USH1C
MCID: USH039
MIFTS: 44

Usher Syndrome, Type Ic (USH1C)

Categories: Ear diseases, Eye diseases, Fetal diseases, Genetic diseases, Rare diseases

Aliases & Classifications for Usher Syndrome, Type Ic

MalaCards integrated aliases for Usher Syndrome, Type Ic:

Name: Usher Syndrome, Type Ic 56 71
Usher Syndrome, Type 1c 56 74 52 29 13 6 39
Ush1c 56 12 52 73
Usher Syndrome Type I Acadian Variety 12 73
Usher Syndrome Type 1c 12 15
Usher Syndrome Type Ic 12 73
Usher Syndrome, Type I, Acadian Variety 56
Usher Syndrome, Acadian Variety 52
Usher's Syndrome Type 1c 73
Acadian Usher Syndrome 73
Usher Syndrome 1c 73

Characteristics:

OMIM:

56
Inheritance:
autosomal recessive

Miscellaneous:
first described in acadian population of louisiana
allelic to deafness, neurosensory, autosomal recessive 18
later onset of hearing loss in some patients


HPO:

31
usher syndrome, type ic:
Inheritance autosomal recessive inheritance


Classifications:



External Ids:

Disease Ontology 12 DOID:0110830
OMIM 56 276904
OMIM Phenotypic Series 56 PS276900
MeSH 43 D052245
ICD10 32 H35.5
MedGen 41 C1848604
SNOMED-CT via HPO 68 258211005 28835009 700453005
UMLS 71 C1848604

Summaries for Usher Syndrome, Type Ic

OMIM : 56 Usher syndrome type I is an autosomal recessive condition characterized by profound congenital hearing impairment with unintelligible speech, early retinitis pigmentosa (usually evident within the first decade), and constant vestibular dysfunction. Type I is distinguished from type II (276901) on the basis of severity of hearing loss and the extent of vestibular involvement. Type I patients are profoundly deaf, whereas type II patients are 'hard of hearing.' Vestibular function is defective in type I patients, whereas type II patients have normal vestibular function (Moller et al., 1989). Patients with type III (USH3; 276902) have progressive hearing loss. For a discussion of genetic heterogeneity of Usher syndrome type I, see USH1 (276900). (276904)

MalaCards based summary : Usher Syndrome, Type Ic, also known as usher syndrome, type 1c, is related to deafness, autosomal recessive 57 and usher syndrome, type ig. An important gene associated with Usher Syndrome, Type Ic is USH1C (USH1 Protein Network Component Harmonin). Affiliated tissues include retina and eye, and related phenotypes are congenital sensorineural hearing impairment and rod-cone dystrophy

Disease Ontology : 12 An Usher syndrome type 1 that has material basis in homozygous or compound heterozygous mutation in the USH1C gene on chromosome 11p15.

UniProtKB/Swiss-Prot : 73 Usher syndrome 1C: USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa with sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). USH1 is characterized by profound congenital sensorineural deafness, absent vestibular function and prepubertal onset of progressive retinitis pigmentosa leading to blindness.

Wikipedia : 74 Usher syndrome, also known as Hallgren syndrome, Usher-Hallgren syndrome, retinitis pigmentosa-dysacusis... more...

Related Diseases for Usher Syndrome, Type Ic

Diseases in the Usher Syndrome family:

Usher Syndrome, Type I Usher Syndrome, Type Iia
Usher Syndrome, Type Iiia Usher Syndrome, Type Ic
Usher Syndrome, Type Id Usher Syndrome, Type if
Usher Syndrome, Type Iic Usher Syndrome, Type Ig
Usher Syndrome, Type Iid Usher Syndrome, Type Ih
Usher Syndrome, Type Iiib Usher Syndrome, Type Ij
Usher Syndrome, Type Ik Usher Syndrome, Type Iv
Usher Syndrome, Type 1m Usher Syndrome Type 2
Usher Syndrome, Type 2b

Diseases related to Usher Syndrome, Type Ic via text searches within MalaCards or GeneCards Suite gene sharing:

