RTS
MCID: RTH001
MIFTS: 60

Rothmund-Thomson Syndrome (RTS)

Categories: Blood diseases, Bone diseases, Eye diseases, Fetal diseases, Genetic diseases, Rare diseases, Skin diseases

Aliases & Classifications for Rothmund-Thomson Syndrome

MalaCards integrated aliases for Rothmund-Thomson Syndrome:

Name: Rothmund-Thomson Syndrome 57 12 24 53 25 75 37 29 13 55 6 44 15 73
Rts 57 12 53 25 75
Poikiloderma Atrophicans and Cataract 57 53 25
Poikiloderma Congenitale 53 25
Congenital Poikiloderma 12 25
Poikiloderma Congenitale of Rothmund-Thomson 25
Poikiloderma of Rothmund-Thomson Type 1 59
Poikiloderma of Rothmund-Thomson Type 2 59
Poikiloderma of Rothmund-Thomson 53
Rothmund-Thomson Syndrome Type 1 59
Rothmund-Thomson Syndrome Type 2 59
Erythrokeratodermia Variabilis 73
Syndrome, Rothmund-Thomson 40
Rothmundthomson Syndrome 76
Rts1 59
Rts2 59

Characteristics:

Orphanet epidemiological data:

59
rothmund-thomson syndrome type 1
Inheritance: Autosomal recessive; Prevalence: <1/1000000 (Worldwide); Age of onset: Infancy,Neonatal;
rothmund-thomson syndrome type 2
Inheritance: Autosomal recessive; Prevalence: <1/1000000 (Worldwide); Age of onset: Infancy,Neonatal;

OMIM:

57
Inheritance:
autosomal recessive


HPO:

32
rothmund-thomson syndrome:
Inheritance autosomal recessive inheritance


Classifications:



Summaries for Rothmund-Thomson Syndrome

NIH Rare Diseases : 53 Rothmund-Thomson syndrome is a rare condition that affects many parts of the body, especially the skin, eyes, bones, and teeth. Signs and symptoms can include a characteristic facial rash (poikiloderma); sparse hair, eyelashes, and/or eyebrows; short stature; skeletal (bone) and dental abnormalities; cataracts; premature aging; and an increased risk for cancer, especially osteosarcoma. Gastrointestinal problems or blood disorders may also occur. It is inherited in an autosomal recessive manner and most often caused by changes (mutations) in the RECQL4 gene. In some cases, the genetic cause is unknown. Treatment focuses on the specific signs and symptoms present and may include laser treatment for skin abnormalities; surgery for cataracts; and standard treatment for cancer.

MalaCards based summary : Rothmund-Thomson Syndrome, also known as rts, is related to poikiloderma with neutropenia and baller-gerold syndrome, and has symptoms including exanthema An important gene associated with Rothmund-Thomson Syndrome is RECQL4 (RecQ Like Helicase 4), and among its related pathways/superpathways are Cell Cycle Checkpoints and DNA Damage. The drugs Calcium, Dietary and Bone Density Conservation Agents have been mentioned in the context of this disorder. Affiliated tissues include skin, bone and eye, and related phenotypes are frontal bossing and osteopenia

Genetics Home Reference : 25 Rothmund-Thomson syndrome is a rare condition that affects many parts of the body, especially the skin. People with this condition typically develop redness on the cheeks between ages 3 months and 6 months. Over time the rash spreads to the arms and legs, causing patchy changes in skin coloring, areas of thinning skin (atrophy), and small clusters of blood vessels just under the skin (telangiectases). These skin problems persist for life and are collectively known as poikiloderma.

OMIM : 57 Rothmund-Thomson syndrome is rare autosomal recessive disorder characterized by skin atrophy, telangiectasia, hyper- and hypopigmentation, congenital skeletal abnormalities, short stature, premature aging, and increased risk of malignant disease (Simon et al., 2010). (268400)

UniProtKB/Swiss-Prot : 75 Rothmund-Thomson syndrome: Characterized by dermatological features such as atrophy, pigmentation, and telangiectasia and frequently accompanied by juvenile cataract, saddle nose, congenital bone defects, disturbances of hair growth, and hypogonadism.

Wikipedia : 76 Rothmund�??Thomson syndrome (RTS), also known as poikiloderma atrophicans with cataract or poikiloderma... more...

