-63884805 11:64117333-64117333
34 FLRT1 NM_013280.4(FLRT1): c.1644G> T (p.Met548Ile) single nucleotide variant Uncertain significance 11:63885383-63885383 11:64117911-64117911
35 FLRT1 NM_013280.4(FLRT1): c.1774C> T (p.Arg592Trp) single nucleotide variant Uncertain significance 11:63885513-63885513 11:64118041-64118041
36 MT-ND4 NC_012920.1: m.11896C> G single nucleotide variant Uncertain significance rs1057516065 MT:11896-11896 MT:11896-11896
37 MYH14 NM_001145809.2(MYH14): c.1945+6G> A single nucleotide variant Uncertain significance rs1057518869 19:50756016-50756016 19:50252759-50252759
38 FLRT1 NM_013280.4(FLRT1): c.38C> G (p.Thr13Arg) single nucleotide variant Uncertain significance rs139768227 11:63883777-63883777 11:64116305-64116305
39 KIFBP NM_015634.4(KIFBP): c.167_187dup (p.Asp56_Glu62dup) duplication Uncertain significance rs767103634 10:70748755-70748775 10:68988999-68989019
40 SBF2 NM_030962.3(SBF2): c.5014_5016del (p.Lys1672del) deletion Uncertain significance rs750958357 11:9809202-9809204 11:9787655-9787657
41 MKS1 NM_017777.3(MKS1): c.1607G> A (p.Arg536Gln) single nucleotide variant Uncertain significance rs746283445 17:56283513-56283513 17:58206152-58206152
42 PRX NM_181882.2(PRX): c.2335G> A (p.Ala779Thr) single nucleotide variant Uncertain significance rs369505684 19:40901924-40901924 19:40396017-40396017
43 PNPLA6 NM_006702.5(PNPLA6): c.1088C> T (p.Ser363Leu) single nucleotide variant Uncertain significance rs372193709 19:7606906-7606906 19:7542020-7542020
44 PHKA1 NM_002637.4(PHKA1): c.1272T> A (p.Asp424Glu) single nucleotide variant Uncertain significance rs1060499719 X:71870292-71870292 X:72650442-72650442
45 FLRT1 NM_013280.4(FLRT1): c.1729G> C (p.Val577Leu) single nucleotide variant Uncertain significance rs140274429 11:63885468-63885468 11:64117996-64117996
46 FLRT1 NM_013280.4(FLRT1): c.229G> A (p.Ala77Thr) single nucleotide variant Uncertain significance rs770193280 11:63883968-63883968 11:64116496-64116496
47 FLRT1 NM_013280.4(FLRT1): c.1381G> A (p.Ala461Thr) single nucleotide variant Uncertain significance rs138289564 11:63885120-63885120 11:64117648-64117648
48 FLRT1 NM_013280.4(FLRT1): c.1120G> C (p.Glu374Gln) single nucleotide variant Uncertain significance rs138445479 11:63884859-63884859 11:64117387-64117387
49 FLRT1 NM_013280.4(FLRT1): c.1712G> T (p.Gly571Val) single nucleotide variant Uncertain significance rs143309484 11:63885451-63885451 11:64117979-64117979
50 FLRT1 NM_013280.4(FLRT1): c.1780A> G (p.Ser594Gly) single nucleotide variant Uncertain significance rs150249733 11:63885519-63885519 11:64118047-64118047

Expression for Rare Peripheral Neuropathy

Search GEO for disease gene expression data for Rare Peripheral Neuropathy.

Pathways for Rare Peripheral Neuropathy

GO Terms for Rare Peripheral Neuropathy

Sources for Rare Peripheral Neuropathy

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HGMD
31 HMDB
32 HPO
33 ICD10
34 ICD10 via Orphanet
35 ICD9CM
36 IUPHAR
37 KEGG
38 LifeMap
40 LOVD
42 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
54 NINDS
55 Novoseek
57 OMIM
58 OMIM via Orphanet
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 TGDB
71 Tocris
72 UMLS
73 UMLS via Orphanet
Content
Loading form....