(show top 50) (show all 100)
# Related Disease Score Top Affiliating Genes
1 deafness, autosomal recessive 57 31.8 WHRN USH1C
2 usher syndrome, type ig 31.4 WHRN USH1G USH1C PCDH15 CDH23
3 autosomal recessive nonsyndromic deafness 36 31.2 WHRN USH1C PCDH15 CDH23
4 retinitis pigmentosa-deafness syndrome 30.7 WHRN CDH23
5 retinal disease 30.6 USH1G USH1C PCDH15 MYO7A CLRN1 CDH23
6 deafness, autosomal recessive 30.6 WHRN USH1C TMIE PCDH15 GJB2
7 usher syndrome, type if 30.4 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
8 bardet-biedl syndrome 30.4 WHRN USH1C PCDH15 MYO7A CLRN1 CDH23
9 deafness, autosomal recessive 16 30.4 USH1C TMIE PCDH15 GJB2 CDH23
10 inherited retinal disorder 30.3 USH1C PCDH15 MYO7A CLRN1 CDH23
11 eye degenerative disease 30.2 WHRN USH1C PCDH15 MYO7A CLRN1 CDH23
12 usher syndrome, type iiib 30.2 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
13 usher syndrome, type iiia 30.1 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
14 deafness, autosomal recessive 18a 30.1 USH1C PCDH15 MYO7A CDH23
15 fundus dystrophy 30.1 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
16 nonsyndromic deafness 30.0 PCDH15 GJB2
17 usher syndrome, type iia 30.0 WHRN USH1C PCDH15 MYO7A GJB2 CDH23
18 deafness, autosomal recessive 4, with enlarged vestibular aqueduct 30.0 USH1C TMIE TMC1 PCDH15 MYO7A GJB2
19 usher syndrome, type ij 29.9 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
20 usher syndrome, type ih 29.9 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
21 usher syndrome, type iid 29.9 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
22 usher syndrome, type iic 29.9 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
23 digenic disease 29.9 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
24 deafness, autosomal dominant 11 29.7 WHRN USH1G USH1C PCDH15 MYO7A GJB2
25 retinitis pigmentosa 29.6 WHRN USH1G USH1C TMC1 PCDH15 MYO7A
26 deafness, autosomal recessive 23 29.6 WHRN USH1G USH1C TMC1 PCDH15 MYO7A
27 usher syndrome type 2 29.4 WHRN USH1G USH1C TMC1 PCDH15 MYO7A
28 deafness, autosomal recessive 2 29.3 WHRN USH1G USH1C TMC1 PCDH15 MYO7A
29 rare genetic deafness 29.2 WHRN USH1C TMC1 PCDH15 MYO7A GJB2
30 sensorineural hearing loss 29.2 WHRN USH1G USH1C TMIE TMC1 SLC17A8
31 usher syndrome, type id 28.6 WHRN USH1G USH1C TMC1 PCDH15 MYO7A
32 nonsyndromic hearing loss 28.6 TMIE TMC1 PCDH15 MYO7A GJB2 CDH23
33 branchiootic syndrome 1 28.6 WHRN USH1G TMC1 MYO7A GJB2 CDH23
34 auditory system disease 28.2 WHRN USH1G USH1C TMIE TMC2 TMC1
35 deafness, autosomal recessive 12 28.1 WHRN USH1G USH1C TMIE TMC1 PCDH15
36 autosomal recessive non-syndromic sensorineural deafness type dfnb 27.8 WHRN USH1C TMIE TMC1 PCDH15 MYO7A
37 autosomal dominant nonsyndromic deafness 27.1 WHRN USH1G USH1C TMIE TMC2 TMC1
38 usher syndrome 26.1 WHRN USHBP1 USH1G USH1C TMIE TMC2
39 usher syndrome, type i 25.6 WHRN USHBP1 USH1G USH1C TMIE TMC2
40 retinal degeneration 11.6
41 autoimmune enteropathy 11.2
42 yemenite deaf-blind hypopigmentation syndrome 10.6
43 neuroretinitis 10.6
44 retinitis 10.6
45 ataxia, combined cerebellar and peripheral, with hearing loss and diabetes mellitus 10.4
46 polycystic kidney disease 10.3
47 deafness, autosomal recessive 83 10.3 MYO7A CDH23
48 deafness, autosomal recessive 13 10.3 TMC1 CDH23
49 deafness, autosomal recessive 6 10.2 TMIE TMC1
50 autosomal recessive disease 10.2