GeneReviews: NBK1237

Related Diseases for Rothmund-Thomson Syndrome

Diseases related to Rothmund-Thomson Syndrome via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 406)
# Related Disease Score Top Affiliating Genes
1 poikiloderma with neutropenia 32.7 RECQL4 USB1
2 baller-gerold syndrome 31.8 RECQL RECQL4 RECQL5 WRN
3 rapadilino syndrome 31.6 HELLS RECQL RECQL4 RECQL5 WRN
4 werner syndrome 29.7 BLM HELLS RECQL RECQL4 RECQL5 WRN
5 bloom syndrome 29.5 BLM HELLS RECQL RECQL4 RECQL5 WRN
6 atypical teratoid rhabdoid tumor 11.9
7 chromosome 16p13.3 deletion syndrome, proximal 11.8
8 rhabdoid cancer 11.6
9 dengue disease 11.3
10 rett syndrome 11.2
11 hereditary acrokeratotic poikiloderma, weary type 11.1
12 parc syndrome 11.1
13 rhabdoid tumor predisposition syndrome 1 11.0
14 congenital toxoplasmosis 11.0
15 malaria 10.6
16 osteogenic sarcoma 10.5
17 sarcoma 10.5
18 leukemia 10.4
19 aging 10.3
20 glomerulonephritis 10.3
21 neutropenia 10.3
22 squamous cell carcinoma 10.3
23 calcinosis 10.3
24 bronchiectasis 10.3
25 dwarfism 10.3
26 mosaic trisomy 8 10.3
27 hepatitis 10.3
28 breast cancer 10.3
29 myeloid leukemia 10.2
30 megalocornea 10.2
31 bowen's disease 10.2
32 linear scleroderma 10.2
33 influenza 10.2
34 colorectal cancer 10.2
35 prostate cancer 10.2
36 spondyloepiphyseal dysplasia with congenital joint dislocations 10.2
37 pancreas, annular 10.2
38 ringed hair 10.2
39 enterocolitis 10.2
40 hypoadrenocorticism, familial 10.2
41 immunodeficiency-centromeric instability-facial anomalies syndrome 1 10.2
42 aplastic anemia 10.2
43 c1q deficiency 10.2
44 myelodysplastic syndrome 10.2
45 pulmonary fibrosis and/or bone marrow failure, telomere-related, 2 10.2
46 alopecia 10.2
47 cataract 10.2
48 hydrocephalus 10.2
49 lymphoma 10.2
50 bone disease 10.2

Graphical network of the top 20 diseases related to Rothmund-Thomson Syndrome:



Diseases related to Rothmund-Thomson Syndrome

Symptoms & Phenotypes for Rothmund-Thomson Syndrome

Symptoms via clinical synopsis from OMIM:

57
Head And Neck Face:
frontal bossing
prognathism

Skeletal:
osteoporosis

Head And Neck Teeth:
microdontia
supernumerary teeth
missing teeth
delayed eruption
multiple crown malformations

Skin Nails Hair Hair:
alopecia
premature graying of hair
sparse hair

Abdomen Gastrointestinal:
anteriorly placed anus

Abdomen Pancreas:
annular pancreas

Skeletal Hands:
hypoplastic thumbs
small hands

Skeletal Spine:
kyphoscoliosis (in some patients)

Skeletal Pelvis:
congenital hip dislocation (rare)

Skin Nails Hair Nails:
atrophic nails

Growth Height:
short stature

Head And Neck Eyes:
strabismus
microphthalmia
glaucoma
microcornea
juvenile zonular cataracts
more
Genitourinary Internal Genitalia Male:
cryptorchidism

Endocrine Features:
hypogonadism

Neoplasia:
squamous cell carcinoma
basal cell carcinoma
osteogenic sarcoma

Skin Nails Hair Skin:
telangiectasia
skin atrophy
sun sensitivity
erythematous skin lesions in infancy
poikiloderma (atrophic plaques with telangiectasia)
more
Skeletal Feet:
club feet
small feet

Head And Neck Nose:
small, saddle nose

Skeletal Limbs:
forearm reduction defects
absence of patella
hypermobile joints (rare)
restricted range of movement in some joints (rare)

Neurologic Central Nervous System:
mental retardation in 5-13%


Clinical features from OMIM:

268400

Human phenotypes related to Rothmund-Thomson Syndrome:

59 32 (show top 50) (show all 107)
# Description HPO Frequency Orphanet Frequency HPO Source Accession
1 frontal bossing 59 32 hallmark (90%) Very frequent (99-80%) HP:0002007
2 osteopenia 59 32 occasional (7.5%) Occasional (29-5%) HP:0000938
3 nausea and vomiting 59 32 occasional (7.5%) Occasional (29-5%) HP:0002017
4 cataract 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0000518
5 skeletal dysplasia 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0002652
6 abnormality of the dentition 59 32 hallmark (90%) Very frequent (99-80%) HP:0000164
7 short stature 59 32 hallmark (90%) Very frequent (99-80%) HP:0004322
8 anemia 59 32 occasional (7.5%) Occasional (29-5%) HP:0001903
9 myelodysplasia 59 32 occasional (7.5%) Occasional (29-5%) HP:0002863
10 palmoplantar keratoderma 59 32 hallmark (90%) Very frequent (99-80%),Frequent (79-30%) HP:0000982
11 nail dystrophy 59 32 frequent (33%) Very frequent (99-80%),Frequent (79-30%) HP:0008404
12 concave nasal ridge 59 32 hallmark (90%) Very frequent (99-80%) HP:0011120
13 microdontia 59 32 frequent (33%) Frequent (79-30%) HP:0000691
14 growth delay 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0001510
15 hypopigmented skin patches 59 32 hallmark (90%) Very frequent (99-80%) HP:0001053
16 hypogonadism 59 32 occasional (7.5%) Occasional (29-5%) HP:0000135
17 prematurely aged appearance 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0007495
18 hypotrichosis 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0001006
19 diarrhea 59 32 occasional (7.5%) Occasional (29-5%) HP:0002014
20 erythema 59 32 hallmark (90%) Very frequent (99-80%) HP:0010783
21 neutropenia 59 32 occasional (7.5%) Occasional (29-5%) HP:0001875
22 cutaneous photosensitivity 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0000992
23 osteosarcoma 59 32 very rare (1%) Very frequent (99-80%) HP:0002669
24 absent eyelashes 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0000561
25 hypoplasia of the radius 59 32 hallmark (90%) Very frequent (99-80%) HP:0002984
26 squamous cell carcinoma 59 32 hallmark (90%) Very frequent (99-80%) HP:0002860
27 hyperpigmentation of the skin 59 32 hallmark (90%) Very frequent (99-80%) HP:0000953
28 absent eyebrow 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0002223
29 short thumb 59 32 hallmark (90%) Very frequent (99-80%) HP:0009778
30 poikiloderma 59 32 very rare (1%) Very frequent (99-80%),Very frequent (99-80%) HP:0001029
31 brittle hair 59 32 hallmark (90%) Very frequent (99-80%),Very frequent (99-80%) HP:0002299
32 dermal atrophy 59 32 hallmark (90%) Very frequent (99-80%) HP:0004334
33 hypoplasia of teeth 59 32 frequent (33%) Frequent (79-30%) HP:0000685
34 basal cell carcinoma 59 32 hallmark (90%) Very frequent (99-80%) HP:0002671
35 hypertelorism 32 frequent (33%) HP:0000316
36 ptosis 32 occasional (7.5%) HP:0000508
37 hypertension 32 occasional (7.5%) HP:0000822
38 intellectual disability 32 very rare (1%) HP:0001249
39 scoliosis 32 frequent (33%) HP:0002650
40 mandibular prognathia 32 HP:0000303
41 global developmental delay 32 occasional (7.5%) HP:0001263
42 carious teeth 32 frequent (33%) HP:0000670
43 malabsorption 32 occasional (7.5%) HP:0002024
44 abnormality of the ulna 32 occasional (7.5%) HP:0002997
45 short nose 32 HP:0003196
46 microcephaly 32 frequent (33%) HP:0000252
47 sensorineural hearing impairment 32 occasional (7.5%) HP:0000407
48 nephropathy 32 occasional (7.5%) HP:0000112
49 osteoporosis 32 HP:0000939
50 micrognathia 32 frequent (33%) HP:0000347

UMLS symptoms related to Rothmund-Thomson Syndrome:


exanthema

GenomeRNAi Phenotypes related to Rothmund-Thomson Syndrome according to GeneCards Suite gene sharing:

26
# Description GenomeRNAi Source Accession Score Top Affiliating Genes
1 Increased viability with MLN4924 (a NAE inhibitor) GR00250-A-3 9.02 BLM RECQL RECQL4 RECQL5 WRN

MGI Mouse Phenotypes related to Rothmund-Thomson Syndrome:

46
# Description MGI Source Accession Score Top Affiliating Genes
1 cellular MP:0005384 9.23 BLM CDC45 HELLS MAPK1 RECQL RECQL4

Drugs & Therapeutics for Rothmund-Thomson Syndrome

Drugs for Rothmund-Thomson Syndrome (from DrugBank, HMDB, Dgidb, PharmGKB, IUPHAR, NovoSeek, BitterDB):


# Name Status Phase Clinical Trials Cas Number PubChem Id
1 Calcium, Dietary
2 Bone Density Conservation Agents

Interventional clinical trials:


# Name Status NCT ID Phase Drugs
1 Calcium Absorption in Patients With Rothmund-Thomson Syndrome Unknown status NCT01304407
2 Familial Investigations of Childhood Cancer Predisposition Recruiting NCT03050268