Graphical network of the top 20 diseases related to Usher Syndrome, Type Ic:



Diseases related to Usher Syndrome, Type Ic

Symptoms & Phenotypes for Usher Syndrome, Type Ic

Human phenotypes related to Usher Syndrome, Type Ic:

31
# Description HPO Frequency HPO Source Accession
1 congenital sensorineural hearing impairment 31 HP:0008527
2 rod-cone dystrophy 31 HP:0000510
3 vestibular hypofunction 31 HP:0001756

Symptoms via clinical synopsis from OMIM:

56
Head And Neck Ears:
vestibular hypofunction
sensorineural hearing loss, profound congenital

Head And Neck Eyes:
retinitis pigmentosa, progressive (prepubertal onset)
retinitis pigmentosa, sector type (in some patients)

Clinical features from OMIM:

276904

MGI Mouse Phenotypes related to Usher Syndrome, Type Ic:

45
# Description MGI Source Accession Score Top Affiliating Genes
1 behavior/neurological MP:0005386 10 CDH23 CLRN1 MYO7A PCDH15 SLC17A8 TMC1
2 hearing/vestibular/ear MP:0005377 9.93 CDH23 CLRN1 GJB2 MYO7A PCDH15 SLC17A8
3 nervous system MP:0003631 9.73 CDH23 CLRN1 GJB2 MYO7A PCDH15 SLC17A8
4 vision/eye MP:0005391 9.23 CDH23 CLRN1 GJB2 MYO7A PCDH15 USH1C

Drugs & Therapeutics for Usher Syndrome, Type Ic

Search Clinical Trials , NIH Clinical Center for Usher Syndrome, Type Ic

Genetic Tests for Usher Syndrome, Type Ic

Genetic tests related to Usher Syndrome, Type Ic:

# Genetic test Affiliating Genes
1 Usher Syndrome, Type 1c 29 USH1C

Anatomical Context for Usher Syndrome, Type Ic

MalaCards organs/tissues related to Usher Syndrome, Type Ic:

40
Retina, Eye

Publications for Usher Syndrome, Type Ic

Articles related to Usher Syndrome, Type Ic:

(show all 41)
# Title Authors PMID Year
1
A defect in harmonin, a PDZ domain-containing protein expressed in the inner ear sensory hair cells, underlies Usher syndrome type 1C. 61 56 6
10973247 2000
2
A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene. 61 6 56
10973248 2000
3
Exome sequencing identifies a founder frameshift mutation in an alternative exon of USH1C as the cause of autosomal recessive retinitis pigmentosa with late-onset hearing loss. 56 6
23251578 2012
4
Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study. 56 6
22135276 2012
5
Mutations in the USH1C gene associated with sector retinitis pigmentosa and hearing loss. 56 6
21487335 2011
6
The USH1C 216G-->A mutation and the 9-repeat VNTR(t,t) allele are in complete linkage disequilibrium in the Acadian population. 61 6
11810303 2002
7
Utilizing ethnic-specific differences in minor allele frequency to recategorize reported pathogenic deafness variants. 6
25262649 2014
8
Clinical utility gene card for: Usher syndrome. 6
21697857 2011
9
Survey of the frequency of USH1 gene mutations in a cohort of Usher patients shows the importance of cadherin 23 and protocadherin 15 genes and establishes a detection rate of above 90%. 6
16679490 2006
10
The contribution of USH1C mutations to syndromic and non-syndromic deafness in the UK. 6
12702164 2003
11
Identification of three novel mutations in the USH1C gene and detection of thirty-one polymorphisms used for haplotype analysis. 6
11139240 2001
12
Usher Syndrome Type I 6
20301442 1999
13
The Usher syndrome in the Lebanese population and further refinement of the USH2A candidate region. 6
9760205 1998
14
A high-resolution integrated physical, cytogenetic, and genetic map of human chromosome 11: distal p13 to proximal p15.1. 56
7789978 1995
15
Tightly linked flanking microsatellite markers for the Usher syndrome type I locus on the short arm of chromosome 11. 56
8128966 1994
16
Localization of two genes for Usher syndrome type I to chromosome 11. 56
1478678 1992
17
Clinical variability and genetic heterogeneity within the Acadian Usher population. 56
1415347 1992
18
Evidence against linkage of the gene for Usher's syndrome type 1 with group specific component (GC) on chromosome 4. 56
2241083 1990
19
Usher syndrome: an otoneurologic study. 56
2909824 1989
20
Linkage studies of Usher syndrome: analysis of an Acadian kindred in Louisiana. 56
3162715 1988
21
The hereditary syndrome of congenital deafness and retinitis pigmentosa. (Usher's syndrome). 56
5937908 1966
22
Fetal antisense oligonucleotide therapy for congenital deafness and vestibular dysfunction. 61
32249312 2020
23
Clarin-1 gene transfer rescues auditory synaptopathy in model of Usher syndrome. 61
29985171 2018
24
Antisense oligonucleotide therapy rescues disruptions in organization of exploratory movements associated with Usher syndrome type 1C in mice. 61
29037661 2018
25
Rescue of peripheral vestibular function in Usher syndrome mice using a splice-switching antisense oligonucleotide. 61
28633508 2017
26
Gene therapy restores auditory and vestibular function in a mouse model of Usher syndrome type 1c. 61
28165476 2017
27
Therapy strategies for Usher syndrome Type 1C in the retina. 61
24664766 2014
28
Harmonin (Ush1c) is required in zebrafish Müller glial cells for photoreceptor synaptic development and function. 61
21757509 2011
29
PTC124-mediated translational readthrough of a nonsense mutation causing Usher syndrome type 1C. 61
21235327 2011
30
An isoform of GTPase regulator DOCK4 localizes to the stereocilia in the inner ear and binds to harmonin (USH1C). 61
16464467 2006
31
Expression of AIE-75 PDZ-domain protein induces G2/M cell cycle arrest in human colorectal adenocarcinoma SW480 cells. 61
15219944 2004
32
Structure, diversity, and evolution of the 45-bp VNTR in intron 5 of the USH1C gene. 61
14962669 2004
33
Mouse models of USH1C and DFNB18: phenotypic and molecular analyses of two new spontaneous mutations of the Ush1c gene. 61
14519688 2003
34
Mutations in the alternatively spliced exons of USH1C cause non-syndromic recessive deafness. 61
12136232 2002
35
Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC. 61
12107438 2002
36
Two families from New England with usher syndrome type IC with distinct haplotypes. 61
11239869 2001
37
Assembly of a high-resolution map of the Acadian Usher syndrome region and localization of the nuclear EF-hand acidic gene. 61
9639681 1998
38
A gene for recessive nonsyndromic sensorineural deafness (DFNB18) maps to the chromosomal region 11p14-p15.1 containing the Usher syndrome type 1C gene. 61
9653658 1998
39
Construction of a YAC contig encompassing the Usher syndrome type 1C and familial hyperinsulinism loci on chromosome 11p14-15.1. 61
8828039 1996
40
Fine mapping of the usher syndrome type IC to chromosome 11p14 and identification of flanking markers by haplotype analysis. 61
9238080 1995
41
Molecular cloning of the human homolog of a striatum-enriched phosphatase (STEP) gene and chromosomal mapping of the human and murine loci. 61
7490079 1995

Variations for Usher Syndrome, Type Ic

ClinVar genetic disease variations for Usher Syndrome, Type Ic:

6 (show top 50) (show all 199) ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎
# Gene Name Type Significance ClinVarId dbSNP ID GRCh37 Pos GRCh38 Pos
1 USH1C NM_153676.4(USH1C):c.496+1G>TSNV Pathogenic 551814 rs138138689 11:17548769-17548769 11:17527222-17527222
2 USH1C NM_153676.4(USH1C):c.1211-1175deldeletion Pathogenic 555064 rs1207247951 11:17539012-17539012 11:17517465-17517465
3 USH1C NM_153676.4(USH1C):c.497-2deldeletion Pathogenic 5140 11:17548589-17548589 11:17527042-17527042
4 USH1C NM_005709.3(USH1C):c.238dupC (p.Arg80Profs)duplication Pathogenic 5141 rs397515359 11:17552955-17552956 11:17531408-17531409
5 USH1C NM_153676.4(USH1C):c.216G>A (p.Val72=)SNV Pathogenic 5143 rs151045328 11:17552978-17552978 11:17531431-17531431
6 USH1C NM_153676.4(USH1C):c.36+1G>TSNV Pathogenic 5144 11:17565818-17565818 11:17544271-17544271
7 USH1C USH1C, IVS5DS, G-A, +1SNV Pathogenic 5145
8 USH1C NM_153676.4(USH1C):c.91C>T (p.Arg31Ter)SNV Pathogenic 5146 rs121908370 11:17554815-17554815 11:17533268-17533268
9 USH1C NM_153676.4(USH1C):c.2227-1G>ASNV Pathogenic 39428 11:17523083-17523083 11:17501536-17501536
10 USH1C USH1C, 1-BP DEL, 1220Gdeletion Pathogenic 39429
11 USH1C NM_153676.4(USH1C):c.7C>T (p.Arg3Ter)SNV Pathogenic 218193 rs876657624 11:17565848-17565848 11:17544301-17544301
12 USH1C NM_153676.4(USH1C):c.496+1G>ASNV Pathogenic 371732 rs138138689 11:17548769-17548769 11:17527222-17527222
13 USH1C NM_153676.4(USH1C):c.672C>A (p.Cys224Ter)SNV Pathogenic/Likely pathogenic 556381 rs1223763703 11:17547896-17547896 11:17526349-17526349
14 USH1C NM_153676.4(USH1C):c.760-1G>TSNV Likely pathogenic 553618 rs1187887456 11:17545026-17545026 11:17523479-17523479
15 USH1C NM_153676.4(USH1C):c.674+2T>GSNV Likely pathogenic 554188 rs1298596518 11:17547892-17547892 11:17526345-17526345
16 USH1C NM_153676.4(USH1C):c.2381-2A>GSNV Likely pathogenic 557217 rs1465352266 11:17519820-17519820 11:17498273-17498273
17 USH1C NM_153676.4(USH1C):c.2227-1G>TSNV Likely pathogenic 551392 rs778110397 11:17523083-17523083 11:17501536-17501536
18 USH1C NM_153676.4(USH1C):c.841_848del (p.Ser281fs)deletion Likely pathogenic 424972 rs1064797153 11:17544786-17544793 11:17523239-17523246
19 USH1C NM_153676.4(USH1C):c.748_759+5deldeletion Likely pathogenic 437936 rs1355262412 11:17545993-17546009 11:17524446-17524462
20 USH1C NM_153676.4(USH1C):c.1039C>T (p.Gln347Ter)SNV Likely pathogenic 500413 rs762551629 11:17542939-17542939 11:17521392-17521392
21 USH1C NM_153676.4(USH1C):c.248+1G>ASNV Likely pathogenic 555472 rs1482487617 11:17552945-17552945 11:17531398-17531398
22 USH1C NM_153676.4(USH1C):c.1A>G (p.Met1Val)SNV Likely pathogenic 554131 rs1554965967 11:17565854-17565854 11:17544307-17544307
23 USH1C NM_153676.4(USH1C):c.2546+1G>TSNV Likely pathogenic 549987 rs1554953350 11:17518304-17518304 11:17496757-17496757
24 USH1C NM_153676.4(USH1C):c.1020-2A>CSNV Likely pathogenic 551676 rs147956944 11:17542960-17542960 11:17521413-17521413
25 USH1C NM_153676.4(USH1C):c.2281-1G>ASNV Likely pathogenic 552730 rs1554954574 11:17522698-17522698 11:17501151-17501151
26 USH1C NM_153676.4(USH1C):c.2326dup (p.Ile776fs)duplication Likely pathogenic 555137 rs758555088 11:17522651-17522652 11:17501104-17501105