Search NIH Clinical Center for Rothmund-Thomson Syndrome

Cochrane evidence based reviews: rothmund-thomson syndrome

Genetic Tests for Rothmund-Thomson Syndrome

Genetic tests related to Rothmund-Thomson Syndrome:

# Genetic test Affiliating Genes
1 Rothmund-Thomson Syndrome 29 RECQL4

Anatomical Context for Rothmund-Thomson Syndrome

MalaCards organs/tissues related to Rothmund-Thomson Syndrome:

41
Skin, Bone, Eye, T Cells, Pancreas, Thyroid, Adrenal Gland

Publications for Rothmund-Thomson Syndrome

Articles related to Rothmund-Thomson Syndrome:

(show top 50) (show all 382)
# Title Authors Year
1
Rothmund-Thomson syndrome (RTS) with osteosarcoma due to<i>RECQL4</i>mutation. ( 29367366 )
2018
2
Novel pathogenic RECQL4 variants in Chinese patients with Rothmund-Thomson syndrome. ( 29462647 )
2018
3
Rothmund-Thomson Syndrome: Insights from New Patients on the Genetic Variability Underpinning Clinical Presentation and Cancer Outcome. ( 29642415 )
2018
4
Regulated intratumoral expression of IL-12 using a RheoSwitch Therapeutic System® (RTS®) gene switch as gene therapy for the treatment of glioma. ( 29755109 )
2018
5
Baseline exposure, antibody subclass, and hepatitis B response differentially affect malaria protective immunity following RTS,S/AS01E vaccination in African children. ( 30376866 )
2018
6
Safety and efficacy of novel malaria vaccine regimens of RTS,S/AS01B alone, or with concomitant ChAd63-MVA-vectored vaccines expressing ME-TRAP. ( 30323956 )
2018
7
CXCR3+ T Follicular Helper Cells Induced by Co-Administration of RTS,S/AS01B and Viral-Vectored Vaccines Are Associated With Reduced Immunogenicity and Efficacy Against Malaria. ( 30090099 )
2018
8
Four novel RECQL4 mutations in four Chinese patients with Rothmund-Thomson syndrome and analysis of RECQL4 mRNA expression level in one typical patient. ( 30007837 )
2018
9
Gastrointestinal Malignancy Presenting with a Virchow's Node in a Patient with Rothmund-Thomson Syndrome. ( 30498607 )
2018
10
Safety and Immunogenicity of Seven Dosing Regimens of the Candidate RTS,S/AS01E Malaria Vaccine Integrated Within an Expanded Program on Immunization Regimen: A Phase II, Single-Center, Open, Controlled Trial in Infants in Malawi. ( 29432383 )
2018
11
Immune response to the hepatitis B antigen in the RTS,S/AS01 malaria vaccine, and co-administration with pneumococcal conjugate and rotavirus vaccines in African children: A randomized controlled trial. ( 29630438 )
2018
12
RTS,S/AS01 malaria vaccine mismatch observed among Plasmodium falciparum isolates from southern and central Africa and globally. ( 29700348 )
2018
13
RTS and RTS-A have equal value in mortality prediction of patients with severely trauma. ( 28768584 )
2018
14
Characterization of T-cell immune responses in clinical trials of the candidate RTS,S malaria vaccine. ( 28934066 )
2018
15
The RTS plus measurement of the RDW improves the prediction of 28-day mortality in trauma patients. ( 29055614 )
2018
16
Rare presentation of Rothmund-Thomson syndrome with predominantly cutaneous findings. ( 28443301 )
2017
17
Generalized Metabolic Bone Disease and Fracture Risk in Rothmund-Thomson Syndrome. ( 28486640 )
2017
18
Pili annulati in a case of Rothmund-Thomson syndrome with a novel frameshift mutation in RECQL4. ( 29224249 )
2017
19
Ophthalmic manifestations in Rothmund-Thomson syndrome: Case report and review of literature. ( 29044077 )
2017
20
Rothmund-Thomson syndrome and osteoma cutis in a patient previously diagnosed as COPS syndrome. ( 28039508 )
2017
21
Country specific predictions of the cost-effectiveness of malaria vaccine RTS,S/AS01 in endemic Africa. ( 27890400 )
2017
22
Validation of trauma scales: ISS, NISS, RTS and TRISS for predicting mortality in a Colombian population. ( 27999959 )
2017
23