27 USH1C NM_153676.4(USH1C):c.1146dup (p.Gln383fs)duplication Likely pathogenic 555436 rs1554960388 11:17542480-17542481 11:17520933-17520934
28 USH1C NM_153676.4(USH1C):c.1139del (p.Gly379_Ser380insTer)deletion Likely pathogenic 553726 rs1554960390 11:17542488-17542488 11:17520941-17520941
29 USH1C NM_153676.4(USH1C):c.877-1G>ASNV Likely pathogenic 553769 rs771279169 11:17544474-17544474 11:17522927-17522927
30 USH1C NM_153676.4(USH1C):c.819+1G>ASNV Likely pathogenic 558029 rs1554961152 11:17544965-17544965 11:17523418-17523418
31 USH1C NM_153676.4(USH1C):c.579+1G>CSNV Likely pathogenic 551520 rs1283092935 11:17548299-17548299 11:17526752-17526752
32 USH1C NM_153676.4(USH1C):c.2490+2T>CSNV Likely pathogenic 556802 rs1554953745 11:17519707-17519707 11:17498160-17498160
33 USH1C NM_153676.4(USH1C):c.2490+1G>TSNV Likely pathogenic 557880 rs1554953746 11:17519708-17519708 11:17498161-17498161
34 USH1C NM_153676.4(USH1C):c.2281-2A>GSNV Likely pathogenic 553146 rs921755529 11:17522699-17522699 11:17501152-17501152
35 USH1C NM_153676.4(USH1C):c.2280+2T>CSNV Likely pathogenic 554114 rs1554954681 11:17523027-17523027 11:17501480-17501480
36 USH1C NM_153676.4(USH1C):c.2185-2A>GSNV Likely pathogenic 554334 rs1358056232 11:17523529-17523529 11:17501982-17501982
37 USH1C NM_153676.4(USH1C):c.104+1G>ASNV Likely pathogenic 556011 rs1287021691 11:17554801-17554801 11:17533254-17533254
38 USH1C NM_153676.4(USH1C):c.674+1G>ASNV Likely pathogenic 553492 rs775496999 11:17547893-17547893 11:17526346-17526346
39 USH1C NM_153676.4(USH1C):c.674+1deldeletion Likely pathogenic 554349 rs1554961872 11:17547893-17547893 11:17526346-17526346
40 USH1C NM_153676.4(USH1C):c.463C>T (p.Arg155Ter)SNV Likely pathogenic 371731 rs377145777 11:17548803-17548803 11:17527256-17527256
41 USH1C NM_153676.4(USH1C):c.790G>A (p.Val264Ile)SNV Conflicting interpretations of pathogenicity 303809 rs79875849 11:17544995-17544995 11:17523448-17523448
42 USH1C NM_153676.4(USH1C):c.1211-1175G>ASNV Conflicting interpretations of pathogenicity 303804 rs143923730 11:17539012-17539012 11:17517465-17517465
43 USH1C NM_153676.4(USH1C):c.-60T>CSNV Conflicting interpretations of pathogenicity 303817 rs371444878 11:17565914-17565914 11:17544367-17544367
44 USH1C NM_153676.4(USH1C):c.*42C>TSNV Conflicting interpretations of pathogenicity 303800 rs16934270 11:17515837-17515837 11:17494290-17494290
45 USH1C NM_153676.4(USH1C):c.921G>A (p.Ala307=)SNV Conflicting interpretations of pathogenicity 228197 rs778447994 11:17544429-17544429 11:17522882-17522882
46 USH1C NM_153676.4(USH1C):c.759+10G>TSNV Conflicting interpretations of pathogenicity 303811 rs368528034 11:17545988-17545988 11:17524441-17524441
47 USH1C NM_153676.4(USH1C):c.*405C>GSNV Conflicting interpretations of pathogenicity 303794 rs11827649 11:17515474-17515474 11:17493927-17493927
48 USH1C NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]short repeat Conflicting interpretations of pathogenicity 5142 rs55983148 11:17548737-17548737 11:17527112-17527113
49 USH1C NM_153676.4(USH1C):c.308G>A (p.Arg103His)SNV Conflicting interpretations of pathogenicity 39427 rs397514500 11:17552780-17552780 11:17531233-17531233
50 USH1C NM_153676.4(USH1C):c.1211-1134G>ASNV Conflicting interpretations of pathogenicity 45426 rs115931035 11:17538971-17538971 11:17517424-17517424

Expression for Usher Syndrome, Type Ic

Search GEO for disease gene expression data for Usher Syndrome, Type Ic.

Pathways for Usher Syndrome, Type Ic

GO Terms for Usher Syndrome, Type Ic

Cellular components related to Usher Syndrome, Type Ic according to GeneCards Suite gene sharing:

(show all 11)
# Name GO ID Score Top Affiliating Genes
1 plasma membrane GO:0005886 10.19 WHRN USH1G USH1C TMC2 TMC1 PCDH15
2 synapse GO:0045202 9.88 WHRN USH1C SLC17A8 PCDH15 MYO7A
3 photoreceptor outer segment GO:0001750 9.61 USH1C PCDH15 MYO7A
4 microvillus GO:0005902 9.58 USH1C MYO7A CLRN1
5 photoreceptor inner segment GO:0001917 9.56 WHRN USH1G USH1C MYO7A
6 stereocilium bundle GO:0032421 9.46 WHRN DOCK4
7 photoreceptor connecting cilium GO:0032391 9.46 WHRN USH1G USH1C MYO7A
8 stereocilia ankle link complex GO:0002142 9.37 WHRN USH1C
9 stereocilia ankle link GO:0002141 9.32 WHRN USH1C
10 stereocilium tip GO:0032426 9.26 WHRN USH1C TMC2 TMC1
11 stereocilium GO:0032420 9.17 WHRN USH1C PCDH15 MYO7A DOCK4 CLRN1

Biological processes related to Usher Syndrome, Type Ic according to GeneCards Suite gene sharing:

(show all 17)
# Name GO ID Score Top Affiliating Genes
1 visual perception GO:0007601 9.81 PCDH15 MYO7A CLRN1 CDH23
2 inner ear morphogenesis GO:0042472 9.76 USH1G USH1C TMIE MYO7A
3 actin filament organization GO:0007015 9.74 PCDH15 MYO7A CLRN1
4 inner ear receptor cell stereocilium organization GO:0060122 9.73 WHRN USH1G USH1C PCDH15 MYO7A CDH23
5 photoreceptor cell maintenance GO:0045494 9.72 USH1G USH1C PCDH15 CLRN1 CDH23
6 auditory receptor cell stereocilium organization GO:0060088 9.71 WHRN PCDH15 MYO7A CLRN1
7 inner ear development GO:0048839 9.67 PCDH15 MYO7A GJB2
8 detection of mechanical stimulus involved in sensory perception of sound GO:0050910 9.67 WHRN TMC2 TMC1 PCDH15
9 equilibrioception GO:0050957 9.63 USH1G USH1C PCDH15 MYO7A CLRN1 CDH23
10 inner ear auditory receptor cell differentiation GO:0042491 9.61 USH1C PCDH15 MYO7A
11 inner ear receptor cell development GO:0060119 9.56 WHRN USH1C
12 regulation of calcium ion transmembrane transport GO:1903169 9.55 TMC2 TMC1
13 auditory receptor cell development GO:0060117 9.54 TMC1 CLRN1
14 inner ear receptor cell differentiation GO:0060113 9.52 USH1G MYO7A
15 sensory perception of light stimulus GO:0050953 9.5 WHRN USH1G USH1C PCDH15 MYO7A CLRN1
16 vestibular reflex GO:0060005 9.48 TMC2 TMC1
17 sensory perception of sound GO:0007605 9.36 WHRN USH1G USH1C TMIE TMC1 SLC17A8

Molecular functions related to Usher Syndrome, Type Ic according to GeneCards Suite gene sharing:

# Name GO ID Score Top Affiliating Genes
1 mechanosensitive ion channel activity GO:0008381 8.96 TMC2 TMC1
2 spectrin binding GO:0030507 8.8 USH1G USH1C MYO7A

Sources for Usher Syndrome, Type Ic

3 CDC
7 CNVD
9 Cosmic
10 dbSNP
11 DGIdb
17 EFO
18 ExPASy
19 FMA
28 GO
29 GTR
30 HMDB
31 HPO
32 ICD10
33 ICD10 via Orphanet
34 ICD9CM
35 IUPHAR
36 KEGG
37 LifeMap
39 LOVD
41 MedGen
43 MeSH
44 MESH via Orphanet
45 MGI
48 NCI
49 NCIt
50 NDF-RT
53 NINDS
54 Novoseek
56 OMIM
57 OMIM via Orphanet
61 PubMed
63 QIAGEN
68 SNOMED-CT via HPO
69 TGDB
70 Tocris
71 UMLS
72 UMLS via Orphanet
Content
Loading form....