Efficacy of Phase 3 Trial of RTS, S/AS01 Malaria Vaccine in infants: a systematic review and meta-analysis. ( 28059665 )
2017
24
Systems analysis of protective immune responses to RTS,S malaria vaccination in humans. ( 28193898 )
2017
25
Efficacy of phase 3 trial of RTS, S/AS01 malaria vaccine: The need for an alternative development plan. ( 28272979 )
2017
26
Quality attributes, phytochemical profile and storage stability studies of functional ready to serve (RTS) drink made from blend of Aloe vera, sweet lime, amla and ginger. ( 28298690 )
2017
27
Distinct Helper T Cell Type 1 and 2 Responses Associated With Malaria Protection and Risk in RTS,S/AS01E Vaccinees. ( 28505356 )
2017
28
Predicting RTS,S Vaccine-Mediated Protection from Transcriptomes in a Malaria-Challenge Clinical Trial. ( 28588574 )
2017
29
Modelling the cost-effectiveness of introducing the RTS,S malaria vaccine relative to scaling up other malaria interventions in sub-Saharan Africa. ( 28588994 )
2017
30
RTS,S/AS01 Malaria Vaccine Efficacy is Not Modified by Seasonal Precipitation: Results from a Phase 3 Randomized Controlled Trial in Malawi. ( 28775306 )
2017
31
Comparison of ISS, NISS, and RTS score as predictor of mortality in pediatric fall. ( 28795055 )
2017
32
Delayed fractional dose regimen of the RTS,S/AS01 malaria vaccine candidate enhances an IgG4 response that inhibits serum opsonophagocytosis. ( 28801554 )
2017
33
RTS,S/AS01E Malaria Vaccine Induces Memory and Polyfunctional T Cell Responses in a Pediatric African Phase III Trial. ( 28878775 )
2017
34
Rothmund-Thomson syndrome and ocular surface findings: case reports and review of the literature. ( 27463631 )
2016
35
Aging in Rothmund-Thomson syndrome and related RECQL4 genetic disorders. ( 27287744 )
2016
36
Rothmund-Thomson Syndrome: novel pathogenic mutations and frequencies of variants in the RECQL4 and USB1 (C16orf57) gene. ( 27247962 )
2016
37
Clinical findings, dental treatment, and improvement in quality of life for a child with Rothmund-Thomson syndrome. ( 27307676 )
2016
38
Safety and High Level Efficacy of the Combination Malaria Vaccine Regimen of RTS,S/AS01B With Chimpanzee Adenovirus 63 and Modified Vaccinia Ankara Vectored Vaccines Expressing ME-TRAP. ( 27307573 )
2016
39
Implementation of the malaria candidate vaccine RTS,S/AS01. ( 26549465 )
2016
40
Public health impact and cost-effectiveness of the RTS,S/AS01 malaria vaccine: a systematic comparison of predictions from four mathematical models. ( 26549466 )
2016
41
Policy analysis for deciding on a malaria vaccine RTS,S in Tanzania. ( 26956944 )
2016
42
The Future of the RTS,S/AS01 Malaria Vaccine: An Alternative Development Plan. ( 27070151 )
2016
43
RTS,S Malaria Vaccine and Increased Mortality in Girls. ( 27118593 )
2016
44
The biological function of antibodies induced by the RTS,S/AS01 malaria vaccine candidate is determined by their fine specificity. ( 27245446 )
2016
45
Fractional Third and Fourth Dose of RTS,S/AS01 Malaria Candidate Vaccine: A Phase 2a Controlled Human Malaria Parasite Infection and Immunogenicity Study. ( 27296848 )
2016
46
Seven-Year Efficacy of RTS,S/AS01 Malaria Vaccine among Young African Children. ( 27355532 )
2016
47
Implementation of RTS,S/AS01 Malaria Vaccine--The Need for Further Evidence. ( 27355540 )
2016
48
Safety and immunogenicity of RTS,S/AS01 malaria vaccine in infants and children with WHO stage 1 or 2 HIV disease: a randomised, double-blind, controlled trial. ( 27394191 )
2016
49
Decrease in circulating CD25(hi)Foxp3(+) regulatory T cells following vaccination with the candidate malaria vaccine RTS,S. ( 27443592 )
2016
50
The RTS,S/AS01 malaria vaccine in children 5 to 17 months of age at first vaccination. ( 27841689 )
2016

Variations for Rothmund-Thomson Syndrome

ClinVar genetic disease variations for Rothmund-Thomson Syndrome:

6 (show all 40)
# Gene Variation Type Significance SNP ID Assembly Location
1 RECQL4 NM_004260.3(RECQL4): c.1650_1656delGGCCTGC (p.Ala551Tyrfs) deletion Pathogenic rs786200887 GRCh37 Chromosome 8, 145739874: 145739880
2 RECQL4 NM_004260.3(RECQL4): c.1650_1656delGGCCTGC (p.Ala551Tyrfs) deletion Pathogenic rs786200887 GRCh38 Chromosome 8, 144514490: 144514496
3 RECQL4 NM_004260.3(RECQL4): c.2269C> T (p.Gln757Ter) single nucleotide variant Pathogenic rs137853229 GRCh37 Chromosome 8, 145738796: 145738796
4 RECQL4 NM_004260.3(RECQL4): c.2269C> T (p.Gln757Ter) single nucleotide variant Pathogenic rs137853229 GRCh38 Chromosome 8, 144513412: 144513412
5 RECQL4 NM_004260.3(RECQL4): c.2492_2493delAT (p.His831Argfs) deletion Pathogenic rs752729755 GRCh37 Chromosome 8, 145738492: 145738493
6 RECQL4 NM_004260.3(RECQL4): c.2492_2493delAT (p.His831Argfs) deletion Pathogenic rs752729755 GRCh38 Chromosome 8, 144513109: 144513110
7 RECQL4 NM_004260.3(RECQL4): c.2059-1G> T single nucleotide variant Pathogenic rs386833849 GRCh37 Chromosome 8, 145739097: 145739097
8 RECQL4 NM_004260.3(RECQL4): c.2059-1G> T single nucleotide variant Pathogenic rs386833849 GRCh38 Chromosome 8, 144513713: 144513713
9 RECQL4 NM_004260.3(RECQL4): c.1573delT (p.Cys525Alafs) deletion Pathogenic rs386833845 GRCh37 Chromosome 8, 145740367: 145740367
10 RECQL4 NM_004260.3(RECQL4): c.1573delT (p.Cys525Alafs) deletion Pathogenic rs386833845 GRCh38 Chromosome 8, 144514983: 144514983
11 RECQL4 NM_004260.3(RECQL4): c.1391-1G> A single nucleotide variant Pathogenic rs117642173 GRCh37 Chromosome 8, 145740627: 145740627
12 RECQL4 NM_004260.3(RECQL4): c.1391-1G> A single nucleotide variant Pathogenic rs117642173 GRCh38 Chromosome 8, 144515243: 144515243
13 RECQL4 NM_004260.3(RECQL4): c.2059-1G> C single nucleotide variant Pathogenic rs386833849 GRCh38 Chromosome 8, 144513713: 144513713
14 RECQL4 NM_004260.3(RECQL4): c.2059-1G> C single nucleotide variant Pathogenic rs386833849 GRCh37 Chromosome 8, 145739097: 145739097
15 RECQL4 NM_004260.3(RECQL4): c.1919_1924delTCACAG (p.Leu640_Ala642delinsPro) deletion Pathogenic rs786200890 GRCh37 Chromosome 8, 145739446: 145739451
16 RECQL4 NM_004260.3(RECQL4): c.1919_1924delTCACAG (p.Leu640_Ala642delinsPro) deletion Pathogenic rs786200890 GRCh38 Chromosome 8, 144514062: 144514067
17 RECQL4 NM_004260.3(RECQL4): c.1704+1G> A single nucleotide variant Pathogenic rs760363252 GRCh37 Chromosome 8, 145739825: 145739825
18 RECQL4 NM_004260.3(RECQL4): c.1704+1G> A single nucleotide variant Pathogenic rs760363252 GRCh38 Chromosome 8, 144514441: 144514441
19 RECQL4 NM_004260.3(RECQL4): c.2476C> T (p.Arg826Ter) single nucleotide variant Pathogenic rs386833851 GRCh37 Chromosome 8, 145738509: 145738509
20 RECQL4 NM_004260.3(RECQL4): c.2476C> T (p.Arg826Ter) single nucleotide variant Pathogenic rs386833851 GRCh38 Chromosome 8, 144513126: 144513126
21 RECQL4 NM_004260.3(RECQL4): c.2464-1G> C single nucleotide variant Pathogenic rs398124117 GRCh37 Chromosome 8, 145738522: 145738522
22 RECQL4 NM_004260.3(RECQL4): c.2464-1G> C single nucleotide variant Pathogenic rs398124117 GRCh38 Chromosome 8, 144513139: 144513139
23 RECQL4 NM_004260.3(RECQL4): c.82C> T (p.Gln28Ter) single nucleotide variant Pathogenic rs794726912 GRCh37 Chromosome 8, 145743087: 145743087
24 RECQL4 NM_004260.3(RECQL4): c.82C> T (p.Gln28Ter) single nucleotide variant Pathogenic rs794726912 GRCh38 Chromosome 8, 144517703: 144517703
25 RECQL4 NM_004260.3(RECQL4): c.1048_1049delAG (p.Arg350Glyfs) deletion Pathogenic rs746636748 GRCh37 Chromosome 8, 145741454: 145741455
26 RECQL4 NM_004260.3(RECQL4): c.1048_1049delAG (p.Arg350Glyfs) deletion Pathogenic rs746636748 GRCh38 Chromosome 8, 144516070: 144516071
27 RECQL4 NM_004260.3(RECQL4): c.1390+1G> T single nucleotide variant Likely pathogenic rs1085307090 GRCh37 Chromosome 8, 145740709: 145740709
28 RECQL4 NM_004260.3(RECQL4): c.1390+1G> T single nucleotide variant Likely pathogenic rs1085307090 GRCh38 Chromosome 8, 144515325: 144515325
29 RECQL4 NM_004260.3(RECQL4): c.1259-1G> A single nucleotide variant Pathogenic rs372380880 GRCh37 Chromosome 8, 145740842: 145740842
30 RECQL4 NM_004260.3(RECQL4): c.1259-1G> A single nucleotide variant Pathogenic rs372380880 GRCh38 Chromosome 8, 144515458: 144515458
31 RECQL4 NM_004260.3(RECQL4): c.1568delG (p.Ser523Thrfs) deletion Pathogenic rs886043102 GRCh37 Chromosome 8, 145740372: 145740372
32 RECQL4 NM_004260.3(RECQL4): c.1568delG (p.Ser523Thrfs) deletion Pathogenic rs886043102 GRCh38 Chromosome 8, 144514988: 144514988
33 RECQL4 NM_004260.3(RECQL4): c.221_222delAG (p.Glu74Alafs) deletion Pathogenic rs773325186 GRCh37 Chromosome 8, 145742566: 145742567
34 RECQL4 NM_004260.3(RECQL4): c.221_222delAG (p.Glu74Alafs) deletion Pathogenic rs773325186 GRCh38 Chromosome 8, 144517182: 144517183
35 RECQL4 NM_004260.3(RECQL4): c.3293_3294insGCAGGATGAGGAGCGCAGCA (p.Arg1099Glnfs) insertion Likely pathogenic GRCh37 Chromosome 8, 145737393: 145737394
36 RECQL4 NM_004260.3(RECQL4): c.3293_3294insGCAGGATGAGGAGCGCAGCA (p.Arg1099Glnfs) insertion Likely pathogenic GRCh38 Chromosome 8, 144512010: 144512011
37 RECQL4 NM_004260.3(RECQL4): c.2336_2357delACCGGCCAGATGTGCGGGCTGT (p.Asp779Glyfs) deletion Likely pathogenic GRCh38 Chromosome 8, 144513324: 144513345
38 RECQL4 NM_004260.3(RECQL4): c.2336_2357delACCGGCCAGATGTGCGGGCTGT (p.Asp779Glyfs) deletion Likely pathogenic GRCh37 Chromosome 8, 145738707: 145738728
39 RECQL4 NM_004260.3(RECQL4): c.1149G> A (p.Trp383Ter) single nucleotide variant Pathogenic GRCh37 Chromosome 8, 145741257: 145741257
40 RECQL4 NM_004260.3(RECQL4): c.1149G> A (p.Trp383Ter) single nucleotide variant Pathogenic GRCh38 Chromosome 8, 144515873: 144515873

Expression for Rothmund-Thomson Syndrome

Search GEO for disease gene expression data for Rothmund-Thomson Syndrome.

Pathways for Rothmund-Thomson Syndrome

Pathways related to Rothmund-Thomson Syndrome according to GeneCards Suite gene sharing:

# Super pathways Score Top Affiliating Genes
1
Show member pathways
12.07 BLM CDC45 WRN
2 11.57 BLM CDC45 RECQL RECQL4 RECQL5 WRN
4 10.95 BLM MAPK1 WRN
5 10.7 C1QC MAPK1

GO Terms for Rothmund-Thomson Syndrome

Cellular components related to Rothmund-Thomson Syndrome according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 nucleus GO:0005634 9.81 BLM CDC45 HELLS MAPK1 RECQL RECQL4
2 replication fork GO:0005657 9.26 BLM WRN
3 chromosome, telomeric region GO:0000781 9.13 BLM RECQL4 WRN
4 chromosome GO:0005694 9.02 BLM RECQL RECQL4 RECQL5 WRN

Biological processes related to Rothmund-Thomson Syndrome according to GeneCards Suite gene sharing:

(show all 19)
# Name GO ID Score Top Affiliating Genes
1 cell cycle GO:0007049 9.86 CDC45 HELLS MAPK1 RECQL5
2 cellular response to DNA damage stimulus GO:0006974 9.83 BLM MAPK1 RECQL5 WRN
3 DNA repair GO:0006281 9.8 BLM RECQL RECQL4 RECQL5 WRN
4 DNA replication GO:0006260 9.65 BLM CDC45 RECQL4 RECQL5 WRN
5 telomere maintenance GO:0000723 9.58 RECQL4 WRN
6 base-excision repair GO:0006284 9.58 RECQL4 WRN
7 DNA metabolic process GO:0006259 9.57 RECQL5 WRN
8 replication fork processing GO:0031297 9.55 BLM WRN
9 DNA recombination GO:0006310 9.55 BLM RECQL RECQL4 RECQL5 WRN
10 response to X-ray GO:0010165 9.54 BLM RECQL5
11 DNA strand renaturation GO:0000733 9.54 BLM RECQL RECQL4
12 cellular metabolic process GO:0044237 9.51 BLM WRN
13 telomeric D-loop disassembly GO:0061820 9.5 BLM RECQL4 WRN
14 t-circle formation GO:0090656 9.49 BLM WRN
15 DNA synthesis involved in DNA repair GO:0000731 9.48 BLM WRN
16 G-quadruplex DNA unwinding GO:0044806 9.46 BLM WRN
17 cellular response to camptothecin GO:0072757 9.43 BLM RECQL5
18 double-strand break repair via homologous recombination GO:0000724 9.35 BLM RECQL RECQL4 RECQL5 WRN
19 DNA duplex unwinding GO:0032508 9.1 BLM CDC45 RECQL RECQL4 RECQL5 WRN

Molecular functions related to Rothmund-Thomson Syndrome according to GeneCards Suite gene sharing:

(show all 21)
# Name GO ID Score Top Affiliating Genes
1 nucleic acid binding GO:0003676 9.99 BLM RECQL RECQL4 RECQL5 WRN
2 single-stranded DNA binding GO:0003697 9.75 BLM CDC45 RECQL4
3 helicase activity GO:0004386 9.73 BLM HELLS RECQL RECQL4 RECQL5 WRN
4 ATP-dependent DNA helicase activity GO:0004003 9.65 BLM RECQL WRN
5 DNA helicase activity GO:0003678 9.62 BLM RECQL RECQL5 WRN
6 annealing helicase activity GO:0036310 9.61 BLM RECQL RECQL4
7 four-way junction DNA binding GO:0000400 9.58 BLM WRN
8 bubble DNA binding GO:0000405 9.58 BLM RECQL4 WRN
9 G-quadruplex DNA binding GO:0051880 9.57 BLM WRN
10 3'-5' DNA helicase activity GO:0043138 9.56 CDC45 WRN
11 Y-form DNA binding GO:0000403 9.55 BLM WRN
12 ATP-dependent helicase activity GO:0008026 9.55 BLM RECQL RECQL4 RECQL5 WRN
13 8-hydroxy-2'-deoxyguanosine DNA binding GO:1905773 9.54 BLM WRN
14 telomeric D-loop binding GO:0061821 9.54 BLM RECQL4 WRN
15 telomeric G-quadruplex DNA binding GO:0061849 9.52 BLM WRN
16 forked DNA-dependent helicase activity GO:0061749 9.49 BLM WRN
17 ATP-dependent 3'-5' DNA helicase activity GO:0043140 9.35 BLM RECQL RECQL4 RECQL5 WRN
18 four-way junction helicase activity GO:0009378 9.02 BLM RECQL RECQL4 RECQL5 WRN
19 DNA binding GO:0003677 10.08 BLM MAPK1 RECQL RECQL4 RECQL5 WRN
20 hydrolase activity GO:0016787 10.05 BLM HELLS RECQL RECQL4 RECQL5 USB1
21 ATP binding GO:0005524 10 BLM HELLS MAPK1 RECQL RECQL4 RECQL5

Sources for Rothmund-Thomson Syndrome

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 ExPASy
19 FMA
28 GO
29 GTR
30 HGMD
31 HMDB
32 HPO
33 ICD10
34 ICD10 via Orphanet
35 ICD9CM
36 IUPHAR
37 KEGG
38 LifeMap
40 LOVD
42 MedGen
44 MeSH
45 MESH via Orphanet
46 MGI
49 NCI
50 NCIt
51 NDF-RT
54 NINDS
55 Novoseek
57 OMIM
58 OMIM via Orphanet
62 PubMed
64 QIAGEN
69 SNOMED-CT via HPO
70 SNOMED-CT via Orphanet
71 TGDB
72 Tocris
73 UMLS
74 UMLS via Orphanet
Content
Loading form....